Effects of microbial-derived long-chain polyunsaturated fatty acids from Aurantiochytrium limacinum BCC52274 and Mortierella sp. on growth and immunity in Litopenaeus vannamei post-larvae

Virak Visudtiphole; Panida Unagul; Sage Chaiyapechara; Waraporn Jangsutthivorawat; Metavee Phromson; Siriporn Tala; Pacharawan Deenarn; Punsa Tobwor; Pisut Yotbuntueng; Surasak Jiemsup; Suganya Yongkiettrakul; Looksorn Koichai; Wananit Wimuttisuk

doi:10.1371/journal.pone.0329358

Abstract

The rapid growth of the aquaculture industry has increased the demand for feed ingredients, resulting in a shortage of fishmeal and fish oil, the latter of which serves as a source of essential fatty acids in aquaculture feed. As dietary supplementation of long-chain polyunsaturated fatty acids (LC-PUFA) improved growth and strengthened immunity in marine larvae, alternative sources for LC-PUFA are required to maintain sustainable aquaculture practice. This study explored the use of Aurantiochytrium limacinum BCC52274 (AL) and oil extracted from Mortierella sp. (ARASCO) as the source of LC-PUFA for the Pacific white shrimp Litopenaeus vannamei post-larvae (PLs) by using Artemia as a carrier. The Artemia were first enriched with combinations of AL and ARASCO with varying ratios of DHA:ARA at 100:0, 75:25, 50:50, 25:75, and 0:100, which were designated as Groups A, B, C, D, and E, respectively. The unenriched Artemia in Group R served as a control. The L. vannamei PL1 were fed with these Artemia for 18 days, revealing that the PL18 in Group A contained the highest biomass and average body weight among all feed groups. Meanwhile, other ratios of DHA:ARA supplementation were more beneficial to shrimp immunity, as the PL18 from Group D expressed the highest levels of prophenoloxidase II transcripts among all feed groups. The increasing proportion of ARA in the enriched Artemia also increased the levels of anti-inflammatory eicosanoids, including 15-deoxy-Δ^12,14-prostaglandin J₂, 11-hydroxyeicosatetraenoic acid (11-HETE), and 12-HETE. When these PLs were infected with white spot syndrome virus (WSSV), the PLs from Groups A, C, D, and E contained lower WSSV copy numbers compared with Group R, suggesting that the supplementation of LC-PUFAs from AL and ARASCO strengthened the immunity of these PLs against viral infection. However, the challenge with Vibrio harveyi resulted in no significant difference in the mean survival rates of PLs in all feed groups. Our results indicate that AL and ARASCO are more sustainable alternative sources of essential fatty acids that can be used strategically to enhance the growth and immunity of L. vannamei PLs.

Citation: Visudtiphole V, Unagul P, Chaiyapechara S, Jangsutthivorawat W, Phromson M, Tala S, et al. (2025) Effects of microbial-derived long-chain polyunsaturated fatty acids from Aurantiochytrium limacinum BCC52274 and Mortierella sp. on growth and immunity in Litopenaeus vannamei post-larvae. PLoS One 20(7): e0329358. https://doi.org/10.1371/journal.pone.0329358

Editor: Lee Seong, Universiti Malaysia Kelantan, MALAYSIA

Received: June 10, 2025; Accepted: July 15, 2025; Published: July 31, 2025

Copyright: © 2025 Visudtiphole et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the manuscript and its Supporting Information files.

Funding: This research has received funding support from the Functional Ingredient & Food Innovation Program, National Center for Genetic Engineering and Biotechnology [grant number P19-51807] to VV and the NSRF via the Program Management Unit for Human Resources & Institutional Development, Research and Innovation [grant number B05F640184] to WW.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Dietary supplementation of long-chain polyunsaturated fatty acids (LC-PUFA) enhances the growth and health of larval marine animals in domestication [1–6]. The expansion of the aquaculture industry has increased the demand for LC-PUFA supplementation, which has traditionally been sourced from fish oil. Due to the scarcity of fish oil, alternative sources of essential fatty acids are required for future feed production [7,8]. Aurantiochytrium limacinum (AL), which produces high levels of n-3 LC-PUFA, has previously been shown to promote growth, swimming strength, and hypo-salinity tolerance in the Pacific white shrimp Litopenaeus vannamei post-larvae (PLs) [9]. Similarly, Mortierella alpina can produce lipids mainly composed of triacylglycerol with high quantities of arachidonic acid (ARA; 20:4n-6) [10,11] and used as feed supplementation in poultry [12].

In shrimp post-larvae (PLs), LC-PUFA supplementation was often performed via the enrichment of Artemia live feed [4,13]. Artemia enriched with n-3 highly unsaturated fatty acids has been shown to enhance resistance to osmotic stress in the PLs of black tiger shrimp Penaeus monodon [13]. Similarly, Artemia supplemented with fish liver oil rich in docosahexaenoic acid (DHA, C22:6n-3) promoted the growth and health quality of the Indian prawn Penaeus indicus PLs [4]. Although the growth-promoting effects of n-3 LC-PUFA in feed supplementation were confirmed, the effects of dietary arachidonic acid (ARA, C20:4n-6) on PL growth varied in the juvenile freshwater prawn Macrobrachium rosenbergii and the Chinese prawn broodstock Penaeus chinensis [14,15], but showed positive correlations in P. monodon [16,17]. ARA supplementation also positively affects L. vannamei immune responses [18,19]. The mechanism by which ARA enhances immune responses is likely through the production of eicosanoids, a series of oxygenated polyunsaturated fatty acids that serve as signaling molecules for the pro- and anti-inflammatory responses. Although the roles of eicosanoids in immunity have been established in mammals [20,21], the known functions of eicosanoids in crustaceans are limited to ovarian maturation and sperm development [22–27]. The correlations between dietary LC-PUFA and the levels of eicosanoids have yet to be demonstrated in L. vannamei.

Earlier, n-3 LC-PUFA supplementation was studied in L. vannamei PLs and found to promote growth performance, swimming strength, and hypo-salinity tolerance in the PLs. However, it did not affect the immunity and disease resistance of the shrimp [9]. On the other hand, n-6 LC-PUFAs are more related to the primary inflammatory mechanism defending against diseases [28]. In this study, dietary supplementation of Aurantiochytrium limacinum BCC52274 (AL) and Mortierella-extracted oil (ARASCO) as n-3 and n-6 LC-PUFA sources for L. vannamei PL was investigated. The supplementation was performed by enriching live Artemia, which was later fed to the PLs. The growth performance and changes in the free fatty acid profile of the PLs were examined. Additionally, a connection between n-3 and n-6 LC-PUFA supplementation and the levels of eicosanoids was established for the first time in L. vannamei. Immunological effects of the n-3 and n-6 LC-PUFA supplementation were assessed using the transcriptional analysis of shrimp immune genes as well as pathogenic challenge. Our analysis provided information for a strategic selection of microbial-derived LC-PUFA supplementation for L. vannamei PL to suit the different requirements of the aquaculture industry.

Materials and methods

The preparation of A. limacinum BCC52274

AL strain BCC52274 (obtained from the National Biobank of Thailand) was cultured in a medium composed of 1.5% (w/v) sea salt, 10% (w/v) glucose, and 2% yeast extract. The culture was maintained in a 10-L fermenter at 28°C with aeration for 3 days as previously described [29,30]. AL cells were harvested by 3,000 × g centrifugation and washed twice with 0.9% normal saline. Cells were freeze-dried, sealed in light-protected plastic bags, stored at −20°C, and used within 1 month.

The formulation of the enrichment emulsion

ARASCO (DSM, Switzerland), an ARA-rich oil extracted from Mortierella sp., was used as the dietary n-6 LC-PUFA source. The oil-in-water emulsion was prepared using a vacuum blender by blending ARASCO with 30-ppt seawater. Sodium polysorbate (12 μL/L) and alpha-tocopherol (4 mg/L) were added as an emulsifier and antioxidant, respectively [31,32]. Dried AL cells were dispersed into the emulsion through a 120T polyester mesh (100-μm pore size). Proportions of the dried AL and ARASCO contents in the cell and emulsion mixture varied according to the DHA and ARA ratios in the S1 Table. The control group (R, 0:0) contained only sodium polysorbate and alpha-tocopherol without AL and ARASCO.

The enrichment of live Artemia

Artemia cysts (Salt Lake, USA) were hatched in 30 ppt seawater with vigorous aeration for 27–31 hours to reach the instar-II stage. Artemia was then enriched with the prepared emulsion for 4 hours at the ratio of 200,000 individuals in 1 L of 30-ppt water containing 90 mg of the combined total DHA and ARA content. Finally, the Artemia were harvested, stored at 4°C, and used for the experiment within 24 hours.

Experimental animals

Specific pathogen-free L. vannamei at stage-3 mysis were obtained from a commercial hatchery in Eastern Thailand. The mysis were randomly distributed into each rearing tank (cylindrical cone-bottom fiberglass tank, 0.75 m diameter), which contained 150 L of 30-ppt sea water at the density of 100 individuals/L with aeration supplied by air stones. The mysis was acclimated until > 80% of the shrimp entered the post-larval (PL)-1 stage (approximately 1.5 days) before the actual feeding experiment started. During acclimatization, instar-I Artemia knocked by quick blanching was offered to the larvae for 6 meals/day. All animal experiment protocols were approved by the National Center for Genetic Engineering and Biotechnology Institutional Animal Care and Use Committee (Approval code: BT-Animal 08/2563) and carried out according to the relevant guidelines and regulations.

Feeding experiment

The experiment was divided into six groups, each randomly assigned to 3 rearing tanks. Fifteen thousand shrimp were randomly distributed into each tank, containing 150 L of 30-ppt water. At PL13, the water volume was adjusted to 180 L to accommodate the larger size of the PL. The enrichment experiment began with the PL-1 stage, which were fed 6 times daily with Artemia enriched with varying DHA:ARA ratios for 18 days. Each PL group was fed to satiation, and the feeding ration for the next meal was adjusted based on the leftover amount of Artemia to compensate for the potential difference in the quantity of Artemia consumed caused by the varying enrichment.

To maintain water quality, daily water exchange was conducted at the rate of 30–50%. The water quality was maintained in the following ranges: dissolved oxygen level > 5 mg/L, pH between 7.5–8.5, temperature between 30–32°C, salinity at 30 ppt, ammonia nitrogen < 0.03 mg/L, nitrite nitrogen < 1 mg/L, and alkalinity between 100–150 mg CaCO₃/L.

