https://orcid.org/0000-0001-6133-4918
Figures
Abstract
Non-neuronal dopamine production has not been understood despite dopamine function in non-neuronal tissues. Tyrosinase is a non-neuronal enzyme which converts tyrosine to L-DOPA (l-3,4-dihydroxyphenylalanine) and L-DOPA to l-dopaquinone for further melanin production. Since L-DOPA is a dopamine precursor in neurons, we hypothesized that tyrosinase-derived L-DOPA could alternatively be converted to dopamine. Therefore, this study investigated whether copper supplementation enhanced pigmentation and induced dopamine production via tyrosinase activation in APRE19 cells. Copper is known as a tyrosinase cofactor. In two separate experiments, we cultured ARPE19 in 1% FBS/DMEM with/without 10 μM copper sulfate for approximately 100 days. After 40–50 days, slight pigmentation with copper treatment was confirmed in the cell pellets, while no pigmentation was observed in the non-copper control. After 90–100 days, the pigmentation in the copper treatment group was obvious, while minimal pigmentation was observed in the non-copper control. Dopamine was not detected at 40–50 days in either group, while it was detected after 90–100 days of culture only in the copper-treated group. Tyrosinase mRNA expression was confirmed in both groups at a similar level, while tyrosinase protein expression was significantly higher in the copper treatment group than in the non-copper control. Thus, we determined that copper supplementation efficiently enhances pigmentation and induces dopamine production in long-term culture ARPE19, likely due to increased tyrosinase protein expression and activity. This is the first report showing the significance of copper in non-neuronal dopamine production of RPE cells, which suggests that tyrosinase may be responsible for non-neuronal dopamine production.
Citation: Uehara H, Shakaib B, Kumar SR, Archer B, Ambati B (2025) Copper supplementation enhances pigmentation and induces dopamine production in ARPE19. PLoS One 20(7): e0327352. https://doi.org/10.1371/journal.pone.0327352
Editor: Subbulakshmi Chidambaram, Pondicherry University, INDIA
Received: February 10, 2025; Accepted: June 15, 2025; Published: July 1, 2025
Copyright: © 2025 Uehara et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the manuscript.
Funding: Supported by Knight Campus startup funding and in part by the NIH/NEI (R21EY034967).
Competing interests: The authors have declared that no competing interests exist.
Introduction
Dopamine is an indispensable neurotransmitter in the central nervous system for motivation and learning, in which dopamine behaves as a reward mediator [1,2]. Various disorders, including Parkinson’s disease, drug addiction, and attention deficit hyperactivity disorder, are associated with dopamine [3–6]. In addition to the central nervous system, dopamine is functional in peripheral tissues as a vasostimulant and immune modulator [7–11]. In fact, various dopamine receptors are expressed in peripheral organs [12]. However, peripheral dopaminergic neurons have not been clearly identified. Also, due to the instability of dopamine [13,14], it is unlikely that dopamine in the brain transduces into peripheral tissues, suggesting the presence of non-neuronal dopamine biosynthesis. One potential pathway is dopa decarboxylase (DDC, also known as aromatic L-amino acid decarboxylase (AADC)), the enzyme converting l-3,4-dihydroxyphenylalanine (L-DOPA, also known as Levodopa) to dopamine, which is expressed in various tissues [15–20]. Nevertheless, the origin of L-DOPA in peripheral tissues is unclear.
In the retina, a subpopulation of amacrine cells, which localize in the inner plexiform layer, are dopaminergic neurons [21]. Amacrine-derived dopamine can be a neurotransmitter and support other retinal neurons [22,23]. Prior animal studies demonstrate that the dopamine pathway can be associated with eye growth [24–26] and choroidal thickness [27,28], which are related to myopia development [29,30]. In humans, GWAS (genome-wide associated study) revealed that dopamine receptor D1 (DRD1) is associated with refractive error [31]. Hence, while dopamine signaling likely has a significant role in myopia development [32], it is uncertain whether amacrine-derived dopamine can reach the choroid traversing the retinal pigmented epithelium (RPE) and Bruch’s membrane and control entire eye growth.
In this study, we hypothesized that tyrosinase in RPE could mediate dopamine biosynthesis. In neurons, the dopamine biosynthesis pathway is well established [33]. Tyrosine hydroxylase converts tyrosine to L-DOPA and, subsequently, L-DOPA to dopamine by DDC (Fig 1, top). In non-neuronal systems, cells in organs such as the kidney, gastrointestinal tract, and immune system can also produce dopamine [34–36]. This dopamine acts locally to regulate ion transport, oxidative stress, and immune responses; however, the exact mechanisms of dopamine synthesis outside the nervous system are still unclear and may differ between tissues [36–38]. As a non-neuronal dopamine biosynthesis pathway, we hypothesized that tyrosinase could be involved in dopamine biosynthesis in RPE (Fig 1, bottom). Tyrosinase is a key enzyme for melanin production [39,40]. Tyrosinase converts tyrosine to L-DOPA and subsequently L-DOPA to L-dopaquinone for further melanin synthesis. We thus hypothesized that tyrosinase-derived L-DOPA could alternatively be converted to dopamine. Since copper is a cofactor for tyrosinase, supplementing copper in the culture medium can drive tyrosinase activity. ARPE19 was used in this study to test the above hypothesis. The ARPE19 cell line, established from a 19-year-old human donor, is commonly used in retinal research due to its ability to mimic several features of native RPE cells [41]. Although not identical to primary RPE cells, including induced pluripotent stem cell (iPSC)-derived RPE cells, ARPE19 remains a useful in vitro model for investigating retinal disorders, inflammation, and oxidative stress [42]. Also, ARPE19 is known to mature in long-term culture and express tyrosinase after at least 14 weeks [43,44]. Therefore, we used a long-term culture of ARPE19 to examine whether copper supplementation enhances pigmentation and induces dopamine synthesis.
