https://orcid.org/0000-0002-9213-9872
Correction
12 Sep 2025: Gao P, Zou Y, Yang M, Li L, Qi Y, et al. (2025) Correction: Identification of the AKCDPK gene family and AkCDPK15 functional analysis under drought and salt stress. PLOS ONE 20(9): e0332416. https://doi.org/10.1371/journal.pone.0332416 View correction
Figures
Abstract
Konjac is one of the important economic crops for poverty alleviation in mountainous areas of Yunnan Province, China. However, there are always various biotic and abiotic stress during its growth, leading to production reduction and quality decline. Calcium-dependent protein kinases (CDPKs) are an important class of genes involved in calcium ion signal transmission within plant tissue cells, yet their presence and functions in konjac remain unexplored. This study aimed to identify the members of the AkCDPK gene family in the Amorphophallus konjac genome and understand their evolution and responses to various stresses. A total of 29 AkCDPK genes were identified and categorized into four subgroups that unevenly distributed across 12 chromosomes. Most AkCDPK have undergone purifying selection during evolution. Cis-acting element analysis revealed that several AkCDPK are involved in phytohormone induction, defence, stress response, and plant development. Expression analysis indicated tissue specificity, and responses to salt, drought, and Pectobacterium carotovorum subsp. carotovorum stress. AkCDPK15, encoding 582 amino acids, was cloned. AkCDPK15 was mainly localised on the cell membrane, and overexpression in tobacco revealed that it can positively regulate the tolerance of transgenic tobacco strains to salt and drought stress. These findings provide a theoretical foundation for future research on the function of the CDPK gene family in A. konjac, potentially aiding in the development of stress-resistant konjac varieties.
Citation: Gao P, Zou Y, Yang M, Li L, Qi Y, Guo J, et al. (2025) Identification of the AKCDPK gene family and AkCDPK15 functional analysis under drought and salt stress. PLoS One 20(6): e0325453. https://doi.org/10.1371/journal.pone.0325453
Editor: Sumita Acharjee, Assam Agricultural University Faculty of Agriculture, INDIA
Received: December 23, 2024; Accepted: May 13, 2025; Published: June 11, 2025
Copyright: © 2025 Gao et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the paper and its Supporting Information files.
Funding: The funder of Yunnan Education Department Research Project (grant no. 2022J0644, 2023J0827) play a role in study design and decision to publish; The funder of applied Basic Research Foundation of Yunnan Province (grant no. 202301AU070136, 202301AT070055), Kunming University Talent Program (grant no. YJL23010, YJL23005, YJL23007) play a role in data collection and analysis; The funder of Yunnan Key Laboratory of Konjac Biology, Yunnan Province Yu Lei Expert Grassroots Research Workstation, Yunnan Provincial Science and Technology Department (grant no. 202201AU070043, 202101BA070001-174), Yunnan Provincial Science and Technology Department (grant no. 202449CE340009) play a role decision to publish; The funder of College Student Innovation Training Program Project (grant no.S202411393051, S202411393042) had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Abbreviations: ABA, abscisic acid; ATP, adenosine triphosphate; BLASTP, basic local alignment search tool for proteins; CaMs, calmodulins; CAT, catalase; CDPKs, calcium-dependent protein kinases; CBD, calcium-binding domain; FPKM, fragments per kilobase of transcript per million mapped reads; GFP, green fluorescent protein; GRAVY, grand average of hydropathy; GTP, guanosine triphosphate; GSDS, gene structure display server; iTOL, Interactive Tree Of Life; JA, jasmonic acid; MS, Murashige and Skoog; MW, molecular weight; OE, overexpression; ORF, open reading frame; Pcc, Pectobacterium carotovorum subsp. Carotovorum; Pfam, protein families database; PI, isolectric point; PKD, protein kinase domain; POD, peroxidase; qRT-PCR, quantitative real-time PCR; ROS, reactive oxygen species; SA, salicylic acid; SOD, superoxide dismutase; VNTD, N-terminal variable domain; WT, wild type
Background
The complex growth environment of plants means that they may be subjected to various biotic and abiotic stresses during their lifetimes. Therefore, plants adapt to various harsh environments by regulating their internal environment. These defence responses include a burst of reactive oxygen species (ROS), Ca2+-mediated signalling pathways, and mitogen-activated protein kinase cascade reactions, etc. [1–3]. Calcium-dependent protein kinases (CDPKs) can direct Ca2+ signals to phosphorylation pathways, serving as a sensor and responder to Ca2+ when plants are under stress [4–7].