Evaluation of growth performance and sample collection

On day 18, the PL18 were starved for 5 hours before being collected to measure the growth performance. The average body weight was determined by counting the number of PL ranging from 1.5–2 mg total weight (2 count replicates/tank). The survival rate was calculated from the final biomass and the average individual weight data. The length of PL from each tank (N = 100) was measured from the end of the rostrum to the end of the telson. The percentage coefficient of length variation was calculated from the average length of the PL.

Pathogen challenges

The Vibrio harveyi challenge was performed by transferring 20 PLs from each feeding tank to a glass cylinder containing 25 L of aerated 30-ppt water with the V. harveyi at 0, 7.96x10⁶, or 1.58x10⁷ CFU/mL. After 24 hours, the water volume in each cylinder was adjusted to 30 L with non-contaminated 30-ppt water, in which 50% of the water was exchanged daily, and the water was always aerated. During the challenge, the PL19 were fed with plain instar-II Artemia and maintained for 2 days before assessment of the survival.

The white spot syndrome virus (WSSV) infection in PLs was induced by ingesting the muscle tissue homogenate from WSSV-infected L. vannamei juveniles. The infected meat was prepared by injecting 300 µL of WSSV at a concentration of 10² copies/µL into 30−40 g juveniles (7 months old). The infected juveniles were maintained in 25-ppt water for 3 days. The muscle tissue of the infected moribund shrimp was dissected, minced, and stored at −20°C until offered to the challenged PL.

For the WSSV challenge, 35 PLs from each feeding experiment tank were transferred to a glass cylinder containing 20 L of aerated 30-ppt water. The PLs were starved for 18 hours and then fed twice within 6 hours with the prepared WSSV-infected meat at the rate of 66.29% of their average body weight/meal. A control was also set up separately for each group, in which PLs were fed with muscle tissue homogenate from a non-infected juvenile. The PLs were maintained by feeding on non-enriched Instar-II Artemia. Fifty percent of the rearing water was changed daily. After two days, the challenged PLs were collected, flash-frozen in liquid N₂ and stored at −80°C.

Quantitative real-time PCR analysis to detect WSSV copy number

The DNA of WSSV-infected PLs (N = 35) was extracted using the QiaAmp DNA Mini Kit (Qiagen, Hilden, Germany) and treated with RNase A (Qiagen). The PCR was performed according to Srisala et al. 2008, in which the WSSV-detection primers are WSSV-229F1: 5’ GATGGAAACGGTAACGAATCTGAA 3’ and WSSV-447R1: 5’ CAGAGCCTAGTCTATCAATCA T 3’ [33]. The DNA template used to construct the standard curve was a purified 1447-bp amplicon from the WSSV-DNA [34]. The standard curve was constructed using a 10-fold serial dilution of the WSSV-DNA from 10² to 10⁷ copies/reaction, resulting in a 99.4% amplification efficiency. The qPCR reaction included 0.1 ng of the extracted DNA, 10 µL of the 2x SYBR Green (Biorad, California, USA), 5 µM of each primer, and PCR-grade water for a final volume of 20 µL. The PCR condition was 1 cycle of 98°C for 3 min, 40 cycles of 98°C for 30 s, 55°C for 30 s, and 72°C for 30 s, with 1 final cycle of 72°C for 45 s.

Fatty acid analysis using gas chromatography flame ionization detector (GC-FID)

Fatty acid extraction and trans-esterification were performed according to Visudthiphole et al. (2018) [9]. Briefly, the fatty acids from the freeze-dried samples were directly extracted and trans-esterified in 4% sulfuric acid in methanol by heating to 90°C for 1 hour [35]. Heptadecaenoic acid (C17:0) or nonadecanoic acid (C19:0) (Sigma-Aldrich) was used as an internal standard. The extracted fatty acid samples were analyzed using the Shimadzu GC-17A high precision gas chromatography (Shimadzu, Japan) equipped with the Omegawax^TM 250, 30 m x 0.25 mm fused silica capillary column (Supelco, Sigma-Aldrich, Massachusetts, USA) and flame ionization detector (FID) following the analysis performed by Visudtiphole et al. 2021 [30]. Helium was selected as a carrier gas with an average linear velocity of 30 cm/s. Temperatures for the injector and detector were set at 250°C and 260°C, respectively. The initial column temperature was set and maintained at 200°C for 10 min and then increased at a rate of 20°C/min to 230°C. Subsequently, the column temperature was held for 17 min. The peak identification and quantification were analyzed based on the retention times relative to fatty acid methyl ester standards (Supelco 18919−1 AMP, Sigma-Aldrich). Each fatty acid was identified and quantified based on the retention time of each peak relative to the fatty acid methyl ester standard peaks.

RNA extraction and cDNA synthesis

L. vannamei PL18 (N = 30) were subjected to total RNA extraction using the Trizol reagent (Invitrogen, California, USA). The obtained RNA samples were treated with RNase-Free DNase (Promega, Wisconsin, USA). One microgram of total RNA was reverse transcribed using the RevertAid^TM First Strand cDNA Synthesis Kit with oligo (dT)₁₈ primers (Thermo Scientific, Massachusetts, USA). The reaction volume was 20 µL per reaction, resulting in a final total RNA concentration of 50 ng/µL. The cDNA concentration from each sample was determined using the Thermo Scientific™ NanoDrop™ One Microvolume UV-Vis Spectrophotometer (Thermo Scientific).

Gene expression analysis

Expression analysis of shrimp immune genes was performed on cDNA samples using the SsoFast EvaGreen Supermix (Bio-Rad, California, USA) according to the manufacturer’s instructions. One hundred nanograms of cDNA were used as templates for each real-time PCR reaction. Primer sequences for immune genes are provided in the S2 Table. Melt curve analysis was performed for each pair of primers as previously described [36]. Amounts of target gene transcripts relative to elongation factor 1α (EF1α) were obtained using the standard curve method. Amplification efficiency was between 95–105%. The specificity of the PCR product was confirmed using melting curve analysis with a continuous fluorescence reading at 0.5°C increments from 55°C to 95°C.

Ethyl acetate extraction of PL samples

Ethyl acetate extraction of PL was adapted from Yotbuntueng et al. 2022 [27]. PLs were homogenized in liquid nitrogen and diluted in HBSS (Sigma-Aldrich) at a concentration of 0.1 g/mL. The homogenates were mixed with 10% BHT in HPLC-grade ethanol (w/v) and 5 µL of 20 μM PGE₂-d₄, 5-HETE-d₈, and EPA-d₅ as an antioxidant and internal standards, respectively. An equal volume of ethyl acetate was added to the PL homogenates, and the mixture was mixed vigorously for 15 min. To collect the organic phase, the extract was spun down at 8,228 × g for 10 min at 20°C. Another equal volume of ethyl acetate was added to the aqueous phase, and the extraction process was repeated. The PL extract was dried using the rotary evaporator and stored at −80°C.

Ultra-high performance liquid chromatography-high resolution tandem mass spectrometry (UHPLC-HRMS/MS) analysis

The UHPLC-HRMS/MS analysis was performed via a DIONEX 3000 RS UHPLC system coupled with an Orbitrap Fusion™ Tribrid™ mass spectrometer (Thermo Fisher Scientific). The system was operated using the Xcalibur software (version 4.4.16.14) and calibrated with the Pierce™ FlexMix™ calibration solution (Thermo Fisher Scientific). Parameters for the UHPLC conditions and mass spectrometer analysis were conducted as previously described [27].

Statistical analysis

The statistical analyses were performed using a one-way analysis of variance (ANOVA) with Duncan’s multiple range test (DMRT) (SPSS 11.5.0) with a threshold for significance at P < 0.05. Dunnett’s test was performed for the WSSV and V. harveyi challenges to compare the LC-PUFA supplemented samples to the control group (* for P < 0.05 and ** for P < 0.01).

Results

The effects of supplementing n-3 and n-6 LC-PUFAs derived from AL and ARASCO in L. vannamei PLs were determined according to the experimental outline shown in Fig 1. Briefly, Artemia, a live feed commonly used for PL, were enriched with different ratios of AL to ARASCO via immersion. Five groups of the enriched Artemia (Groups A to E) and a control (Group R) were fed to L. vannamei PL1 for 18 days. The effects of n-3 and n-6 LC-PUFA enrichment were performed by monitoring biomass, fatty acid profiles, eicosanoid profiles, and gene expression levels. The remaining PLs were divided into two groups to be challenged with WSSV and V. harveyi to determine the immunological effects of n-3 and n-6 LC-PUFA supplementation on the PLs.

Download:

Fig 1. Schematic diagram outlining the experiments used to determine the effects of n-3 and n-6 LC-PUFA from AL and ARASCO on L. vannamei PLs.

Created in BioRender. Wimuttisuk, W. (2025) https://BioRender.com/nknnhk8.

https://doi.org/10.1371/journal.pone.0329358.g001

GC-FID analysis was performed on the Artemia, which had previously been enriched with AL and ARASCO to obtain different ratios of DHA:ARA. The fatty acid profiles of Artemia with and without supplementation are shown in S3 Table, in which the ratios of DHA:ARA calculated from the percentage of total fatty acids (%TFA) were 13.95:1, 1.19:1, 0.18:1, 0.10:1, and 0.00:1 for the Artemia in Groups A, B, C, D, and E, respectively.

The supplemented Artemia were given to L. vannamei PL1 for 18 days, and the resulting PL18 were analyzed using GC-FID to determine fatty acid profiles (Table 1). The fatty acid compositions and the total fatty acid content in PL18 corresponded with those in the offered feed. For example, the short-chain fatty acid (SFA) content of the PLs from Group A was the highest among all PL groups due to the high content of C16:0 found in the AL. Similarly, the PLs fed with Artemia enriched with increasing proportions of AL to ARASCO also contained increasing levels of n-3 LC-PUFA due to the high levels of DHA (C22:6) and DPA (C22:5) in AL. On the other hand, the PL18 fed with a higher proportion of ARASCO contained higher levels of n-6 LC-PUFA, which contributed solely from the high content of ARA (C20:4). Moreover, the ratios of DHA:ARA in the supplemented PLs mimicked those found in the offered feed, which gradually decreased from Groups A to E.

Download:

Table 1. Fatty acid compositions and total fatty acid (TFA) contents (% dry weight) of PL1 shrimp before the experiment and PL18 supplemented with varying ratios of DHA:ARA.

https://doi.org/10.1371/journal.pone.0329358.t001

Growth performance analysis of PL with LC-PUFA supplementation

The supplementation of DHA:ARA at 100:0, 75:25, and 50:50 ratios was beneficial to the PL growth as the PL18 from Groups A, B, and C displayed higher biomass and body length than Group R (the control group) (Figs 2A and 2B). Similarly, the PLs from Groups A and B showed higher wet and dried body weight than Group R (Figs 2C and 2D), further confirming that DHA supplementation was beneficial to the PL growth. However, the increasing proportion of ARA supplementation did not increase the PL body weight. All PL groups with LC-PUFA supplementation showed reduced feed conversion rates (FCR) when compared to Group R (Fig 2E), suggesting that any combination of n-3 and n-6 LC-PUFA supplementation was beneficial to the PL growth efficiency. Nevertheless, the survival rate and the percent coefficient of size variation were unaffected by LC-PUFA supplementation (Figs 2F and 2G).