Materials and methods
Cell culture and observation for pigmentation
ARPE19 was obtained from ATCC (Manassas, VA. Cat.no: CRL-2302) and cultured following the manufacturer’s instructions. For the long-term culture, we used 1% FBS (Cytiva Life Sciences, Marlborough, MA. Cat.no: SH30396.03)/DMEM (Cytiva Life Sciences. Cat.no: SH30243.01) with Antibiotic-Antimycotic (anti-anti, Thermo Fisher Scientific, Waltham, MA. Cat.no: 15240–062). 0.1 x 106 or 0.15 x 106 cells were plated in 6-well plates with 2mL of culture medium. After one day, the culture medium was changed to 1%FBS/DMEM + anti-anti with/without 10 μM copper sulfate (Sigma-Aldrich, Inc. St. Louis, MO. Cat.no: 209198). Copper lactate was obtained from City Chemical LLC (West Haven, CT. Cat.no: C4738). The medium was changed every 3–4 days, typically Monday and Friday, until the cells were harvested. Pigmentation was observed by our eyes and bright-field microscopy (EVOS Cell Imaging System, Thermo Fisher Scientific).
Copper toxicity assay
CCK-8 and crystal violet assays were conducted to evaluate copper toxicity. For the CCK-8 assay (Dojindo, Tokyo, Japan. Cat no: CK04), 10,000 cells of ARPE19 were plated in 96-well plates using 100 μL of 10%FBS/DMEM/F12 with/without 10μM copper sulfate. Since a previous study indicated copper inhibits WST-8 (water-soluble tetrazolium salt) reduction [45], before the CCK-8 assay, we washed the cells twice with 10%FBS/DMEM/F12 and applied 100 μL of culture medium without copper sulfate. Then, 10 μL of WST-8 was applied. After two hours of incubation in a CO2 incubator at 37°C, OD450 was measured using a plate reader.
For crystal violet assay, 50,000 ARPE19 cells were plated in 24-well plates with 10%FBS/DMEM/F12. After 1 day of incubation, the medium was changed to 1%FBS/DMEM with/without 10μM copper sulfate. The cells were fixed with 4%PFA at the indicated time. After washing the cells with water twice, the cells were stained with 1% crystal violet (Thermo Fisher Scientific, Cat.no: C581-25)/25% methanol/water for 25 minutes at room temperature. After washing the plates with water four times, the plates were dried. 500 μL of 1% acetic acid was used for crystal violet elution. OD590 in 100 μL of the elution was measured using a plate reader.
Dopamine enzyme-linked immunosorbent assay (ELISA)
Dopamine high-sensitive ELISA was obtained from Immusmol (Bordeaux, France. Cat.no: BA E-5300R). 800 μL of the conditioned medium from the 6-well plate was mixed immediately with 3.2 μL of 1 M sodium metabisulfite (Sigma-Aldrich, Inc. Cat.no: S9000) and 1.6 μL of 0.5 M EDTA (Sigma-Aldrich, Inc. Cat.no: 15575−038) to prevent dopamine degradation. The dopamine assay was started within 30 minutes after harvesting the culture medium. 750 μL was used for dopamine assay according to the manufacturer’s instructions.
Reverse transcription polymerase chain reaction (RT-PCR)
Total RNA was purified using Direct-zol RNA Miniprep kits with DNase treatment (Zymo Research, Irvine, CA. Cat.no: R2052). cDNA (complementary DNA) was synthesized using iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, Inc. Hercules, CA. Cat.no: 1708891). Standard Taq DNA Polymerase (New England Biolabs, Ipswich, MA. Cat.no: M0273L) was used for PCR. Each primer sequence is Human Tyrosinase F: 5’-ACCCATTGGACATAACCGGG-3’, R: 5’-TCTTGAAAAGAGTCTGGGTCTGA-3’. Human DDC F: 5’- CCCTGGAGAGAGACAAAGCG-3’, R: 5’- CGGAACTCAGGGCAGATGAA-3’. Human DBH F: 5’- GAGACCGCCTTCATCCTCAC-3’, R: 5’- ACATGCGGATCTCCTGGAAG-3’. Human TH F: 5’- GTGTTCCAGTGCACCCAGTA −3’, R: 5’- TTACACAGCCCGAACTCCAC −3’. Human GAPDH F: 5’- CAGCCTCAAGATCATCAGCA-3’, R: 5’- TGTGGTCATGAGTCCTTCCA-3’. Tyrosinase and GAPDH were amplified with 30 cycles, while the PCR cycle number for the other genes was 40 cycles.