CDPKs are serine/threonine protein kinases widely distributed in plants [8]. The proteins encoded by CDPK usually contain four domains: calcium-binding (CBD), N-terminal variable (VNTD), Ser/Thr protein kinase (PKD), and self-inhibitory junction (JD) [9]. The CBD contains EF-hand-shaped domains that bind Ca2+. Among the four domains, the PKD is highly conserved and contains Ser/Thr phosphorylation sites, which are involved in activating kinase activity. The VNTD region of most CDPK-encoded proteins contain myristoyl or palmitoyl sites; the JD, usually located near the PKD, inhibits kinase activity and prevents the occurrence of regulatory pathways by binding to pseudo substrates [7,10]. When plants perceive unfavourable environmental conditions, specific Ca2+ signals are generated within the cells. Ca2+ directly binds to the EF-hand structure, relieves the self-inhibitory effect of kinases, realises kinase substrate phosphorylation, and activates kinase activity. In addition, the PKD can bind adenosine triphosphate (ATP) or guanosine triphosphate (GTP) and transfer γ-phosphate groups to receptor hydroxyl residues, activate substrates, and induce various physiological reactions in plants [11,12].
Recent studies have indicated that CDPKs play a role in plant growth and stress response. When rice (Oryza sativa) is subjected to water deficiency, OsCDPK5 enhances its resistance to drought by increasing its photosynthetic activity [13]. Potato (Solanum tuberosum) CDPKs, such as StCDPK28, have similar functions in response to water deficiency [14]. OsCPK12 positively regulates rice productivity by prolonging its growth period [15]. SpCPK33 enhances cold resistance in tomatoes by reducing ROS accumulation and regulating the expression of stress-related genes [16]. In wheat (Triticum aestivum), TaCDPK27 negatively regulates wheat resistance to powdery mildew (Blumeria graminis f. sp. tritici) by participating in the regulation of ROS production, antioxidant enzyme activity, and programmed cell death processes [17]. And the positive regulatory gene TaCDPK7 in wheat is involved in tolerance to Puccinia striiformis f. sp. tritici by regulating the content of hydrogen peroxide and the expression of related defence genes [18].
Konjac is an economically important crop in China. Amorphophallus konjac is the most-commonly cultivated konjac species in agriculture. However, A. konjac is often threatened by drought, salt stress, and soft rot during cultivation, which hinders the development of the konjac industry. As the CDPK gene family acts as receptors for calcium ions, playing important roles in regulating plant growth and development, hormone responses, and a variety of biotic and abiotic stresses responses, we suspected that it plays a key role in the water deficit, salt, and disease resistance of A. konjac. At present, the complete genome sequencing of A. konjac has laid the foundation for exploring the expression, evolution, and functional characteristics of CDPK in A. konjac at the whole genome level [19,20]. Consequently, to explore the function and genetic evolution of AkCDPK, bioinformatics were used to identify and analyse the AkCDPK gene family members from the whole genome of A. konjac. Quantitative real-time PCR (qRT-PCR) was employed to analyse the expression levels of the AkCDPK gene family under Pectobacterium carotovorum subsp. carotovorum (Pcc) stress and abiotic stressors, such as mannitol and salt. The function of AkCDPK15 was studied by overexpression in tobacco (Nicotiana benthamiana). This study provides a theoretical foundation for future research on AkCDPK functions in A. konjac, potentially aiding in the development of stress-resistant konjac varieties.
Methods
Plant materials and treatments
A. konjac was supplied by the Konjac Genetic Research Center (Kunming University, Kunming, Yunnan, China). Two-month-old A. konjac seedlings were grown in a greenhouse at 28 ± 2 °C, 6000 lx, a relative humidity of 75%, and 16 h/8 h (day/night). Nine A. konjac seedlings with the same growth rate were collected from each treatment in triplicates.