Download:

Fig 2. Growth performance analysis of PL18 fed with Artemia enriched with graded ratios of DHA:ARA from AL and ARASCO, respectively.

PL18, which had previously been fed with Artemia containing different ratios of n-3 and n-6 LC-PUFAs, were examined for their (A) biomass in g per tank, (B) length, (C) average wet body weight, (D) average dried body weight, (E) FCR determined from the feed weight, (F) survival rate, and (G) percent coefficient of size variation. Error bars represent the standard deviation of the averaged data from the tank replicates (N = 3). Data were statistically analyzed using ANOVA with DMRT. Different letters above the bar graphs indicate significant differences between feed groups (P < 0.05).

https://doi.org/10.1371/journal.pone.0329358.g002

Transcriptional analysis of shrimp immune genes

To determine whether the increasing levels of LC-PUFA in PLs also affect the transcriptional levels of immune genes, the qPCR analysis was performed to monitor the transcription levels of prophenoloxidase I (ProPO-I), prophenoloxidase II (ProPO-II), prophenoloxidase-activating enzyme (ppA), penaeidin 3a (PEN3a), and superoxide dismutase (SOD) in PLs. The transcription levels of ProPO-I, ppA, PEN3a, and SOD were unaffected by the LC-PUFA supplementation (Fig 3). However, the transcription levels of ProPO-II in Group D were the highest among all feed groups (Fig 3B), suggesting that the supplementation of DHA:ARA at a 25:75 ratio induced part of the shrimp immune system via the activation of the ProPO-II gene.

Download:

Fig 3. Transcription levels of immune genes in PL18 fed with Artemia with varying ratios of n-3:n-6 LC-PUFA supplementation.

L. vannamei PL18 that has previously been fed with Artemia with no supplementation (Group R) and Artemia supplemented with n-3:n-6 at 100:0 (Group A), 75:25 (Group B), 50:50 (Group C), 25:75 (Group D), and 0:100 (Group E) ratios were homogenized under liquid N₂ and subjected to RNA extraction and cDNA synthesis. Expression levels of (A) ProPO-I, (B) ProPO-II, (C) ppA, (D) PEN3a, and (E) SOD relative to EF1α were determined using the qPCR analysis. The differences in transcription levels of shrimp immune genes among all feed groups were determined using ANOVA with DMRT and designated by different letters above the bar graphs (P < 0.05).

https://doi.org/10.1371/journal.pone.0329358.g003

Effects of LC-PUFA supplementation on the levels of eicosanoids in PLs

As both ARA and eicosapentaenoic acid (EPA; C20:5) served as eicosanoid precursors, the impact of LC-PUFA supplementation on eicosanoid profiles in PLs was monitored using the UHPLC-HRMS/MS analysis. Nine eicosanoids, including two prostaglandins, three isomers of hydroxyeicosatetraenoic acids (HETEs), and four isomers of hydroxyeicosapentaenoic acids (HEPEs), were detected in these PLs. Although ARA served as a precursor of prostaglandins and HETEs, the increasing proportion of ARA in the Artemia did not produce the same impact across all ARA-derived eicosanoids. For example, the levels of PGF_2α were comparable in all feed groups, while the levels of 15-deoxy-Δ^12,14-prostaglandin J₂ (15d-PGJ₂) were at the lowest levels in Group R and steadily increased until it reached the highest levels in Group E (Figs 4A and 4B). Similarly, the increasing proportion of ARA in the LC-PUFA supplementation also impacted each HETE isomer differently. While the levels of 8-HETE were comparable among all feed groups (Fig 4C), the levels of 11-HETE and 12-HETE gradually increased as the proportion of ARA increased in the enriched Artemia, with the lowest levels of 11-HETE and 12-HETE in Group R and the highest levels in Group E (Figs 4D and 4E).

Download:

Fig 4. The UPLC-HRMS/MS analysis of PL samples fed with enriched Artemia.

Levels of (A) PGF_2α, (B) 15d-PGJ₂, (C) 8-HETE, (D) 11-HETE, (E) 12-HETE, (F) 5-HEPE, (G) 8-HEPE, (H) 12-HEPE, and (I) 18-HEPE from PLs in each feed group were quantified using the standard curve method. Error bars represent standard deviations, and different letters indicate statistically significant differences in the eicosanoid levels as determined by ANOVA using DMRT (P < 0.05).

https://doi.org/10.1371/journal.pone.0329358.g004

The GC-FID analysis of PL18 indicated that the levels of EPA in Groups A and R were higher than in the other feed groups (Table 1). Therefore, the levels of HEPEs, which are derivatives of EPA, would also increase in these PLs. However, the UHPLC-HRMS/MS analysis revealed that the increasing levels of EPA in PLs did not affect the production of HEPEs as the levels of 5-HEPE, 8-HEPE, 12-HEPE, and 18-HEPE were comparable among all feed groups (Figs 4F to 4I), suggesting that the increasing intake for EPA was utilized in other pathways to promote shrimp growth rather than for the biosynthesis of eicosanoids.

The effects of LC-PUFA supplementation on pathogenic challenges

To assess the effect of LC-PUFA supplementation on pathogenic resistance, PL18 samples from each feed group were transferred into glass tanks. After 24 hours of acclimation, the PL19 were infected with either WSSV or V. harveyi for 48 hours.

For WSSV infection, the PL19 were starved for 18 hours before being fed twice with either minced WSSV-free shrimp meat (control group) or the minced meat of WSSV-infected shrimp. The post-larvae were maintained for 48 hours, and the resulting PL22 were subjected to qPCR analysis to determine the WSSV copy number. The infected PLs from Groups A, C, D, and E contained lower WSSV copy numbers than those in Group R (Fig 5A), suggesting that LC-PUFA supplementation at 100:0, 50:50, 25:75, and 0:100 ratio of DHA:ARA is beneficial to shrimp immunity by reducing WSSV replication in the PLs. In particular, the PL22 in Group A and E showed the lowest numbers of WSSV replicates, suggesting that the supplementation with either DHA or ARA alone is more beneficial to the PLs during WSSV infection.

Download:

Fig 5. Effects of pathogenic infection in PLs fed with enriched Artemia.

PLs were challenged with (A) WSSV and (B) V. harveyi. Error bars represent the standard deviation of the averaged data from the tank replicates (N = 3). Statistically significant differences were determined by ANOVA using Dunnett’s test to compare all LC-PUFA supplemented groups with the control group (* for P < 0.05 and ** for P < 0.01).

https://doi.org/10.1371/journal.pone.0329358.g005

The V. harveyi challenge was performed by immersing 20 PL19 from each feed group with V. harveyi at 0, 7.96x10⁶, or 1.58x10⁷ CFU/mL for 24 hours to obtain control, low dose, and high dose of V. harveyi infection, respectively. The survival was assessed at 48 hours post-infection, revealing no significant difference in the mean survival rates of PLs in all feed groups due to considerable sample variation (Fig 5B). Therefore, LC-PUFA supplementation did not increase the PL survival rates during V. harveyi infection.

Discussion

LC-PUFA supplementation has previously been shown to enhance the growth of PL in several marine organisms [1–6]. While the positive effect of DHA on growth is consistent in shrimp and most marine species [1–4], the results from ARA supplementation varied [5,6,17,37,38]. In the present study, dietary supplementation of LC-PUFA by Artemia enrichment was performed using different proportions of A. limacinum BCC52274 and ARASCO derived from Mortierella sp. to vary the ratios of DHA and ARA. Based on the data obtained in this study, we propose that the supplementation of microbial-derived PUFA can be selectively applied in different situations for the optimal L. vannamei post-larvae aquaculture production (Fig 6). During the pathogenic outbreak, the supplementation of DHA:ARA at a 25:75 ratio promoted the production of anti-inflammatory eicosanoids, including 15d-PGJ₂, 11-HETE, and 12-HETE, increased the transcription levels of an immune gene ProPO-II, and reduced the levels of WSSV at 24 hpi. As the prophenoloxidase system has been shown to protect shrimp against various pathogens, including Enterocytozoon hepatopenaei and Vibrio parahaemolyticus that caused acute hepatopancreatic necrosis disease (AHPND) [39,40], the supplementation of DHA:ARA at a 25:75 ratio during pathogenic outbreaks is recommended to promote shrimp immunity. However, as the energy obtained from ARA supplementation was allocated to heighten the immune response, the biomass of these ARA-supplemented L. vannamei was comparable to that of the shrimp without PUFA supplementation.

Download:

Fig 6. A proposed model on the impact of DHA and ARA supplementation on L. vannamei health.

Created in BioRender. Wimuttisuk, W. (2025) https://BioRender.com/2bugr6t. Arrows pointing up indicate increasing levels of the designated metabolites, immune gene transcripts, biomass, body weight, or activation of specific pathways. An arrow pointing down indicates decreasing levels of WSSV copy number.

https://doi.org/10.1371/journal.pone.0329358.g006

During a low pathogenic outbreak, supplementation of DHA:ARA at 100:0 ratio would be the most beneficial to the shrimp aquaculture production as it resulted in the highest biomass, wet weight, and dry weight when compared to other feed groups. Moreover, shrimp supplemented with DHA:ARA at a 100:0 also contained the lowest WSSV copy number in PL, suggesting an additional benefit during WSSV outbreak.

The rapid expansion of the aquaculture industry resulted in the scarcity of feed ingredients [41,42]. In particular, the replacement of fish meal and fish oil, which are the primary sources of protein and essential fatty acids, respectively, is required for the sustainability of the aquaculture industry [7,8]. The supplementation of EPA and DHA from algal oil showed a significant improvement in specific growth rate, feed conversion rate, and survival in L. vannamei [43]. Similarly, the use of a fish oil-free dietary supplement with high levels of DHA (at 0.24% DHA) increased the growth of L. vannamei [44]. Several studies have examined the possibility of using fungal-derived LC-PUFA as fish oil replacement with varying outcomes [30,45,46]. The use of a different strain of A. limacinum has been shown to promote the growth and survival in P. monodon post-larvae [47]. Similarly, two studies by Yao et al. (2022) and Li et al. (2025) revealed that the supplementation of Schizochytrium limacinum, which is also known as A. limacinum, can improve growth performance and intestinal health of juvenile L. vannamei [48,49]. The use of A. limacinum BCC52274 has previously been tested on the growth of Penaeus monodon PLs [30]. The PLs fed with Artemia enriched with 100% A. limacinum showed the highest average body weight and biomass compared to other feed groups at 0, 50, and 75% enrichment. These data paralleled with the results obtained in this study, in which the PLs fed with Artemia supplemented with the highest ratio of DHA:ARA also showed the highest biomass and average wet and dry body weight among all feed groups. However, the effects of A. limacinum supplementation on the health and immunity of PLs were not investigated in P. monodon.