Western blot and melanin quantification
ARPE19 in a 6-well plate was harvested using 250 μL RIPA buffer (Sigma-Aldrich, Inc. Cat.no: R0278). Protein concentration was determined by Pierce™ BCA Protein Assay kits (Thermo Fisher Scientific. Cat.no: 23225). Equal amounts of protein (15 μg) were run in Bolt™ 4–12% Bis-Tris Plus Mini Protein Gels (Thermo Fisher Scientific. Cat.no: NW04120) using Mini Gel Tank and Blot Module Set (Thermo Fisher Scientific. Cat.no: NW2000), and the proteins were transferred to PVDF membrane following the manufacture instruction. After blocking with 5% nonfat dry milk/TBS, we used 1:200 mouse anti-tyrosinase antibody (Santa Cruz Biotechnology, Inc. Dallas, TX. Cat.no: sc-20035) for tyrosinase and 1:3000 rabbit anti-GAPDH antibody (Abcam, Eugene, OR. Cat.no: ab9485) for GAPDH internal control. After staining with an appropriate secondary antibody conjugated with horseradish peroxidase, the Azure 280 Imaging System (Azure Biosystems, Dublin, CA) was used for image capture with SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific. Cat.no: 34577).
Since melanin in cell culture is often soluble, we directly measured the OD500 in the cell lysate/RIPA buffer [46]. The protein concentration was adjusted at 2 mg/mL. For the standard, the melanin (Sigma-Aldrich, M8631) was dissolved in 1N NaOH at 10 mg/mL and then diluted to 100 μg/mL, 25 μg/mL, and 6.25 μg/mL. Our standard and spike recovery test in the cell lysate found that 6.25 μg/mL was the detection limit. 80 μL of cell lysates and standards were plated in a 96-well plate, and OD500 was measured with a plate reader.
Statistical analysis
All results obtained were analyzed using Microsoft Excel. The results in the figures were presented as averages with standard deviation. Student’s t-test was used for comparison of averages accompanied with analysis of variance (ANOVA) for multiple group comparisons. p < 0.05 was considered statistically significant.
Results
Copper supplementation enhanced pigmentation in ARPE19
ARPE19 is known to mature in 1% FBS/DMEM over a long-term culture [43,44]. Importantly, the short-term culture of ARPE19 did not show tyrosinase expression, while a long-term culture of ARPE19 expressed tyrosinase. Therefore, we cultured the ARPE19 cells with/without 10 μM copper sulfate for approximately 100 days. Copper toxicity in the short term (1–14 days) was not observed by CCK-8 (Cell Counting Kit-8) assay (S1 Fig) and crystal violet assay (S2 Fig). Also, the protein amounts in the cell lysis did not decrease after the long-term (105 days) copper treatment, which indicated copper did not show significant cell toxicity in our condition (S3 Fig). Fig 2A shows 40-day-cultured cell pellets. Although it was hard to confirm the color change under the microscope, the cell pellets with copper sulfate were darker than those without copper sulfate. At 65 days, some pigmentation could be confirmed with our naked eye (Fig 2B) and bright field microscopy (Fig 2C). At 90 days, strong pigmentations were observed in copper-supplemented cultures (Figs 2D, 2E, and 3), while only slight pigmentation was confirmed in non-copper cultures. Furthermore, melanin concentration was quantified (Fig 4). Long-term copper treatment significantly increased melanin production. Thus, the copper supplement efficiently enhanced the pigmentation of ARPE19 cells, which indicated that copper enhanced tyrosinase activity.
(A) Cell pellet picture from 40-day ARPE19 culture. (B) 65-day cell culture picture and (C) images of bright field microscopy. (D) 90-day cell culture picture and (E) images bright field microscopy. Scale bar is 100 μm.
Top: No copper, Bottom: 10 μM CuSO4, 90 days culture. The scale bar is 50 μm.
Melanin concentration was measured in each cell lysate using OD500. Total protein concentration was adjusted at 2 mg/mL. N = 3. * indicates p < 0.01 by Student’s t-test.
Copper supplement induces dopamine production in ARPE19
Next, we examined whether copper supplements induce dopamine production using a dopamine ELISA. Long-term copper treatment over 90 days induces dopamine production in ARPE19 (Fig 5A), while non-copper samples showed less dopamine than the lower limit of analytical sensitivity (3.3 pg/mL, according to the manufacturer). We also tested a 45-day culture medium, but the dopamine level was below the detection limit. Lastly, after 104 days of cell culture without copper, we added 10μM copper sulfate or copper lactate and tested dopamine concentration (Fig 5B). We found that the short-term addition (4 days) of copper, even if after long-term culture, did not induce dopamine synthesis. This result indicated that long-term copper supplementation is a critical factor for dopamine production.