For abiotic stress, two-month-old A. konjac seedlings were treated with 200 mM NaCl and 100 mM mannitol for 0, 24, and 48 h to induce salt and drought stress.
For biotic stress, two-month-old A. konjac seedlings were inoculated with either sterile water or Pcc bacterial suspension (100 µL; 108 cfu/mL) [21]. The sites injected with sterile water served as controls. An inoculation site was selected for each plant. The cultivation conditions for the plants were kept unchanged. The samples were collected at 0, 24, 48, and 72 h.
Identification of CDPKs in A. konjac by bioinformatic analysis
The A. konjac genome database was downloaded from https://doi.org/10.6084/m9.figshare.15169578. Arabidopsis CDPK protein sequences were downloaded from https://www.arabidopsis.org/ (S1 Table). O. sativa CDPK sequences were downloaded from http://rice.uga.edu/pub/data/Eukaryotic_Projects/o_sativa/annotation_dbs/pseudomolecules/version_7.0/all.dir/ (S1 Table). Arabidopsis and rice CDPK amino acid sequences were employed to construct a hidden Markov model to search the HMMER 3.0 (http://hmmer.janelia.org/) software [22] to identify all potential AkCDPK family numbers of A. konjac. The candidate reference sequences were compared using the BLASTP (version: ncbi last v2.10.1+) [23] with an e-value of 1e-20. The sequences containing the PF00069 and PF13499 domains were then annotated as AkCDPK gene family numbers by pfamscan (version: v1.6) and Pfam A (version: v33.1) [24,25] (S1 Table).
Sequence analysis of AkCDPK
The bioinformatics analysis of AkCDPK were predicted using the ExPASY PROTPARAM tool (http://web.expasy.org/protparam/). MEME software (version: v5.0.5) [26] was used to analyse the similarity and diversity of protein motifs, and conserved motifs of AkCDPK family numbers. MG2C (http://mg2c.iask.in/mg2c_v2.1/) [27] was employed to draw the chromosome physical location map of the AkCDPK family numbers. The transmembrane domains, signal peptides, and subcellular localisation were predicted by DeepTMHMM (version 1.0.8), SignalP (version: v5.0b), and WOLFPSORT (https://wolfpsort.hgc.jp/), respectively. The transcription factor (TF) binding sites in each AkCDPK was predicted using the PlantCARE software (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) [28].
MAFFT (version: v7.427) [29] was employed to perform multiple alignments of CDPK sequences from A. konjac (AkCDPK), Arabidopsis thalliana (AtCDPK), and Oriza sativa (OrCDPK). MEGA (MEGA10) software was used to construct phylogenetic tree (neighbour-joining (NJ) method, 1000 bootstrap) using the p-distance model [30]. The NJ tree was then annotated by the interactive Tree of Life v6 software (https://itol.embl.de/) [31]. The AkCDPK protein multiple sequence alignment was performed using Jalview software [32] to further elucidate the characteristics of the AkCDPK family. And the GSDS tool (http://gsds.cbi.pku.edu.cn/) [33] was employed to display the gene structure.
Selection pressure analysis of the AkCDPK family
The non-synonymous substitution rate (Ka)/ synonymous substitution rate (Ks) ratios of paralogous AkCDPK gene pairs were calculated using KaKs_Calculator (version: 2.0) software to determine whether AkCDPKs had selection pressure [34].
Collinearity analysis of AkCDPK
MCScanX software was employed to conduct the collinearity analysis of AkCDPK [35].
Expression profiles of AkCDPK
The expression profiles of AkCDPK in the roots, corms, petioles, and leaves were obtained from the NCBI (S2 Table). The expression levels under salt stress, drought stress and Pcc stress treatments were determined using qRT-PCR.
A. konjac seedlings were cultivated at 27 ± 2 °C for one months. Total RNA was extracted from the all tested samples using the Trelief ® Hi-Pure Plant RNA Plus Kit (Tsingke Biotechnology Co., Ltd., Beijing, China), the total RNA was revised to cDNA using SynScript® III cDNA Synthesis Mix (Tsingke). Followed by the 1.1 × EasyQ SYBR qPCR Mix (Low ROX Premixed) EasyQ (Tsingke) was employed to conduct qRT-PCR. All experimental protocols were based on the manufacturer’s instructions. Each reaction carried out with three technical replicates. The 2−(ΔΔCt) method [36] was used to calculate relative expression levels of the tested AkCDPK genes. The qRT-PCR primers were shown in S3 Table.