During the preparation of the enriched Artemia, the GC-FID analysis revealed that the ratios of DHA:ARA in the resulting enriched Artemia were lower than those of the prepared enrichment mixtures, particularly for Groups B, C, and D. The ratio changes commonly occur when a zooplankton is simultaneously enriched with different dietary substances [50–53]. This could have been attributed to several causes, including the different phases of AL and ARASCO in the mixture, different retro-conversion activities of DHA and ARA by Artemia, or the different stability of DHA and ARA present in the cell and oil droplet, respectively.

A study by Zhu et al. (2023) reported that dietary supplementation of n-6 LC-PUFA showed positive effects on growth, the antioxidative pathway, and the immune system in L. vannamei [6]. Moreover, dietary ARA and DHA supplementation increased the survival rates of Apostichopus japonicus and L. vannamei juveniles infected with Vibrio sp. [19,54]. These results are similar to the study by Nonwachai et al. 2010, in which the supplementation of ARA and DHA increased the L. vannamei survival from the V. harveyi infection more than individual supplementation of either ARA or DHA alone [19]. However, the supplementation of n-6 LC-PUFA derived from Mortierella sp. did not significantly impact the survival rate of V. harveyi-infected PLs in this study due to large sample variations among the replicates.

Although WSSV generally does not cause significant mortality in shrimp at the larval and PL stages [55,56], the WSSV challenge experiment was performed in this study to examine the capability of LC-PUFA supplementation to suppress the virus replication in its host. Free polyunsaturated fatty acids, including DHA and ARA, have been shown to suppress virus replication and infection [57–59]. However, this has not yet been evaluated in shrimp. In this study, dietary DHA and ARA were demonstrated for the first time to suppress replication of WSSV in the PLs. This is supported by a study by Hoffling et al. (2024), which demonstrated that L. vannamei fed with Aurantiochytrium sp. meal showed increased survival rates after the WSSV challenge [60]. Moreover, the dietary supplementation of ARA and linoleic acid (LA) has previously been correlated with increasing activities of SOD and catalase (CAT) in L. vanmamei [6]. Activities of lysozyme, acid phosphatase, and alkaline phosphatase also increased along with increasing amounts of dietary LA and ARA. However, the levels of SOD and CAT gene transcripts opposed the enzyme activity in shrimp that were supplemented with ARA [6]. As the supplementation of LC-PUFA from A. limacinum BCC52274 and ARASCO in this study also showed little impact on the transcription levels of shrimp immune genes, the effects of feed supplementation may be more prominent at the enzymatic levels rather than at the transcription levels.

Additional effects of ARA supplementation on the shrimp’s immune system may stem from the increasing levels of eicosanoids in shrimp. ARA serves as a precursor in the eicosanoid biosynthesis pathway, which has been shown to regulate inflammation and immune response in insects and mammals [61–64]. In this study, the PLs fed with Artemia with decreasing ratios of DHA:ARA also showed increasing levels of 15d-PGJ₂, 11-HETE, and 12-HETE, suggesting that the amounts of dietary ARA were correlated with the levels of eicosanoids in L. vannamei. A study by Aguilar et al. (2012) revealed that increasing levels of ARA in the shrimp diet led to enhanced immune response to counteract the negative response of high-stocking density [18]. However, they concluded that the ARA-derived eicosanoids were not responsible due to the inconsistent levels of PGE₂ found in L. vannamei. Based on our results, however, we proposed that the eicosanoids responsible for enhancing the immune response are not PGE₂ but rather a different set of ARA-derived eicosanoids, such as 15d-PGJ₂, 11-HETE, and 12-HETE. Additionally, the ethanol extract of A. limacinum has anti-inflammatory properties by reducing the expression of proinflammatory cytokine genes, including tumor necrosis factor α, interleukin-1β, and interleukin-6 when tested in vitro using RAW264 murine macrophage cells [65].

Conclusions

The use of A. limacinum BCC52274 and oil extracted from Mortierella sp. (ARASCO) can serve as an alternative source of LC-PUFA to promote the growth and immunity of L. vannamei PL by using Artemia as a carrier. The PL supplemented with DHA:ARA at a 100:0 ratio resulted in the highest biomass and average body weight among all feed groups. On the other hand, the supplementation of DHA:ARA at a 25:75 ratio resulted in the highest induction of an immune gene, prophenoloxidase II. The increasing proportion of ARA in the supplements was also positively correlated with the levels of anti-inflammatory eicosanoids, making it suitable for feed supplementation during pathogenic outbreaks. Our results provide supporting evidence that the supplementation of LC-PUFA from A. limacinum BCC52274 and Mortierella sp. is a more suitable and sustainable sources of LC-PUFA for aquaculture feed, as it improves the growth and immunity in L. vannamei PL.

Supporting information

S1 Table. Proportions of dried AL and ARACO used to supplement Artemia for the feed experiment.

https://doi.org/10.1371/journal.pone.0329358.s001

(DOCX)

S2 Table. Primer sequences and PCR conditions for the qPCR analysis of shrimp immune genes in L. vannamei.

https://doi.org/10.1371/journal.pone.0329358.s002

(DOCX)

S3 Table. Fatty acid compositions and total fatty acid (TFA) contents (% dry weight) of Artemia supplemented with different ratios of DHA:ARA.

https://doi.org/10.1371/journal.pone.0329358.s003

(DOCX)

S1 File. Fatty acid composition in AL and ARASCO oil.

https://doi.org/10.1371/journal.pone.0329358.s004

(XLSX)

S2 File. Fatty acid composition in Artemia from each feed group.

https://doi.org/10.1371/journal.pone.0329358.s005

(XLSX)

S3 File. Fatty acid composition in PL1 and PL18 from each feed group.

https://doi.org/10.1371/journal.pone.0329358.s006

(XLSX)

S4 File. Growth performance analysis of PL18 fed with enriched Artemia in different feed groups.

https://doi.org/10.1371/journal.pone.0329358.s007

(XLSX)

S5 File. Transcription levels of immune genes in PL18 fed with Artemia with varying ratios of n-3: n-6 PUFA supplementation.

https://doi.org/10.1371/journal.pone.0329358.s008

(XLSX)

S6 File. The UPLC-HRMS/MS analysis of eicosanoids in PL samples fed with enriched Artemia.

https://doi.org/10.1371/journal.pone.0329358.s009

(XLSX)

S7 File. Effects of pathogenic infection in PLs fed with enriched Artemia.

https://doi.org/10.1371/journal.pone.0329358.s010

(XLSX)

Acknowledgments

We sincerely thank DSM Nutritional Products (Thailand) Ltd. for their generous provision of ARASCO and alpha-tocopherol used in this study. We thank the members of the Advanced Diagnostics and Biomarker Discovery Research Team at BIOTEC for their technical support during sample collection.