(A) 90-day culture with 10 μM copper sulfate showed dopamine detected. N = 3. (B) After 104 days of culture, we added 10 μM copper lactate and 10 μM copper sulfate for 4 days. N = 3 (three individual samples). The error bar is standard deviation. The dotted lines indicate analytical sensitivity (3.3 pg/mL). ANOVA and Student’s t-test were used.
Copper treatment promotes tyrosinase protein expression but not mRNA expression
To understand how copper supplement induces dopamine biosynthesis in ARPE19, we examined several key genes by RT-PCR and western blot. As expected, based on the previous studies, we confirmed tyrosinase mRNA expression in both samples (Fig 6A). However, tyrosinase and GAPDH mRNA expression were slightly reduced in copper treatment samples compared to the non-copper controls, but this was not statistically significant (Fig 6B). Also, we detected DDC mRNA by the end-point RT-PCR (Fig 6A). On the other hand, tyrosine hydroxylase (TH) and dopamine beta-hydroxylase (DBH) were not detected by RT-PCR (S4 Fig). These mRNA expression results are consistent with previous RNA-seq data of ARPE19 (GSE88848) [44]. Furthermore, we confirmed tyrosinase protein expression by western blot (Figs 6C and 6D). Interestingly, copper supplementation increased tyrosinase protein expression. Thus, dopamine biosynthesis in ARPE19 by copper supplementation may be due to stabilization of tyrosinase and/or enhanced activity because tyrosinase converts tyrosine to L-DOPA.
(A) RT-PCR results for tyrosinase, DDC, and GAPDH from 104-day culture. N = 3. As noted, DDC was amplified by the end-point PCR (40 cycles). (B) Densitometry of PCR bands of each gene. Student’s t-test did not show a significant difference (N.S). (C) Western blot results for tyrosinase from 105-day culture. N = 3. (D) Densitometry of western blot bands of tyrosinase and GAPDH.
Discussion
We determine that copper supplementation efficiently enhanced pigmentation and induced dopamine biosynthesis in long-term ARPE19 culture. This is the first report showing the significance of copper to non-neuronal dopamine production in RPE cells, and it suggests that RPE-derived dopamine could potentially affect choroid homeostasis and myopia development.
In this study, we demonstrate a potential new pathway of dopamine production via tyrosinase in RPE cells stimulated by copper. Dopamine synthesis pathway in non-neuronal tissues has not been investigated well. We hope our results will trigger the study of dopamine production in non-neuronal tissues.
Potential biological functions of RPE-derived dopamine
Dopamine’s role in eye growth, choroidal thickness, and myopia development are areas of intense investigation. Our results indicate that RPE-derived dopamine may have biological roles in eye growth and homeostasis. In albinism, which is often caused by mutations of tyrosinase and tyrosinase-related protein, various ocular abnormalities, including myopia, decreased choroidal thickness, and decreased visual acuity were observed [47,48]. Although various gene mutations cause albinism, tyrosinase-dependent dopamine production may be associated with ocular phenotypes in albinism. In addition, retinal morphology and visual function in a murine model of albinism were rescued by L-DOPA administration without pigmentation [49], suggesting that tyrosinase-dependent L-DOPA and subsequent dopamine could be associated with ocular phenotypes in albinism.
Copper stabilizes tyrosinase protein
Interestingly, in our experiment, copper supplements increased tyrosinase protein expression but not mRNA expression (Figs 6A and 6C). Tyrosinase requires multiple steps for maturation in the ER (endoplasmic reticulum) and Golgi, with strict quality controls. Although copper is not indispensable for tyrosinase processing/translocation, the holo-enzyme of tyrosinase showed higher stability than apo-enzyme [50]. Therefore, our result suggests that copper enhances tyrosinase protein stability. Also, dopamine production was not induced when copper was added to ARPE19 after a long-term culture without copper (Fig 5B). This may be due to inefficient copper transport into ARPE19 cells. Copper trafficking is highly regulated since an abundance of free copper is toxic due to its redox activity and potential to generate reactive oxygen species [51,52]. Ceruloplasmin, a major copper-carrying protein in the blood, plays a key role in systemic copper transport [53]. Although serum contains ceruloplasmin as a copper transporter [54], 1% FBS for the ARPE19 maturation may not have sufficient ceruloplasmin for efficient copper transport. Within cells, copper is delivered by transporters like CTR1 (also known as SLC31A) and chaperones such as ATOX1, while ATP7A/B and ceruloplasmin ensure proper distribution and export [55,56]. These genes may be downregulated under in vitro conditions. Alternative mechanisms of copper-mediated increase in tyrosinase protein levels could include translational activation or open reading frame operon regulation; these are less likely given the lack of apoptosis and the lack of multiple tyrosinase bands [57,58]. Thus, further investigation into copper transport may need to be done.