AkCDPK15 subcellular localisation and phosphorylation site analyses
The sequence 35S::AkCDPK15::GLOsGFP was generated by amplifying the coding sequence of AkCDPK15 without the terminal codon from A. konjac cDNA, using the primers pBWA(V)HS-AkCDPK15-GLOsGFP-F (AGAGAACACGGGGGACTTTGCAACATGGGCAACACATGCCGC) and pBWA(V)HS-AkCDPK15-GLOsGFP-R (GTACTGAAGACAGAGCTAGTTACATTAGGATGCCAATGGAGAACCTCTCATG). The PCR fragment was cloned into the pBWA(V)HS-GLOsGFP vector using the MonClone™ Single Assembly Cloning Mix (Mona [Suzhou] Biotechnology Co., Ltd., Suzhou, China). The constructed expression vector pBWA (V) HS-AkCDPK15 Glosgfp was added to GV3101 for cultivation. After expansion, the bacterial cells were collected and resuspended in a 10 mM MgCL2 (containing 120 μM AS) suspension (OD = 0.6–0.8). The lower epidermis of tobacco was then injected with 1 ml of the above suspension. After injection, the cells were cultured under dark conditions for two days. Labelled leaves were removed, and glass slides were observed under a laser confocal microscope and photographed.
Western blot analysis was performed on transgenic tobacco leaves using transient expression of the pBWA (V) HS-ACDPK15-Glosgfp vector (S1 Fig). The target band was cut and enzymatically hydrolysed using trypsin. The hydrolysed peptide segments were desalted and detected using high-performance liquid mass spectrometry. Finally, the mass spectrometry data were analysed using PD software with the parameter phospho for variable modification, fixed modification for carbammidomethyl (C), and trypsin/P for enzyme digestion, with the first-level mass spectrometry matching tolerance was 3 ppm; the secondary mass spectrometry matching was 20 ppm.
AkCDPK15 gene function analysis
To explore the function of the AkCDPK15 gene, a plate germination experiment was conducted using transgenic lines obtained as follows.
The sequence 35S::AkCDPK15::GFP was generated by amplifying the coding sequence without the terminal codon of AkCDPK15 from A. konjac cDNA using primers pCAMBIA-AkCDPK15-F (GAGGACAGGGTACCCGGGGATCCATGGGCAACACATGCCGC) and pCAMBIA-AkCDPK15-R (CTAGTGTCGACTCTAGAGGATCCTTAGGATGCCAATGGAGAACCTCTCATG). The PCR fragment was cloned into the pCAMBIA-1300 vector using the MonClone™ Single Assembly Cloning Mix (Mona [Suzhou] Biotechnology Co., Ltd., Suzhou, China). Followed by transforming the successfully constructed pCAMBIA-AkCDPK15 plasmid into Agrobacterium tumefaciens strain GV3101. This was followed by the transformation of A. tumefaciens carrying the pCAMBIA-AkCDPK15 vector into N. benthamiana leaves and overexpression of AkCDPK15 via the leaf disc transformation method. The obtained transgenic strains were amplified using specific primers, pCAMBIA-AkCDPK15-FA (TTCATTTGGAGAGAACACGGGGGAC) and pCAMBIA-AkCDPK15-RA (GATTGAGAGGAAGGACAACCAA) (S2 Fig). The overexpressing AkCDPK15 representative lines were used for further analyses.
First, transgenic (OE1, OE2, OE3) and wild-type (WT) strains were cultured on a flat plate (130 mm*130 mm) containing ½ Murashige & Skoog (MS) medium supplemented with 200 mM NaCl and 100 mM mannitol, and a statistical analysis on the root length of AkCDPK15 was conducted after 14 d culture (n = 10).