References

1. Eryalçın KM, Roo J, Saleh R, Atalah E, Benítez T, Betancor M, et al. Fish oil replacement by different microalgal products in microdiets for early weaning of gilthead sea bream (Sparus aurata, L.). Aquac Res. 2013;44(5):819–28.
- View Article
- Google Scholar
2. Ganuza E, Benítez-Santana T, Atalah E, Vega-Orellana O, Ganga R, Izquierdo MS. Crypthecodinium cohnii and Schizochytrium sp. as potential substitutes to fisheries-derived oils from seabream (Sparus aurata) microdiets. Aquaculture. 2008;277(1–2):109–16.
- View Article
- Google Scholar
3. Harel M, Koven W, Lein I, Bar Y, Behrens P, Stubblefield J, et al. Advanced DHA, EPA and ArA enrichment materials for marine aquaculture using single cell heterotrophs. Aquaculture. 2002;213(1–4):347–62.
- View Article
- Google Scholar
4. Immanuel G, Palavesam A, Petermarian M. Effects of Feeding Lipid Enriched Artemia Nauplii on Survival, Growth, Fatty Acids and Stress Resistance of Postlarvae Penaeus Indicus. Asian Fish Sci. 2001;14:377–88.
- View Article
- Google Scholar
5. González-Félix ML, Lawrence AL, Gatlin DM III, Perez-Velazquez M. Growth, survival and fatty acid composition of juvenile Litopenaeus vannamei fed different oils in the presence and absence of phospholipids. Aquaculture. 2002;205(3–4):325–43.
- View Article
- Google Scholar
6. Zhu W, Dong R, Ge L, Yang Q, Lu N, Li H, et al. Effects of dietary n-6 polyunsaturated fatty acids (PUFA) composition on growth performances and non-specific immunity in pacific white shrimp (Litopenaeus vannamei). Aquaculture Reports. 2023;28:101436.
- View Article
- Google Scholar
7. Oliva-Teles A, Enes P, Peres H. Replacing fishmeal and fish oil in industrial aquafeeds for carnivorous fish. Feed and Feeding Practices in Aquaculture. Elsevier; 2015. 203–33. doi: https://doi.org/10.1016/b978-0-08-100506-4.00008-8
8. Randazzo B, Zarantoniello M, Cardinaletti G, Cerri R, Giorgini E, Belloni A, et al. Hermetia illucens and Poultry by-Product Meals as Alternatives to Plant Protein Sources in Gilthead Seabream (Sparus aurata) Diet: A Multidisciplinary Study on Fish Gut Status. Animals (Basel). 2021;11(3):677. pmid:33806710
- View Article
- PubMed/NCBI
- Google Scholar
9. Visudtiphole V, Phromson M, Tala S, Bunphimpapha P, Raweeratanapong T, Sittikankaew K, et al. Aurantiochytrium limacinum BCC52274 improves growth, hypo-salinity tolerance and swimming strength of Penaeus vannamei post larvae. Aquaculture. 2018;495:849–57.
- View Article
- Google Scholar
10. Jang H-D, Lin Y-Y, Yang S-S. Effect of culture media and conditions on polyunsaturated fatty acids production by Mortierella alpina. Bioresource Technology. 2005;96(15):1633–44.
- View Article
- Google Scholar
11. Ratledge C. Fatty acid biosynthesis in microorganisms being used for Single Cell Oil production. Biochimie. 2004;86(11):807–15. pmid:15589690
- View Article
- PubMed/NCBI
- Google Scholar
12. Vadivelan G, Venkateswaran G. Production and enhancement of omega-3 fatty acid from Mortierella alpina CFR-GV15: its food and therapeutic application. Biomed Res Int. 2014;2014:657414. pmid:24982900
- View Article
- PubMed/NCBI
- Google Scholar
13. Rees JF, Curé K, Piyatiratitivorakul S, Sorgeloos P, Menasveta P. Highly unsaturated fatty acid requirements of Penaeus monodon postlarvae: an experimental approach based on Artemia enrichment. Aquaculture. 1994;122(2–3):193–207.
- View Article
- Google Scholar
14. D’Abramo LR, Sheen S-S. Polyunsaturated fatty acid nutrition in juvenile freshwater prawn Macrobrachium rosenbergii. Aquaculture. 1993;115(1–2):63–86.
- View Article
- Google Scholar
15. Xu XL, Ji WJ, Castell JD, O’Dor RK. Influence of dietary lipid sources on fecundity, egg hatchability and fatty acid composition of Chinese prawn (Penaeus chinensis) broodstock. Aquaculture. 1994;119(4):359–70.
- View Article
- Google Scholar
16. Merican ZO, Shim KF. Qualitative requirements of essential fatty acids for juvenile Penaeus monodon. Aquaculture. 1996;147(3–4):275–91.
- View Article
- Google Scholar
17. Glencross BD, Smith DM. A study of the arachidonic acid requirements of the giant tiger prawn,Penaues monodon. Aquaculture Nutrition. 2001;7(1):59–69.
- View Article
- Google Scholar
18. Aguilar V, Racotta IS, Goytortúa E, Wille M, Sorgeloos P, Civera R, et al. The influence of dietary arachidonic acid on the immune response and performance of Pacific whiteleg shrimp, Litopenaeus vannamei, at high stocking density. Aquaculture Nutrition. 2012;18(3):258–71.
- View Article
- Google Scholar
19. Nonwachai T, Purivirojkul W, Limsuwan C, Chuchird N, Velasco M, Dhar AK. Growth, nonspecific immune characteristics, and survival upon challenge with Vibrio harveyi in Pacific white shrimp (Litopenaeus vannamei) raised on diets containing algal meal. Fish Shellfish Immunol. 2010;29(2):298–304. pmid:20420922
- View Article
- PubMed/NCBI
- Google Scholar
20. Kinsella JE, Lokesh B, Broughton S, Whelan J. Dietary polyunsaturated fatty acids and eicosanoids: potential effects on the modulation of inflammatory and immune cells: an overview. Nutrition. 1990;6(1):24–44; discussion 59-62. pmid:2135755
- View Article
- PubMed/NCBI
- Google Scholar
21. Calder PC, Bevan SJ, Newsholme EA. The inhibition of T-lymphocyte proliferation by fatty acids is via an eicosanoid-independent mechanism. Immunology. 1992;75(1):108–15. pmid:1537586
- View Article
- PubMed/NCBI
- Google Scholar
22. Wimuttisuk W, Tobwor P, Deenarn P, Danwisetkanjana K, Pinkaew D, Kirtikara K, et al. Insights into the prostanoid pathway in the ovary development of the penaeid shrimp Penaeus monodon. PLoS One. 2013;8(10):e76934. pmid:24116186
- View Article
- PubMed/NCBI
- Google Scholar
23. Spaziani EP, Hinsch GW, Edwards SC. Changes in prostaglandin E2 and F2 alpha during vitellogenesis in the Florida crayfish Procambarus paeninsulanus. J Comp Physiol B. 1993;163(7):541–5. pmid:8151012
- View Article
- PubMed/NCBI
- Google Scholar
24. Spaziani EP, Hinsch GW, Edwards SC. The effect of prostaglandin E2 and prostaglandin F2 alpha on ovarian tissue in the Florida crayfish Procambarus paeninsulanus. Prostaglandins. 1995;50(4):189–200. pmid:8848543
- View Article
- PubMed/NCBI
- Google Scholar
25. Reddy PS, Reddy PR, Nagaraju GPC. The synthesis and effects of prostaglandins on the ovary of the crab Oziotelphusa senex senex. Gen Comp Endocrinol. 2004;135(1):35–41. pmid:14644642
- View Article
- PubMed/NCBI
- Google Scholar
26. Tahara D, Yano I. Maturation-related variations in prostaglandin and fatty acid content of ovary in the kuruma prawn (Marsupenaeus japonicus). Comp Biochem Physiol A Mol Integr Physiol. 2004;137(4):631–7. pmid:15123170
- View Article
- PubMed/NCBI
- Google Scholar
27. Yotbuntueng P, Jiemsup S, Deenarn P, Tobwor P, Yongkiettrakul S, Vichai V, et al. Differential distribution of eicosanoids and polyunsaturated fatty acids in the Penaeus monodon male reproductive tract and their effects on total sperm counts. PLoS One. 2022;17(9):e0275134. pmid:36137117
- View Article
- PubMed/NCBI
- Google Scholar
28. Bhathena SJ. Relationship between fatty acids and the endocrine and neuroendocrine system. Nutr Neurosci. 2006;9(1–2):1–10. pmid:16910164
- View Article
- PubMed/NCBI
- Google Scholar
29. Unagul P, Suetrong S, Preedanon S, Klaysuban A, Gundool W, Suriyachadkun C, et al. Isolation, fatty acid profiles and cryopreservation of marine thraustochytrids from mangrove habitats in Thailand. Botanica Marina. 2017;60(4).
- View Article
- Google Scholar
30. Visudtiphole V, Khudet J, Chaitongsakul P, Plaisen S, Siriwattano J, Laiphrom S, et al. Growth and Lipidomic Analyses of Penaeus monodon Larvae Supplemented With Aurantiochytrium limacinum BCC52274. Front Mar Sci. 2021;8.
- View Article
- Google Scholar
31. Tamaru CS, Murashige R, Lee C-S, Ako H, Sato V. Rotifers fed various diets of baker’s yeast and/or Nannochloropsis oculata and their effect on the growth and survival of striped mullet (Mugil cephalus) and milkfish (Chanos chanos) larvae. Aquaculture. 1993;110(3–4):361–72.
- View Article
- Google Scholar
32. Noshirvani M, Takami AGh, Rassouli A, Bokaee S. The stability of ascorbic acid in Artemia urmiana following enrichment and subsequent starvation. J Appl Ichthyol. 2006;22(1):85–8.
- View Article
- Google Scholar
33. Srisala J, Tacon P, Flegel TW, Sritunyalucksana K. Comparison of white spot syndrome virus PCR-detection methods that use electrophoresis or antibody-mediated lateral flow chromatographic strips to visualize PCR amplicons. J Virol Methods. 2008;153(2):129–33. pmid:18760309
- View Article
- PubMed/NCBI
- Google Scholar
34. Sritunyalucksana K, Srisala J, McColl K, Nielsen L, Flegel TW. Comparison of PCR testing methods for white spot syndrome virus (WSSV) infections in penaeid shrimp. Aquaculture. 2006;255(1–4):95–104.
- View Article
- Google Scholar
35. Lepage G, Roy CC. Direct transesterification of all classes of lipids in a one-step reaction. J Lipid Res. 1986;27(1):114–20. pmid:3958609
- View Article
- PubMed/NCBI
- Google Scholar
36. Deenarn P, Tobwor P, Leelatanawit R, Wongtriphop S, Khudet J, Karoonuthaisiri N, et al. Dynamics of fatty acid regulatory genes during ovarian development in Penaeus monodon. Reproduction. 2018;156(6):527–44. pmid:30328347
- View Article
- PubMed/NCBI
- Google Scholar
37. Duan Y, Lu Z, Zeng S, Dan X, Zhang J, Li Y. Effects of dietary arachidonic acid on growth, immunity and intestinal microbiota of Litopenaeus vannamei under microcystin-LR stress. Aquaculture. 2022;549:737780.
- View Article
- Google Scholar
38. Araújo BC, Flores-Galvez K, Honji RM, Barbosa VM, Viana MT, Tinajero A, et al. Arachidonic acid effects on the overall performance, fatty acid profile, hepatopancreas morphology and lipid-relevant genes in Litopenaeus vannamei juveniles. Aquaculture. 2020;523:735207.
- View Article
- Google Scholar
39. Sukonthamarn P, Wongvises P, Sangklai N, Jaroenlak P, Tassanakajon A. Prophenoloxidase-activating system plays a crucial role in innate immune responses to Enterocytozoon hepatopenaei infection in shrimp Litopenaeus vannamei. Fish Shellfish Immunol. 2024;154:109925. pmid:39326689
- View Article
- PubMed/NCBI
- Google Scholar
40. Boonchuen P, Jaree P, Somboonviwat K, Somboonwiwat K. Regulation of shrimp prophenoloxidase activating system by lva-miR-4850 during bacterial infection. Sci Rep. 2021;11(1):3821. pmid:33589707
- View Article
- PubMed/NCBI
- Google Scholar
41. Tacon AGJ, Metian M. Global overview on the use of fish meal and fish oil in industrially compounded aquafeeds: Trends and future prospects. Aquaculture. 2008;285(1–4):146–58.
- View Article
- Google Scholar
42. Naylor RL, Goldburg RJ, Primavera JH, Kautsky N, Beveridge MC, Clay J, et al. Effect of aquaculture on world fish supplies. Nature. 2000;405(6790):1017–24. pmid:10890435
- View Article
- PubMed/NCBI
- Google Scholar
43. Santigosa E, Lemos D, Coelho RTI, Carr I. Omega‐3 EPA and DHA From Algal Oil Improve Pacific White Shrimp Zootechnical Performance and Nutritional Quality Without Changing Sensory Quality. Aquaculture Research. 2024;2024(1).
- View Article
- Google Scholar
44. Araújo BC, Mata-Sotres JA, Viana MT, Tinajero A, Braga A. Fish oil-free diets for Pacific white shrimp Litopenaeus vannamei: The effects of DHA-EPA supplementation on juvenile growth performance and muscle fatty acid profile. Aquaculture. 2019;511:734276.
- View Article
- Google Scholar
45. Karimi S, Ferreira JA, Taherzadeh MJ. Filamentous fungi as animal and fish feed ingredients. Current Developments in Biotechnology and Bioengineering. Elsevier; 2023. 399–433. doi: https://doi.org/10.1016/b978-0-323-91872-5.00002-8
46. Binur R, Aryantha INP, Suantika G. Nutritional profiling of microfungi and its effects on the growth performance, bacterial communities, and survival with Vibrio harveyi on white shrimp post-larvae (Litopenaeus vannamei). Aquaculture. 2021;545:737260.
- View Article
- Google Scholar
47. Jaseera KV, Ebeneezar S, Sayooj P, Nair AV, Kaladharan P. Dietary supplementation of microalgae, Aurantiochytrium sp. and co-feeding with Artemia enhances the growth, stress tolerance and survival in Penaeus monodon (Fabricius, 1798) post larvae. Aquaculture. 2021;533:736176.
- View Article
- Google Scholar
48. Yao X, Lin Y, Shi M, Chen L, Qu K, Liu Y, et al. Effect of Schizochytrium limacinum supplementation to a low fish-meal diet on growth performance, lipid metabolism, apoptosis, autophagy and intestinal histology of Litopenaeus vannamei. Front Mar Sci. 2022;9.
- View Article
- Google Scholar
49. Li X, Yao X, Lu J, Li J, Tan B, Yang Q, et al. Dietary supplementation with Schizochytrium Limacinum in a plant protein-based diet on growth performance, flesh quality, myofiber development, and antioxidant profile of Litopenaeus vannamei. Animal Feed Science and Technology. 2025;327:116422.
- View Article
- Google Scholar
50. Estévez A, McEvoy LA, Bell JG, Sargent JR. Effects of temperature and starvation time on the pattern and rate of loss of essential fatty acids in Artemia nauplii previously enriched using arachidonic acid and eicosapentaenoic acid-rich emulsions. Aquaculture. 1998;165(3–4):295–311.
- View Article
- Google Scholar
51. Estévez A, McEvoy LA, Bell JG, Sargent JR. Growth, survival, lipid composition and pigmentation of turbot (Scophthalmus maximus) larvae fed live-prey enriched in Arachidonic and Eicosapentaenoic acids. Aquaculture. 1999;180(3–4):321–43.
- View Article
- Google Scholar
52. Han K, Geurden I, Sorgeloos P. Fatty acid changes in enriched and subsequently starved Artemia franciscana nauplii enriched with different essential fatty acids. Aquaculture. 2001;199(1–2):93–105.
- View Article
- Google Scholar
53. Boglino A, Darias MJ, Estévez A, Andree KB, Gisbert E. The effect of dietary arachidonic acid during the Artemia feeding period on larval growth and skeletogenesis in Senegalese sole, Solea senegalensis. Journal of Applied Ichthyology. 2012;28(3):411–8.
- View Article
- Google Scholar
54. Qi H, Liu Y, Jian F, Xing X, Wang J, Li C. Effects of dietary arachidonic acid (ARA) on immunity, growth and fatty acids of Apostichopus japonicus. Fish Shellfish Immunol. 2022;127:901–9. pmid:35863534
- View Article
- PubMed/NCBI
- Google Scholar
55. Yoganandhan K, Narayanan RB, Sahul Hameed AS. Larvae and early post-larvae of Penaeus monodon (Fabricius) experimentally infected with white spot syndrome virus (WSSV) show no significant mortality. J Fish Dis. 2003;26(7):385–91. pmid:12946007
- View Article
- PubMed/NCBI
- Google Scholar
56. Pérez F, Volckaert FAM, Calderón J. Pathogenicity of white spot syndrome virus on postlarvae and juveniles of Penaeus (Litopenaeus) vannamei. Aquaculture. 2005;250(3–4):586–91.
- View Article
- Google Scholar
57. Kohn A, Gitelman J, Inbar M. Unsaturated free fatty acids inactivate animal enveloped viruses. Arch Virol. 1980;66(4):301–7. pmid:7447706
- View Article
- PubMed/NCBI
- Google Scholar
58. Suo X, Wang J, Wang D, Fan G, Zhu M, Fan B, et al. DHA and EPA inhibit porcine coronavirus replication by alleviating ER stress. J Virol. 2023;97(11):e0120923. pmid:37843366
- View Article
- PubMed/NCBI
- Google Scholar
59. Das UN. Arachidonic acid and other unsaturated fatty acids and some of their metabolites function as endogenous antimicrobial molecules: A review. J Adv Res. 2018;11:57–66. pmid:30034876
- View Article
- PubMed/NCBI
- Google Scholar
60. Hoffling FB, Marquezi AS, Pinheiro I, Simon C, Rombenso AN, Seiffert WQ, et al. Aurantiochytrium sp. Meal as Feed Additive for Pacific White Shrimp Reared under Low Temperature and Challenged by WSSV in Association with Thermal Stress. Fishes. 2024;9(3):108.
- View Article
- Google Scholar
61. Sander WJ, O’Neill HG, Pohl CH. Prostaglandin E2 As a Modulator of Viral Infections. Front Physiol. 2017;8:89. pmid:28261111
- View Article
- PubMed/NCBI
- Google Scholar
62. Oshima H, Hioki K, Popivanova BK, Oguma K, Van Rooijen N, Ishikawa T-O, et al. Prostaglandin E₂ signaling and bacterial infection recruit tumor-promoting macrophages to mouse gastric tumors. Gastroenterology. 2011;140(2):596-607.e7. pmid:21070778
- View Article
- PubMed/NCBI
- Google Scholar
63. Jurenka RA, Pedibhotla VK, Stanley DW. Prostaglandin production in response to a bacterial infection in true armyworm larvae. Arch Insect Biochem Physiol. 1999;41(4):225–32.
- View Article
- Google Scholar
64. Noverr MC, Toews GB, Huffnagle GB. Production of prostaglandins and leukotrienes by pathogenic fungi. Infect Immun. 2002;70(1):400–2. pmid:11748207
- View Article
- PubMed/NCBI
- Google Scholar
65. Takahashi S, Yoshida M, Watanabe MM, Isoda H. Anti-Inflammatory Effects of Aurantiochytrium limacinum 4W-1b Ethanol Extract on Murine Macrophage RAW264 Cells. Biomed Res Int. 2019;2019:3104057. pmid:30809537
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Eryalçın KM, Roo J, Saleh R, Atalah E, Benítez T, Betancor M, et al. Fish oil replacement by different microalgal products in microdiets for early weaning of gilthead sea bream (Sparus aurata, L.). Aquac Res. 2013;44(5):819–28.
View Article
Google Scholar