Origin of DDC, exogenous or endogenous
DDC mRNA was detected in both copper-treated and non-treated ARPE19, but the expression level may be low because only end-point PCR detected it (Fig 6A). In addition to neurons, DDC is expressed in non-neuronal tissues [15,18,20,59], lymphocytes [17], and serum/plasma [60,61]. This suggests that serum in the culture medium may supply DDC. In human intact RPE, DDC expression was confirmed by RNA-seq (GSE159435) [62]. Therefore, in in vivo RPE/choroid, whether DDC is supplied endogenously and/or from the bloodstream (as the RPE is adjacent to the highly vascularized choroid) is unclear. Thus, further investigations are necessary to understand the precise mechanism of converting L-DOPA to dopamine.
Risk of tyrosinase inhibitors for peripheral dopamine production
Tyrosinase inhibitors have been extensively studied for cosmetic purposes [63]. However, our results indicate a potential risk of tyrosinase inhibitors to reduce dopamine in peripheral tissues. Tyrosinase has three different enzymatic reactions [40]. Among them, the reaction converting L-DOPA to dopaquinone (Fig 1) can be a target to inhibit melanin production without dopamine reduction. Also, the inhibition of this reaction could accumulate L-DOPA, which would result in an increase in dopamine.
Limitations of the current study
We recognize several limitations of the current study. First, ARPE19 cells were used. Although ARPE19 is a useful RPE cell line, various RPE markers are low or lost compared to intact RPE and induced pluripotent stem cell (iPSC)-derived RPE [64,65]. Also, the RPE cell polarity was ignored [66,67]. Since our main subject was whether tyrosinase activation by copper can induce dopamine production, we believe that ARPE19 cells were sufficient. However, intact RPE or iPSC-derived RPE will be employed for further investigation. Second, only dopamine was analyzed by ELISA. Generally, dopamine is unstable and metabolized/processed into 3-Methoxytyramine (3-MT), 3,4-Dihydroxyphenylacetic acid (DOPAC), Homovanillic acid (HVA), Norepinephrine (noradrenaline) and Epinephrine (adrenaline) [68,69]. To understand dopamine production more precisely, we will assess these metabolites in vivo in future studies.
Conclusion
In conclusion, we demonstrated that copper supplementation enhances pigmentation and induces dopamine production in long-term cultured ARPE19. Although we have not assessed its biological functions, RPE-derived dopamine could be involved in eye growth, choroidal homeostasis, and myopia development.
Supporting information
S1 Fig. CCK-8 assay for copper toxicity.
1 day and 4 days with 10 μM copper sulfate did not show significant toxicity. * indicates p < 0.05 with Student’s t-test.
https://doi.org/10.1371/journal.pone.0327352.s001
(TIF)
S2 Fig. Crystal violet assay for copper toxicity.
(A) Plate images after crystal violet staining. (B) After eluting the crystal violet, OD590 was measured. We found that copper treatment showed more cell growth rather than toxicity in our condition. N = 6. Student’s t-test was used for average comparison.
https://doi.org/10.1371/journal.pone.0327352.s002
(TIF)
S3 Fig. Protein concentration in the lysis buffer after 105 days culture.
After 105 days culture, the cells were lysed with 250 μL RIPA buffer, and the protein concentration was measured by BCA assay. N = 3. * indicates p < 0.05 by Student’s t test.
https://doi.org/10.1371/journal.pone.0327352.s003
(TIF)
S4 Fig. RT-PCR showed that ARPE19 did not express TH and DBH mRNA.
As a positive control, the same amount of human adrenal total RNA (Zyagen, San Diego, CA. Cat.no: HR-501) was used.
https://doi.org/10.1371/journal.pone.0327352.s004
(TIF)
Acknowledgments
The authors thank all members of the University of Oregon’s Knight Campus for Accelerating Scientific Impact who helped with the experiments.
References
- 1. Mohebi A, Pettibone JR, Hamid AA, Wong J-MT, Vinson LT, Patriarchi T, et al. Dissociable dopamine dynamics for learning and motivation. Nature. 2019;570(7759):65–70. pmid:31118513
- 2. Wise RA. Dopamine, learning and motivation. Nat Rev Neurosci. 2004;5(6):483–94. pmid:15152198
- 3. Klein MO, Battagello DS, Cardoso AR, Hauser DN, Bittencourt JC, Correa RG. Dopamine: Functions, Signaling, and Association with Neurological Diseases. Cell Mol Neurobiol. 2019;39(1):31–59. pmid:30446950
- 4. Lotharius J, Brundin P. Pathogenesis of Parkinson’s disease: dopamine, vesicles and alpha-synuclein. Nat Rev Neurosci. 2002;3(12):932–42. pmid:12461550
- 5. Volkow ND, Wise RA, Baler R. The dopamine motive system: implications for drug and food addiction. Nat Rev Neurosci. 2017;18(12):741–52. pmid:29142296
- 6. Xu H, Yang F. The interplay of dopamine metabolism abnormalities and mitochondrial defects in the pathogenesis of schizophrenia. Transl Psychiatry. 2022;12(1):464. pmid:36344514
- 7. Bhatt-Mehta V, Nahata MC. Dopamine and dobutamine in pediatric therapy. Pharmacotherapy. 1989;9(5):303–14. pmid:2682552
- 8. Channer B, Matt SM, Nickoloff-Bybel EA, Pappa V, Agarwal Y, Wickman J, et al. Dopamine, Immunity, and Disease. Pharmacol Rev. 2023;75(1):62–158. pmid:36757901
- 9. De Backer D, Biston P, Devriendt J, Madl C, Chochrad D, Aldecoa C, et al. Comparison of dopamine and norepinephrine in the treatment of shock. N Engl J Med. 2010;362(9):779–89. pmid:20200382
- 10. Kuchel O. Peripheral dopamine in hypertension and associated conditions. J Hum Hypertens. 1999;13(9):605–15. pmid:10482970
- 11. Yan Y, Jiang W, Liu L, Wang X, Ding C, Tian Z, et al. Dopamine controls systemic inflammation through inhibition of NLRP3 inflammasome. Cell. 2015;160(1–2):62–73. pmid:25594175
- 12. Lu X, Liu Q, Deng Y, Wu J, Mu X, Yang X, et al. Research progress on the roles of dopamine and dopamine receptors in digestive system diseases. J Cell Mol Med. 2024;28(7):e18154. pmid:38494840
- 13. El-Sherbeni AA, Stocco MR, Wadji FB, Tyndale RF. Addressing the instability issue of dopamine during microdialysis: the determination of dopamine, serotonin, methamphetamine and its metabolites in rat brain. J Chromatogr A. 2020;1627:461403. pmid:32823108
- 14.