Next, one-month-old AkCDPK15-overexpressing and WT tobacco strains were subjected to water deficit treatment. Twenty tobacco plants for both AkCDPK15 transgenic strain and WT strain were subjected to drought stress conditions. For the drought stress treatment, water was withheld from the AkCDPK15 transgenic and WT strains for two weeks, followed by regular watering for two days. Malondialdehyde (MDA), H2O2, proline, soluble sugar accumulation, and antioxidant enzyme activity were then measured.
For H2O2 accumulation assessment, detection kits for MDA content, soluble sugar content, proline content, and superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) enzyme activities (Beijing Solarbio Technology Co., Ltd., Beijing, China) were used with spectrophotometry.
Results
Identification of AkCDPK family members in A. konjac
A total of 29 putative CDPK proteins were identified in the A. konjac genome and named AkCDPK1–AkCDPK29. The full length of the 29 AkCDPK proteins varied from 497 (AkCDPK1) to 616 (AkCDPK29) amino acids (aa), with coding sequence (CDS) lengths ranging from 1494 to 1851 bp. The MW varied from 51.80 (AkCDPK3/11) to 66.94 KDa (AkCDPK29), whereas the theoretical isoelectric points (pI) varied from 5.16 (AkCDPK2) to 9.08 (AkCDPK21). Among the family members, most genes encoded unstable protein. The grand average of hydropathy (GRAVY) varied from −0.59 to −0.186, indicating that all AkCDPK are hydrophilic. Most AkCDPK contained both the predicted N-myristoylation and S-palmitoylation sites, whereas AkCDPK3 contained only one predicted N-myristoylation site. AkCDPK1, 4, and 19 were predicted to contain no N-myristoylation or S-palmitoylation sites. All AkCDPK harboured protein kinase and EF-hand domains (Table 1).
Phylogenetic, gene structure, and chromosomal distribution of AkCDPK
To understand the phylogenetic relationships among the CDPKs in A. konjac, CDPK sequences of three species, A. konjac, A. thaliana, and O. sativa, were employed to construct NJ tree using MEGA10. The CDPK sequences grouped into four subfamilies, with 7, 5, 12, and 5 members in Groups I, II, III, and IV, respectively (Fig 1).
The evolutionary tree was constructed using MEGA10 software with the neighbour-joining method. The numbers next to the branch show 1000 bootstrap replicates, expressed as percentages. The phylogenetic groups of AkCDPK are marked with different colours and legends.
Gene structure, motif, and chromosomal location analyses of CDPK in A. konjac
To understand the possible structural evolution of AkCDPK, the diversity of the exon-intron organisation within the AkCDPK family was compared. As shown in Fig 2A, all AkCDPK members possessed 5–11 introns (3 with 5 introns, 9 with 6 introns, 13 with 7 introns, and 4 with 11 introns). In Group I, members had seven or eight exons. A diverse number of exons were found in Group II: six exons were found in AkCDPK24, AkCDPK26, and AkCDPK28; seven exons were found in AkCDPK7, AkCDPK8, and AkCDPK18; and eight exons were found in AkCDPK2, AkCDPK20, AkCDPK5, AkCDPK22, AkCDPK23, and AkCDPK27. The members in Group III had 7 or 12 exons, of which 7 exons were found in AkCDPK4 and 12 were found in AkCDPK14, AkCDPK16, AkCDPK21, and AkCDPK25. In Group IV, all members had eight exons. These results indicated that CDPK with higher homogeneity usually had the same number of exons.
(A) Structure of the AkCDPK genes. Orange, black, and blue boxes represent the exons, introns, and untranslated regions, respectively. (B) Conserved motifs of AkCDPK proteins. The motifs are indicated by different coloured boxes and their numbers are listed on the right.
The MEME software was used to further understand the similarity and diversity of AkCDPK protein motifs. Fifteen conserved motifs were predicted in AkCDPK family numbers with similar motif types and sequences. Hence, the 29 AkCDPK proteins had the same conserved motifs and orders. AkCDPK4 contained six motifs. AkCDPK1, AkCDPK19, AkCDPK4, AkCDPK3, AkCDPK11, and AkCDPK16 did not contain a motif 13. Compared to other family members, AkCDPK5, AkCDPK22, AkCDPK23, AkCDPK27, AkCDPK7, AkCDPK8, AkCDPK18, AkCDPK24, AkCDPK26, and AkCDPK28 contained a unique motif 10 (Fig 2B).