[2] View Article

[3] Google Scholar

[ref2] 2. Ganuza E, Benítez-Santana T, Atalah E, Vega-Orellana O, Ganga R, Izquierdo MS. Crypthecodinium cohnii and Schizochytrium sp. as potential substitutes to fisheries-derived oils from seabream (Sparus aurata) microdiets. Aquaculture. 2008;277(1–2):109–16.
View Article
Google Scholar

[5] View Article

[6] Google Scholar

[ref3] 3. Harel M, Koven W, Lein I, Bar Y, Behrens P, Stubblefield J, et al. Advanced DHA, EPA and ArA enrichment materials for marine aquaculture using single cell heterotrophs. Aquaculture. 2002;213(1–4):347–62.
View Article
Google Scholar

[8] View Article

[9] Google Scholar

[ref4] 4. Immanuel G, Palavesam A, Petermarian M. Effects of Feeding Lipid Enriched Artemia Nauplii on Survival, Growth, Fatty Acids and Stress Resistance of Postlarvae Penaeus Indicus. Asian Fish Sci. 2001;14:377–88.
View Article
Google Scholar

[11] View Article

[12] Google Scholar

[ref5] 5. González-Félix ML, Lawrence AL, Gatlin DM III, Perez-Velazquez M. Growth, survival and fatty acid composition of juvenile Litopenaeus vannamei fed different oils in the presence and absence of phospholipids. Aquaculture. 2002;205(3–4):325–43.
View Article
Google Scholar

[14] View Article

[15] Google Scholar

[ref6] 6. Zhu W, Dong R, Ge L, Yang Q, Lu N, Li H, et al. Effects of dietary n-6 polyunsaturated fatty acids (PUFA) composition on growth performances and non-specific immunity in pacific white shrimp (Litopenaeus vannamei). Aquaculture Reports. 2023;28:101436.
View Article
Google Scholar

[17] View Article

[18] Google Scholar

[ref7] 7. Oliva-Teles A, Enes P, Peres H. Replacing fishmeal and fish oil in industrial aquafeeds for carnivorous fish. Feed and Feeding Practices in Aquaculture. Elsevier; 2015. 203–33. doi: https://doi.org/10.1016/b978-0-08-100506-4.00008-8

[ref8] 8. Randazzo B, Zarantoniello M, Cardinaletti G, Cerri R, Giorgini E, Belloni A, et al. Hermetia illucens and Poultry by-Product Meals as Alternatives to Plant Protein Sources in Gilthead Seabream (Sparus aurata) Diet: A Multidisciplinary Study on Fish Gut Status. Animals (Basel). 2021;11(3):677. pmid:33806710
View Article
PubMed/NCBI
Google Scholar

[21] View Article

[22] PubMed/NCBI

[23] Google Scholar

[ref9] 9. Visudtiphole V, Phromson M, Tala S, Bunphimpapha P, Raweeratanapong T, Sittikankaew K, et al. Aurantiochytrium limacinum BCC52274 improves growth, hypo-salinity tolerance and swimming strength of Penaeus vannamei post larvae. Aquaculture. 2018;495:849–57.
View Article
Google Scholar

[25] View Article

[26] Google Scholar

[ref10] 10. Jang H-D, Lin Y-Y, Yang S-S. Effect of culture media and conditions on polyunsaturated fatty acids production by Mortierella alpina. Bioresource Technology. 2005;96(15):1633–44.
View Article
Google Scholar

[28] View Article

[29] Google Scholar

[ref11] 11. Ratledge C. Fatty acid biosynthesis in microorganisms being used for Single Cell Oil production. Biochimie. 2004;86(11):807–15. pmid:15589690
View Article
PubMed/NCBI
Google Scholar

[31] View Article

[32] PubMed/NCBI

[33] Google Scholar

[ref12] 12. Vadivelan G, Venkateswaran G. Production and enhancement of omega-3 fatty acid from Mortierella alpina CFR-GV15: its food and therapeutic application. Biomed Res Int. 2014;2014:657414. pmid:24982900
View Article
PubMed/NCBI
Google Scholar

[35] View Article

[36] PubMed/NCBI

[37] Google Scholar

[ref13] 13. Rees JF, Curé K, Piyatiratitivorakul S, Sorgeloos P, Menasveta P. Highly unsaturated fatty acid requirements of Penaeus monodon postlarvae: an experimental approach based on Artemia enrichment. Aquaculture. 1994;122(2–3):193–207.
View Article
Google Scholar