Sturgill MG, Kelly M, Notterman DA. Pharmacology of the Cardiovascular System. In: Fuhrman BP, Zimmerman JJ. Pediatric Critical Care. Fourth ed. Saint Louis: Mosby; 2011. 277–305.
- 15. Dominici P, Tancini B, Barra D, Voltattorni CB. Purification and characterization of rat-liver 3,4-dihydroxyphenylalanine decarboxylase. Eur J Biochem. 1987;169(1):209–13. pmid:3119338
- 16. Ichinose H, Kojima K, Togari A, Kato Y, Parvez S, Parvez H, et al. Simple purification of aromatic L-amino acid decarboxylase from human pheochromocytoma using high-performance liquid chromatography. Anal Biochem. 1985;150(2):408–14. pmid:4091266
- 17. Kokkinou I, Nikolouzou E, Hatzimanolis A, Fragoulis EG, Vassilacopoulou D. Expression of enzymatically active L-DOPA decarboxylase in human peripheral leukocytes. Blood Cells Mol Dis. 2009;42(1):92–8. pmid:19041269
- 18. Mappouras DG, Stiakakis J, Fragoulis EG. Purification and characterization of L-dopa decarboxylase from human kidney. Mol Cell Biochem. 1990;94(2):147–56. pmid:2374548
- 19. Nishigaki I, Ichinose H, Tamai K, Nagatsu T. Purification of aromatic L-amino acid decarboxylase from bovine brain with a monoclonal antibody. Biochem J. 1988;252(2):331–5. pmid:3415655
- 20. Shirota K, Fujisawa H. Purification and characterization of aromatic L-amino acid decarboxylase from rat kidney and monoclonal antibody to the enzyme. J Neurochem. 1988;51(2):426–34. pmid:3392537
- 21. Voigt T, Wässle H. Dopaminergic innervation of A II amacrine cells in mammalian retina. J Neurosci. 1987;7(12):4115–28. pmid:2891802
- 22. Jin NG, Chuang AZ, Masson PJ, Ribelayga CP. Rod electrical coupling is controlled by a circadian clock and dopamine in mouse retina. J Physiol. 2015;593(7):1597–631. pmid:25616058
- 23. Zhang Q, Xue J, Tang J, Wu S, Liu Z, Wu C, et al. Modulating amacrine cell-derived dopamine signaling promotes optic nerve regeneration and preserves visual function. Sci Adv. 2024;10(31):eado0866. pmid:39093964
- 24. McCarthy CS, Megaw P, Devadas M, Morgan IG. Dopaminergic agents affect the ability of brief periods of normal vision to prevent form-deprivation myopia. Exp Eye Res. 2007;84(1):100–7. pmid:17094962
- 25. Shu Z, Chen K, Wang Q, Wu H, Zhu Y, Tian R, et al. The Role of Retinal Dopamine D1 Receptors in Ocular Growth and Myopia Development in Mice. J Neurosci. 2023;43(48):8231–42. pmid:37751999
- 26. Stone RA, Lin T, Laties AM, Iuvone PM. Retinal dopamine and form-deprivation myopia. Proc Natl Acad Sci U S A. 1989;86(2):704–6. pmid:2911600
- 27. Mathis U, Feldkaemper M, Liu H, Schaeffel F. Studies on the interactions of retinal dopamine with choroidal thickness in the chicken. Graefes Arch Clin Exp Ophthalmol. 2023;261(2):409–25. pmid:36192457
- 28. Nickla DL, Totonelly K, Dhillon B. Dopaminergic agonists that result in ocular growth inhibition also elicit transient increases in choroidal thickness in chicks. Exp Eye Res. 2010;91(5):715–20. pmid:20801115
- 29. Du R, Xie S, Igarashi-Yokoi T, Watanabe T, Uramoto K, Takahashi H, et al. Continued Increase of Axial Length and Its Risk Factors in Adults With High Myopia. JAMA Ophthalmol. 2021;139(10):1096–103. pmid:34436537
- 30. Ho M, Liu DTL, Chan VCK, Lam DSC. Choroidal thickness measurement in myopic eyes by enhanced depth optical coherence tomography. Ophthalmology. 2013;120(9):1909–14. pmid:23683921
- 31. Tedja MS, Wojciechowski R, Hysi PG, Eriksson N, Furlotte NA, Verhoeven VJM, et al. Genome-wide association meta-analysis highlights light-induced signaling as a driver for refractive error. Nat Genet. 2018;50(6):834–48. pmid:29808027