All 29 AkCDPK in A. konjac were mapped to 12 chromosomes (Fig 3). And there were significant differences in the number of genes on different chromosomes. The largest numbers of genes (AkCDPK7, AkCDPK8, AkCDPK9, AkCDPK10, AkCDPK11, AkCDPK12) were located on chromosome HIC-ASM-0; five genes (AkCDPK21, AkCDPK22, AkCDPK23, AkCDPK24, AkCDPK25) were located on chromosome HIC-ASM-5, and chromosomes HIC-ASM-4 and HIC-ASM-9 were found to contain four AkCDPK each. Chromosomes HIC-ASM-1 and HIC-ASM-11 contained two AkCDPK. Chromosomes CTG-17200, CTG-17475, CTG-18290, CTG-20042, CTG-3081, and CTG-9134 harboured only one AtCDPK each.
The vertical axis represents the length of the chromosomes.
To elucidate the replication events of the AkCDPK gene family, the MCScanX software was used for collinearity analysis. Two duplicated CDPK gene pairs were found in the A. konjac genome: one was segmentally duplicated (AkCDPK14/21) and the other was tandemly duplicated (AkCDPK26/28) (Fig 4A). Furthermore, the collinear correlation among A. konjac, A. thaliana, and O. sativa was calculated to infer the evolutionary history of CDPKs. Two AkCDPK showed syntenic relationships with those in Arabidopsis and six with those in rice (Fig 4B; S4 Table). Two pairs of syntenic orthologous genes (one-to-one) were identified between Arabidopsis and A. konjac CDPK genes: AkCDPK11-AtCPK29 and AkCDPK21- AtCPK18 (Fig 4B; S4 Table). Between rice and A. konjac CDPK, there were two kinds of syntenic orthologous gene pairs: One A. konjac gene and multiple rice genes, such as AkCDPK17-OsCPK2/14/25, and one A. konjac gene vs. one rice gene, such as AkCDPK9-OsCPK6, AkCDPK15-OsCPK13, AkCDPK24-OsCPK9, and AkCDPK29- OsCPK11 (Fig 4B; S4 Table), indicating that these genes might have been derived from the same ancestor of rice and A. konjac. For further evolutionary studies, the number of Ka and Ks were computed to analyse selection pressure (S5 Table). Most orthologous CDPK gene pairs had Ka/Ks < 1, indicating those AkCDPK numbers underwent strong purifying selective pressure during evolution.
(A) Schematic representation of the chromosomal distribution and intrachromosomal relationships of A. konjac CDPK genes. (B) Collinear correlation between A. konjac and A. thaliana, and O. sativa. Grey lines in the background indicate the collinear blocks within A. konjac and other plant genomes, whereas the red lines highlight syntenic AkCDPK gene pairs.
To explore which factors might regulate the level of AkCDPK expression, the PlantCARE database was used to predict cis-acting regulatory elements of AkCDPK (S6 Table). CAAT-box, activating sequence 1 (as-1), and TATA box are cis-acting elements shared by all AkCDPK genes. The remaining cis-acting elements of the genes can be divided into four categories. First, there are multiple phytohormone responsive elements, including salicylic acid response element (TCA-element), gibberellin-responsive element (P-box, TATC-box, and GARE-motif), auxin-responsive element (TGA-box, AuxRR-core), ethylene-responsive element (ERE), ABA response element (ABRE), and MeJA-responsive element (CGTCA-motif and TGACG-motif), suggesting that AkCDPK expression might be regulated by multiple phytohormones. Multiple elements were involved in the light response, such as the G-box, Box 4, and TCCC-motif. What’s more there are varieties of growth and development elements, including meristem expression elements (CAT-box, CCGTCC motif, and CCGTCC-box), flavonoid biosynthetic gene regulation elements (MBSI), lignin biosynthetic gene regulation elements (AC-I and AC-II), endosperm expression elements (GCN4_motif), seed-specific regulatory elements (RY-element), palisade mesophyll cell elements (HD-Zip 1), and circadian elements (O2-site). In addition, stress-responsive elements were found in AkCDPK, for example, the anaerobic induction element (ARE and GC-motif), dehydration-responsive element (DRE core and DRE1), low-temperature-responsive elements, defence and stress-responsive elements (TC-rich repeats), stress-responsive elements (STRE), and wound-responsive elements (WRE3 and WUN-motif) (Fig 5, S6 Table). There were also some transcription factor-binding elements, including the MYB-like sequence, Myb-binding site, and W-box (S6 Table). ABRE, MeJA responsiveness, ARE, and STRE elements were detected in the promoter regions of most AkCDPK. The above results suggest that AkCDPK are not only involved in the growth and development of A. konjac but also in its response to various environmental stresses.