[39] View Article

[40] Google Scholar

[ref14] 14. D’Abramo LR, Sheen S-S. Polyunsaturated fatty acid nutrition in juvenile freshwater prawn Macrobrachium rosenbergii. Aquaculture. 1993;115(1–2):63–86.
View Article
Google Scholar

[42] View Article

[43] Google Scholar

[ref15] 15. Xu XL, Ji WJ, Castell JD, O’Dor RK. Influence of dietary lipid sources on fecundity, egg hatchability and fatty acid composition of Chinese prawn (Penaeus chinensis) broodstock. Aquaculture. 1994;119(4):359–70.
View Article
Google Scholar

[45] View Article

[46] Google Scholar

[ref16] 16. Merican ZO, Shim KF. Qualitative requirements of essential fatty acids for juvenile Penaeus monodon. Aquaculture. 1996;147(3–4):275–91.
View Article
Google Scholar

[48] View Article

[49] Google Scholar

[ref17] 17. Glencross BD, Smith DM. A study of the arachidonic acid requirements of the giant tiger prawn,Penaues monodon. Aquaculture Nutrition. 2001;7(1):59–69.
View Article
Google Scholar

[51] View Article

[52] Google Scholar

[ref18] 18. Aguilar V, Racotta IS, Goytortúa E, Wille M, Sorgeloos P, Civera R, et al. The influence of dietary arachidonic acid on the immune response and performance of Pacific whiteleg shrimp, Litopenaeus vannamei, at high stocking density. Aquaculture Nutrition. 2012;18(3):258–71.
View Article
Google Scholar

[54] View Article

[55] Google Scholar

[ref19] 19. Nonwachai T, Purivirojkul W, Limsuwan C, Chuchird N, Velasco M, Dhar AK. Growth, nonspecific immune characteristics, and survival upon challenge with Vibrio harveyi in Pacific white shrimp (Litopenaeus vannamei) raised on diets containing algal meal. Fish Shellfish Immunol. 2010;29(2):298–304. pmid:20420922
View Article
PubMed/NCBI
Google Scholar

[57] View Article

[58] PubMed/NCBI

[59] Google Scholar

[ref20] 20. Kinsella JE, Lokesh B, Broughton S, Whelan J. Dietary polyunsaturated fatty acids and eicosanoids: potential effects on the modulation of inflammatory and immune cells: an overview. Nutrition. 1990;6(1):24–44; discussion 59-62. pmid:2135755
View Article
PubMed/NCBI
Google Scholar

[61] View Article

[62] PubMed/NCBI

[63] Google Scholar

[ref21] 21. Calder PC, Bevan SJ, Newsholme EA. The inhibition of T-lymphocyte proliferation by fatty acids is via an eicosanoid-independent mechanism. Immunology. 1992;75(1):108–15. pmid:1537586
View Article
PubMed/NCBI
Google Scholar

[65] View Article

[66] PubMed/NCBI

[67] Google Scholar

[ref22] 22. Wimuttisuk W, Tobwor P, Deenarn P, Danwisetkanjana K, Pinkaew D, Kirtikara K, et al. Insights into the prostanoid pathway in the ovary development of the penaeid shrimp Penaeus monodon. PLoS One. 2013;8(10):e76934. pmid:24116186
View Article
PubMed/NCBI
Google Scholar

[69] View Article

[70] PubMed/NCBI

[71] Google Scholar

[ref23] 23. Spaziani EP, Hinsch GW, Edwards SC. Changes in prostaglandin E2 and F2 alpha during vitellogenesis in the Florida crayfish Procambarus paeninsulanus. J Comp Physiol B. 1993;163(7):541–5. pmid:8151012
View Article
PubMed/NCBI
Google Scholar

[73] View Article

[74] PubMed/NCBI

[75] Google Scholar

[ref24] 24. Spaziani EP, Hinsch GW, Edwards SC. The effect of prostaglandin E2 and prostaglandin F2 alpha on ovarian tissue in the Florida crayfish Procambarus paeninsulanus. Prostaglandins. 1995;50(4):189–200. pmid:8848543
View Article
PubMed/NCBI
Google Scholar

[77] View Article

[78] PubMed/NCBI

[79] Google Scholar

[ref25] 25. Reddy PS, Reddy PR, Nagaraju GPC. The synthesis and effects of prostaglandins on the ovary of the crab Oziotelphusa senex senex. Gen Comp Endocrinol. 2004;135(1):35–41. pmid:14644642
View Article
PubMed/NCBI
Google Scholar

[81] View Article

[82] PubMed/NCBI

[83] Google Scholar

[ref26] 26. Tahara D, Yano I. Maturation-related variations in prostaglandin and fatty acid content of ovary in the kuruma prawn (Marsupenaeus japonicus). Comp Biochem Physiol A Mol Integr Physiol. 2004;137(4):631–7. pmid:15123170
View Article
PubMed/NCBI
Google Scholar

[85] View Article

[86] PubMed/NCBI

[87] Google Scholar

[ref27] 27. Yotbuntueng P, Jiemsup S, Deenarn P, Tobwor P, Yongkiettrakul S, Vichai V, et al. Differential distribution of eicosanoids and polyunsaturated fatty acids in the Penaeus monodon male reproductive tract and their effects on total sperm counts. PLoS One. 2022;17(9):e0275134. pmid:36137117
View Article
PubMed/NCBI
Google Scholar

[89] View Article

[90] PubMed/NCBI

[91] Google Scholar

[ref28] 28. Bhathena SJ. Relationship between fatty acids and the endocrine and neuroendocrine system. Nutr Neurosci. 2006;9(1–2):1–10. pmid:16910164
View Article
PubMed/NCBI
Google Scholar

[93] View Article

[94] PubMed/NCBI

[95] Google Scholar

[ref29] 29. Unagul P, Suetrong S, Preedanon S, Klaysuban A, Gundool W, Suriyachadkun C, et al. Isolation, fatty acid profiles and cryopreservation of marine thraustochytrids from mangrove habitats in Thailand. Botanica Marina. 2017;60(4).
View Article
Google Scholar

[97] View Article

[98] Google Scholar

[ref30] 30. Visudtiphole V, Khudet J, Chaitongsakul P, Plaisen S, Siriwattano J, Laiphrom S, et al. Growth and Lipidomic Analyses of Penaeus monodon Larvae Supplemented With Aurantiochytrium limacinum BCC52274. Front Mar Sci. 2021;8.
View Article
Google Scholar

[100] View Article

[101] Google Scholar

[ref31] 31. Tamaru CS, Murashige R, Lee C-S, Ako H, Sato V. Rotifers fed various diets of baker’s yeast and/or Nannochloropsis oculata and their effect on the growth and survival of striped mullet (Mugil cephalus) and milkfish (Chanos chanos) larvae. Aquaculture. 1993;110(3–4):361–72.
View Article
Google Scholar

[103] View Article

[104] Google Scholar

[ref32] 32. Noshirvani M, Takami AGh, Rassouli A, Bokaee S. The stability of ascorbic acid in Artemia urmiana following enrichment and subsequent starvation. J Appl Ichthyol. 2006;22(1):85–8.
View Article
Google Scholar

[106] View Article

[107] Google Scholar

[ref33] 33. Srisala J, Tacon P, Flegel TW, Sritunyalucksana K. Comparison of white spot syndrome virus PCR-detection methods that use electrophoresis or antibody-mediated lateral flow chromatographic strips to visualize PCR amplicons. J Virol Methods. 2008;153(2):129–33. pmid:18760309
View Article
PubMed/NCBI
Google Scholar

[109] View Article

[110] PubMed/NCBI

[111] Google Scholar

[ref34] 34. Sritunyalucksana K, Srisala J, McColl K, Nielsen L, Flegel TW. Comparison of PCR testing methods for white spot syndrome virus (WSSV) infections in penaeid shrimp. Aquaculture. 2006;255(1–4):95–104.
View Article
Google Scholar

[113] View Article

[114] Google Scholar

[ref35] 35. Lepage G, Roy CC. Direct transesterification of all classes of lipids in a one-step reaction. J Lipid Res. 1986;27(1):114–20. pmid:3958609
View Article
PubMed/NCBI
Google Scholar

[116] View Article

[117] PubMed/NCBI

[118] Google Scholar

[ref36] 36. Deenarn P, Tobwor P, Leelatanawit R, Wongtriphop S, Khudet J, Karoonuthaisiri N, et al. Dynamics of fatty acid regulatory genes during ovarian development in Penaeus monodon. Reproduction. 2018;156(6):527–44. pmid:30328347
View Article
PubMed/NCBI
Google Scholar

[120] View Article

[121] PubMed/NCBI

[122] Google Scholar

[ref37] 37. Duan Y, Lu Z, Zeng S, Dan X, Zhang J, Li Y. Effects of dietary arachidonic acid on growth, immunity and intestinal microbiota of Litopenaeus vannamei under microcystin-LR stress. Aquaculture. 2022;549:737780.
View Article
Google Scholar

[124] View Article

[125] Google Scholar

[ref38] 38. Araújo BC, Flores-Galvez K, Honji RM, Barbosa VM, Viana MT, Tinajero A, et al. Arachidonic acid effects on the overall performance, fatty acid profile, hepatopancreas morphology and lipid-relevant genes in Litopenaeus vannamei juveniles. Aquaculture. 2020;523:735207.
View Article
Google Scholar

[127] View Article

[128] Google Scholar

[ref39] 39. Sukonthamarn P, Wongvises P, Sangklai N, Jaroenlak P, Tassanakajon A. Prophenoloxidase-activating system plays a crucial role in innate immune responses to Enterocytozoon hepatopenaei infection in shrimp Litopenaeus vannamei. Fish Shellfish Immunol. 2024;154:109925. pmid:39326689
View Article
PubMed/NCBI
Google Scholar

[130] View Article

[131] PubMed/NCBI

[132] Google Scholar

[ref40] 40. Boonchuen P, Jaree P, Somboonviwat K, Somboonwiwat K. Regulation of shrimp prophenoloxidase activating system by lva-miR-4850 during bacterial infection. Sci Rep. 2021;11(1):3821. pmid:33589707
View Article
PubMed/NCBI
Google Scholar

[134] View Article

[135] PubMed/NCBI

[136] Google Scholar

[ref41] 41. Tacon AGJ, Metian M. Global overview on the use of fish meal and fish oil in industrially compounded aquafeeds: Trends and future prospects. Aquaculture. 2008;285(1–4):146–58.
View Article
Google Scholar