- 32. Feldkaemper M, Schaeffel F. An updated view on the role of dopamine in myopia. Exp Eye Res. 2013;114:106–19. pmid:23434455
- 33. Daubner SC, Le T, Wang S. Tyrosine hydroxylase and regulation of dopamine synthesis. Arch Biochem Biophys. 2011;508(1):1–12. pmid:21176768
- 34. Eisenhofer G, Aneman A, Friberg P, Hooper D, Fåndriks L, Lonroth H, et al. Substantial production of dopamine in the human gastrointestinal tract. J Clin Endocrinol Metab. 1997;82(11):3864–71. pmid:9360553
- 35. Hayashi M, Yamaji Y, Kitajima W, Saruta T. Effects of high salt intake on dopamine production in rat kidney. Am J Physiol. 1991;260(5 Pt 1):E675-9. pmid:2035623
- 36. Sarkar C, Basu B, Chakroborty D, Dasgupta PS, Basu S. The immunoregulatory role of dopamine: an update. Brain Behav Immun. 2010;24(4):525–8. pmid:19896530
- 37. Feng Y, Lu Y. Immunomodulatory Effects of Dopamine in Inflammatory Diseases. Front Immunol. 2021;12:663102. pmid:33897712
- 38. Wu Y, Hu Y, Wang B, Li S, Ma C, Liu X, et al. Dopamine Uses the DRD5-ARRB2-PP2A Signaling Axis to Block the TRAF6-Mediated NF-κB Pathway and Suppress Systemic Inflammation. Mol Cell. 2020;78(1):42-56.e6. pmid:32035036
- 39. Sánchez-Ferrer A, Rodríguez-López JN, García-Cánovas F, García-Carmona F. Tyrosinase: a comprehensive review of its mechanism. Biochim Biophys Acta. 1995;1247(1):1–11. pmid:7873577
- 40. Tripathi RK, Hearing VJ, Urabe K, Aroca P, Spritz RA. Mutational mapping of the catalytic activities of human tyrosinase. J Biol Chem. 1992;267(33):23707–12. pmid:1429711
- 41. Dunn KC, Aotaki-Keen AE, Putkey FR, Hjelmeland LM. ARPE-19, a human retinal pigment epithelial cell line with differentiated properties. Exp Eye Res. 1996;62(2):155–69. pmid:8698076
- 42. Ablonczy Z, Dahrouj M, Tang PH, Liu Y, Sambamurti K, Marmorstein AD, et al. Human retinal pigment epithelium cells as functional models for the RPE in vivo. Invest Ophthalmol Vis Sci. 2011;52(12):8614–20. pmid:21960553
- 43. Ahmado A, Carr A-J, Vugler AA, Semo M, Gias C, Lawrence JM, et al. Induction of differentiation by pyruvate and DMEM in the human retinal pigment epithelium cell line ARPE-19. Invest Ophthalmol Vis Sci. 2011;52(10):7148–59. pmid:21743014
- 44. Samuel W, Jaworski C, Postnikova OA, Kutty RK, Duncan T, Tan LX, et al. Appropriately differentiated ARPE-19 cells regain phenotype and gene expression profiles similar to those of native RPE cells. Mol Vis. 2017;23:60–89. pmid:28356702
- 45. Semisch A, Hartwig A. Copper ions interfere with the reduction of the water-soluble tetrazolium salt-8. Chem Res Toxicol. 2014;27(2):169–71. pmid:24380418
- 46. Hu D-N. Methodology for evaluation of melanin content and production of pigment cells in vitro. Photochem Photobiol. 2008;84(3):645–9. pmid:18435617
- 47. Woertz EN, Ayala GD, Wynne N, Tarima S, Zacharias S, Brilliant MH, et al. Quantitative Foveal Structural Metrics as Predictors of Visual Acuity in Human Albinism. Invest Ophthalmol Vis Sci. 2024;65(3):3. pmid:38441889
- 48. Seguy P-H, Korobelnik J-F, Delyfer M-N, Michaud V, Arveiler B, Lasseaux E, et al. Ophthalmologic Phenotype-Genotype Correlations in Patients With Oculocutaneous Albinism Followed in a Reference Center. Invest Ophthalmol Vis Sci. 2023;64(12):26. pmid:37707835
- 49. Sanchez-Bretano A, Keeling E, Scott JA, Lynn SA, Soundara-Pandi SP, Macdonald SL, et al. Human equivalent doses of L-DOPA rescues retinal morphology and visual function in a murine model of albinism. Sci Rep. 2023;13(1):17173. pmid:37821525
- 50. Rüegg C, Ammer D, Lerch K. Comparison of amino acid sequence and thermostability of tyrosinase from three wild type strains of Neurospora crassa. J Biol Chem. 1982;257(11):6420–6. pmid:6210697