Expression profiles of AkCDPK in different tissues
To understand the possible roles of AkCDPK, the spatial expression patterns of the 29 AkCDPK genes were analysed using RNA-Seq expression data from A. konjac recently published by Li et al. [19]. The results showed that AkCDPK2, 3, 11, 17, and 20 were not expressed in the root, bulb, leaf, or petiole. The remaining genes had high expression levels in the petiole. Moreover, AkCDPK8, 9, 12, and 29 transcript levels in bulbs were significantly higher than those of other genes. Compared with other genes, AkCDPK6, and AkCDPK24 showed higher transcription levels in leaves (Fig 6). These results indicate that AkCDPK gene family members play different regulatory roles in the growth and development of A. konjac.
The heat map shows the relative expression after log10 transformation.
Expression profiles of AkCDPK in response to biotic and abiotic stress
To explore the expression characteristics of AkCDPK family members in response to external stress, qRT-PCR was used to analyse the expression patterns of 18 family members under Pcc infection, drought, and salt stress. Most AkCDPK family members were induced under Pcc stress, except for AkCDPK16 and AkCDPK27; AkCDPK22 and AkCDPK18 were induced at the late stage of Pcc infection (72 h). Most of the genes were induced at the early stage of Pcc infection (24 h) and then downregulated, such as AkCDPK1/5/6/7/9/12/13/14. The expression levels of AkCDPK15, AkCDPK21, and AkCDPK24 were significantly increased within 72 h of Pcc infection (Fig 7). We found that all 18 AkCDPK analysed responded to mannitol and salt stress. Among these genes, the expression level of AkCDPK27 was suppressed with mannitol and salt treatment for 24 h. When A. konjac was subjected to mannitol and salt stress for 24 h, the expression levels of AkCDPK12/13/16 were significantly upregulated, indicating that these three genes may participate in the early stages of osmotic stress. The expression levels of AkCDPK1/4/5/6/7/9/14/15/18/21/22/24/26/29 were significantly higher than those in the control group within 48 h of mannitol and salt treatment (Fig 8).
Cloning and characterisation of AkCDPK15 in A. konjac
The expression profile of A. konjac CDPK family genes suggested that they play an important role in response to different biotic and abiotic stresses. To further understand their function, a Group I member (AkCDPK15) was selected for further study. An open reading frame (ORF) of AkCDPK15, which was 1749 bp long and encoded 582 amino acids, was obtained from A. konjac. The sequence alignment of AtCDPK5/26 revealed a high homology with AkCDPK15. To characterise the subcellular localisation of AkCDPK15, pBWA(V)HS-AkCDPK15-GLOsGFP fusion protein was transformed into tobacco protoplasts. The result showed that AkCDPK15 was mainly localised in the cell membrane region, with a small amount expressed in the nucleus (Fig 9), indicating that AkCDPK15 mainly functioned at these two sites.
Because the function of CDPK genes is often accompanied by protein phosphorylation, we identified the phosphorylation sites of AkCDPK15. The results showed that AkCDPK15 contained eight phosphorylation sites (S87 [88.5], S92 [88.5], T94 [88.5], S359 [77.3], S436 [96.2], S453 [99.7], S508 [83.9], and T526 [90]), and the probability of all phosphorylisable amino acid sites occurring was above 75% (S3 Fig, S7 Table).