[138] View Article

[139] Google Scholar

[ref42] 42. Naylor RL, Goldburg RJ, Primavera JH, Kautsky N, Beveridge MC, Clay J, et al. Effect of aquaculture on world fish supplies. Nature. 2000;405(6790):1017–24. pmid:10890435
View Article
PubMed/NCBI
Google Scholar

[141] View Article

[142] PubMed/NCBI

[143] Google Scholar

[ref43] 43. Santigosa E, Lemos D, Coelho RTI, Carr I. Omega‐3 EPA and DHA From Algal Oil Improve Pacific White Shrimp Zootechnical Performance and Nutritional Quality Without Changing Sensory Quality. Aquaculture Research. 2024;2024(1).
View Article
Google Scholar

[145] View Article

[146] Google Scholar

[ref44] 44. Araújo BC, Mata-Sotres JA, Viana MT, Tinajero A, Braga A. Fish oil-free diets for Pacific white shrimp Litopenaeus vannamei: The effects of DHA-EPA supplementation on juvenile growth performance and muscle fatty acid profile. Aquaculture. 2019;511:734276.
View Article
Google Scholar

[148] View Article

[149] Google Scholar

[ref45] 45. Karimi S, Ferreira JA, Taherzadeh MJ. Filamentous fungi as animal and fish feed ingredients. Current Developments in Biotechnology and Bioengineering. Elsevier; 2023. 399–433. doi: https://doi.org/10.1016/b978-0-323-91872-5.00002-8

[ref46] 46. Binur R, Aryantha INP, Suantika G. Nutritional profiling of microfungi and its effects on the growth performance, bacterial communities, and survival with Vibrio harveyi on white shrimp post-larvae (Litopenaeus vannamei). Aquaculture. 2021;545:737260.
View Article
Google Scholar

[152] View Article

[153] Google Scholar

[ref47] 47. Jaseera KV, Ebeneezar S, Sayooj P, Nair AV, Kaladharan P. Dietary supplementation of microalgae, Aurantiochytrium sp. and co-feeding with Artemia enhances the growth, stress tolerance and survival in Penaeus monodon (Fabricius, 1798) post larvae. Aquaculture. 2021;533:736176.
View Article
Google Scholar

[155] View Article

[156] Google Scholar

[ref48] 48. Yao X, Lin Y, Shi M, Chen L, Qu K, Liu Y, et al. Effect of Schizochytrium limacinum supplementation to a low fish-meal diet on growth performance, lipid metabolism, apoptosis, autophagy and intestinal histology of Litopenaeus vannamei. Front Mar Sci. 2022;9.
View Article
Google Scholar

[158] View Article

[159] Google Scholar

[ref49] 49. Li X, Yao X, Lu J, Li J, Tan B, Yang Q, et al. Dietary supplementation with Schizochytrium Limacinum in a plant protein-based diet on growth performance, flesh quality, myofiber development, and antioxidant profile of Litopenaeus vannamei. Animal Feed Science and Technology. 2025;327:116422.
View Article
Google Scholar

[161] View Article

[162] Google Scholar

[ref50] 50. Estévez A, McEvoy LA, Bell JG, Sargent JR. Effects of temperature and starvation time on the pattern and rate of loss of essential fatty acids in Artemia nauplii previously enriched using arachidonic acid and eicosapentaenoic acid-rich emulsions. Aquaculture. 1998;165(3–4):295–311.
View Article
Google Scholar

[164] View Article

[165] Google Scholar

[ref51] 51. Estévez A, McEvoy LA, Bell JG, Sargent JR. Growth, survival, lipid composition and pigmentation of turbot (Scophthalmus maximus) larvae fed live-prey enriched in Arachidonic and Eicosapentaenoic acids. Aquaculture. 1999;180(3–4):321–43.
View Article
Google Scholar

[167] View Article

[168] Google Scholar

[ref52] 52. Han K, Geurden I, Sorgeloos P. Fatty acid changes in enriched and subsequently starved Artemia franciscana nauplii enriched with different essential fatty acids. Aquaculture. 2001;199(1–2):93–105.
View Article
Google Scholar

[170] View Article

[171] Google Scholar

[ref53] 53. Boglino A, Darias MJ, Estévez A, Andree KB, Gisbert E. The effect of dietary arachidonic acid during the Artemia feeding period on larval growth and skeletogenesis in Senegalese sole, Solea senegalensis. Journal of Applied Ichthyology. 2012;28(3):411–8.
View Article
Google Scholar

[173] View Article

[174] Google Scholar

[ref54] 54. Qi H, Liu Y, Jian F, Xing X, Wang J, Li C. Effects of dietary arachidonic acid (ARA) on immunity, growth and fatty acids of Apostichopus japonicus. Fish Shellfish Immunol. 2022;127:901–9. pmid:35863534
View Article
PubMed/NCBI
Google Scholar

[176] View Article

[177] PubMed/NCBI

[178] Google Scholar

[ref55] 55. Yoganandhan K, Narayanan RB, Sahul Hameed AS. Larvae and early post-larvae of Penaeus monodon (Fabricius) experimentally infected with white spot syndrome virus (WSSV) show no significant mortality. J Fish Dis. 2003;26(7):385–91. pmid:12946007
View Article
PubMed/NCBI
Google Scholar

[180] View Article

[181] PubMed/NCBI

[182] Google Scholar

[ref56] 56. Pérez F, Volckaert FAM, Calderón J. Pathogenicity of white spot syndrome virus on postlarvae and juveniles of Penaeus (Litopenaeus) vannamei. Aquaculture. 2005;250(3–4):586–91.
View Article
Google Scholar

[184] View Article

[185] Google Scholar

[ref57] 57. Kohn A, Gitelman J, Inbar M. Unsaturated free fatty acids inactivate animal enveloped viruses. Arch Virol. 1980;66(4):301–7. pmid:7447706
View Article
PubMed/NCBI
Google Scholar

[187] View Article

[188] PubMed/NCBI

[189] Google Scholar

[ref58] 58. Suo X, Wang J, Wang D, Fan G, Zhu M, Fan B, et al. DHA and EPA inhibit porcine coronavirus replication by alleviating ER stress. J Virol. 2023;97(11):e0120923. pmid:37843366
View Article
PubMed/NCBI
Google Scholar

[191] View Article

[192] PubMed/NCBI

[193] Google Scholar

[ref59] 59. Das UN. Arachidonic acid and other unsaturated fatty acids and some of their metabolites function as endogenous antimicrobial molecules: A review. J Adv Res. 2018;11:57–66. pmid:30034876
View Article
PubMed/NCBI
Google Scholar

[195] View Article

[196] PubMed/NCBI

[197] Google Scholar

[ref60] 60. Hoffling FB, Marquezi AS, Pinheiro I, Simon C, Rombenso AN, Seiffert WQ, et al. Aurantiochytrium sp. Meal as Feed Additive for Pacific White Shrimp Reared under Low Temperature and Challenged by WSSV in Association with Thermal Stress. Fishes. 2024;9(3):108.
View Article
Google Scholar

[199] View Article

[200] Google Scholar

[ref61] 61. Sander WJ, O’Neill HG, Pohl CH. Prostaglandin E2 As a Modulator of Viral Infections. Front Physiol. 2017;8:89. pmid:28261111
View Article
PubMed/NCBI
Google Scholar

[202] View Article

[203] PubMed/NCBI

[204] Google Scholar

[ref62] 62. Oshima H, Hioki K, Popivanova BK, Oguma K, Van Rooijen N, Ishikawa T-O, et al. Prostaglandin E₂ signaling and bacterial infection recruit tumor-promoting macrophages to mouse gastric tumors. Gastroenterology. 2011;140(2):596-607.e7. pmid:21070778
View Article
PubMed/NCBI
Google Scholar

[206] View Article

[207] PubMed/NCBI

[208] Google Scholar

[ref63] 63. Jurenka RA, Pedibhotla VK, Stanley DW. Prostaglandin production in response to a bacterial infection in true armyworm larvae. Arch Insect Biochem Physiol. 1999;41(4):225–32.
View Article
Google Scholar

[210] View Article

[211] Google Scholar

[ref64] 64. Noverr MC, Toews GB, Huffnagle GB. Production of prostaglandins and leukotrienes by pathogenic fungi. Infect Immun. 2002;70(1):400–2. pmid:11748207
View Article
PubMed/NCBI
Google Scholar

[213] View Article

[214] PubMed/NCBI

[215] Google Scholar

[ref65] 65. Takahashi S, Yoshida M, Watanabe MM, Isoda H. Anti-Inflammatory Effects of Aurantiochytrium limacinum 4W-1b Ethanol Extract on Murine Macrophage RAW264 Cells. Biomed Res Int. 2019;2019:3104057. pmid:30809537
View Article
PubMed/NCBI
Google Scholar

[217] View Article

[218] PubMed/NCBI

[219] Google Scholar

Figures

Abstract

Introduction

Materials and methods

The preparation of A. limacinum BCC52274

The formulation of the enrichment emulsion

The enrichment of live Artemia

Experimental animals

Feeding experiment

Evaluation of growth performance and sample collection

Pathogen challenges

Quantitative real-time PCR analysis to detect WSSV copy number

Fatty acid analysis using gas chromatography flame ionization detector (GC-FID)

RNA extraction and cDNA synthesis

Gene expression analysis

Ethyl acetate extraction of PL samples

Ultra-high performance liquid chromatography-high resolution tandem mass spectrometry (UHPLC-HRMS/MS) analysis

Statistical analysis

Results

Growth performance analysis of PL with LC-PUFA supplementation

Transcriptional analysis of shrimp immune genes

Effects of LC-PUFA supplementation on the levels of eicosanoids in PLs

The effects of LC-PUFA supplementation on pathogenic challenges

Discussion

Conclusions

Supporting information

S1 Table. Proportions of dried AL and ARACO used to supplement Artemia for the feed experiment.

S2 Table. Primer sequences and PCR conditions for the qPCR analysis of shrimp immune genes in L. vannamei.

S3 Table. Fatty acid compositions and total fatty acid (TFA) contents (% dry weight) of Artemia supplemented with different ratios of DHA:ARA.

S1 File. Fatty acid composition in AL and ARASCO oil.

S2 File. Fatty acid composition in Artemia from each feed group.

S3 File. Fatty acid composition in PL1 and PL18 from each feed group.

S4 File. Growth performance analysis of PL18 fed with enriched Artemia in different feed groups.

S5 File. Transcription levels of immune genes in PL18 fed with Artemia with varying ratios of n-3: n-6 PUFA supplementation.

S6 File. The UPLC-HRMS/MS analysis of eicosanoids in PL samples fed with enriched Artemia.

S7 File. Effects of pathogenic infection in PLs fed with enriched Artemia.

Acknowledgments

References