- 51. Lutsenko S. Human copper homeostasis: a network of interconnected pathways. Curr Opin Chem Biol. 2010;14(2):211–7. pmid:20117961
- 52. O’Halloran TV, Culotta VC. Metallochaperones, an intracellular shuttle service for metal ions. J Biol Chem. 2000;275(33):25057–60. pmid:10816601
- 53. Hellman NE, Gitlin JD. Ceruloplasmin metabolism and function. Annu Rev Nutr. 2002;22:439–58. pmid:12055353
- 54. Linder MC, Wooten L, Cerveza P, Cotton S, Shulze R, Lomeli N. Copper transport. Am J Clin Nutr. 1998;67(5 Suppl):965S-971S. pmid:9587137
- 55. Ohrvik H, Thiele DJ. How copper traverses cellular membranes through the mammalian copper transporter 1, Ctr1. Ann N Y Acad Sci. 2014;1314:32–41. pmid:24697869
- 56. Prohaska JR, Gybina AA. Intracellular copper transport in mammals. J Nutr. 2004;134(5):1003–6. pmid:15113935
- 57. Liu C, Chen L, Cong Y, Cheng L, Shuai Y, Lv F, et al. Protein phosphatase 1 regulatory subunit 15 A promotes translation initiation and induces G2M phase arrest during cuproptosis in cancers. Cell Death Dis. 2024;15(2):149. pmid:38365764
- 58. Roy G, Antoine R, Schwartz A, Slupek S, Rivera-Millot A, Boudvillain M, et al. Posttranscriptional Regulation by Copper with a New Upstream Open Reading Frame. mBio. 2022;13(4):e0091222. pmid:35862763
- 59. GTEx Consortium. The GTEx Consortium atlas of genetic regulatory effects across human tissues. Science. 2020;369(6509):1318–30. pmid:32913098
- 60. Pereira JB, Kumar A, Hall S, Palmqvist S, Stomrud E, Bali D, et al. DOPA decarboxylase is an emerging biomarker for Parkinsonian disorders including preclinical Lewy body disease. Nat Aging. 2023;3(10):1201–9. pmid:37723208
- 61. Smardz J, Martynowicz H, Wojakowska A, Wezgowiec J, Olchowy C, Danel D, et al. Is sleep bruxism related to the levels of enzymes involved in the serotonin synthesis pathway?. Clin Oral Investig. 2022;26(4):3605–12. pmid:34882257
- 62. Butler JM, Supharattanasitthi W, Yang YC, Paraoan L. RNA-seq analysis of ageing human retinal pigment epithelium: Unexpected up-regulation of visual cycle gene transcription. J Cell Mol Med. 2021;25(12):5572–85. pmid:33934486
- 63. Zolghadri S, Bahrami A, Hassan Khan MT, Munoz-Munoz J, Garcia-Molina F, Garcia-Canovas F, et al. A comprehensive review on tyrosinase inhibitors. J Enzyme Inhib Med Chem. 2019;34(1):279–309. pmid:30734608
- 64. Carr A-J, Vugler AA, Yu L, Semo M, Coffey P, Moss SE, et al. The expression of retinal cell markers in human retinal pigment epithelial cells and their augmentation by the synthetic retinoid fenretinide. Mol Vis. 2011;17:1701–15. pmid:21738400
- 65. Markert EK, Klein H, Viollet C, Rust W, Strobel B, Kauschke SG, et al. Transcriptional comparison of adult human primary Retinal Pigment Epithelium, human pluripotent stem cell-derived Retinal Pigment Epithelium, and ARPE19 cells. Front Cell Dev Biol. 2022;10:910040. pmid:36092714
- 66. Lehmann GL, Benedicto I, Philp NJ, Rodriguez-Boulan E. Plasma membrane protein polarity and trafficking in RPE cells: past, present and future. Exp Eye Res. 2014;126:5–15. pmid:25152359
- 67. Sonoda S, Spee C, Barron E, Ryan SJ, Kannan R, Hinton DR. A protocol for the culture and differentiation of highly polarized human retinal pigment epithelial cells. Nat Protoc. 2009;4(5):662–73. pmid:19373231
- 68. Nakatsuka N, Andrews AM. Differentiating Siblings: The Case of Dopamine and Norepinephrine. ACS Chem Neurosci. 2017;8(2):218–20. pmid:28177214
- 69. Nishijima H, Tomiyama M. What Mechanisms Are Responsible for the Reuptake of Levodopa-Derived Dopamine in Parkinsonian Striatum?. Front Neurosci. 2016;10:575. pmid:28018168