AkCDPK15 overexpression enhanced drought and salt tolerance
To understand AkCDPK15 function under drought and salt conditions, we generated several overexpressing transgenic tobacco lines. Plants transformed with the empty vector were considered WT. Three AkCDPK15-overexpressing strains (OE1, OE2, and OE3) were used in further experiments. The root elongation experiments showed that the roots of the WT strain were significantly shorter than those of the AkCDPK15-overexpressing strains treated with 100 mM mannitol and 200 mM NaCl (Fig 10A, B, C, D). In contrast, there was no difference in the root length between the WT and untreated AkCDPK15-overexpressing strains (Fig 10E, F).
(A) AkCDPK15-overexpressing and wild-type strains grown for 14 days on standard 1/2 Murashige and Skoog (MS) medium supplemented with 200 mM NaCl. (B) The root length bar chart of AkCDPK15-overexpressing and wild-type strains grown for 14 days on standard 1/2 MS medium supplemented with 200 mM NaCl. (C) AkCDPK15-overexpressing and wild-type strains grown for 14 days on standard 1/2 MS medium supplemented with 100 mM mannitol. (D) The root length bar chart of AkCDPK15-overexpressing and wild-type strains grown for 14 days on standard 1/2 MS medium supplemented with 100 mM mannitol. (E) AkCDPK15-overexpressing and wild-type strains grown for 14 days on standard 1/2 MS medium without supplementation. (F) The root length bar chart of AkCDPK15 gene overexpression strains and wild-type strains grown for 14 days on standard 1/2 MS medium without supplementation. Different lowercase letters indicate significant differences, as calculated by Student’s t-test).
To further explore the function of AkCDPK15, one-month-old AkCDPK15 transgenic and WT strains were subjected to water deficit stress. Under normal growth conditions, there were no significant differences in the growth of AkCDPK15 transgenic and WT strains (Fig 11A). After 14 days of drought treatment, the degree of leaf wilting in the WT strain was more severe than that in AkCDPK15-overexpressing strains (Fig 11B). Two days after re-watering, both the WT and AkCDPK15-overexpressing strains showed growth recovery. However, yellowing and wilting of the bottom leaves of the WT strains were still higher than those of the AkCDPK15-overexpressing strains (Fig 11C). Taken together, AkCDPK15-overexpressing strains showed stronger resistance to drought stress than did the WT strains.
(A) One-month-old WT strains grown under normal conditions. (B) AkCDPK15-overexpressing and WT strains after 14 days without water. (C) AkCDPK15-overexpressing and WT strains in (B) after re-watering for two days. (D-J) The content of malondialdehyde (MDA) (D), proline (E), soluble sugar (F), H2O2 (G) in WT and AkCDPK15-overexpressing strains under normal and drought stress. The activity of superoxide dismutase (SOD) (H), peroxidase (POD) (I), and catalase (CAT) (J) in WT and transgenic lines under normal and drought stress conditions. Data are presented as mean ± SD (n = 3, *P < 0.05; **P < 0.01, Student’s t-test).
To understand the physiological changes in AkCDPK15-overexpressing and WT strains under drought stress, the MDA, proline, soluble sugar, and H2O2 contents, as well as the SOD, POD, and CAT activities of the two strains after 14 days of water deficit were detected. The results showed that after 14 days of drought stress, the MDA content of the WT strain was approximately 2.08 times higher than that of the AkCDPK15-overexpressing strain (Fig 11D). The proline and soluble sugar contents of the AkCDPK15-overexpressing strain were approximately 3.03 and 1.77 times those of the WT strain, respectively (Fig 11E, F). The H2O2 content of the WT strain was approximately 2.39 times that of the AkCDPK15-overexpressing strain (Fig 11G). However, the SOD, POD, and CAT activities of the AkCDPK15-overexpressing strain were 3.09, 2, and 1.63 times higher than those of the WT strain, respectively (Fig 11H, I, G). No significant differences in physiological indicators were detected under normal cultivation conditions (Fig 11). In short, overexpression of AkCDPK15 in tobacco can enhance tobacco resistance to drought stress by reducing membrane damage in plant cells, enhancing antioxidant enzyme activity, and increasing intracellular stress resistance.
Discussion
Konjac corms are rich in glucosinolates and have broad application prospects in food, health, biomedicine, and industry, making them highly valuable crops. However, konjac is often affected by a variety of biotic and abiotic stressors, leading to a significant decline in its yield and quality. CDPK family genes not only exist in various plant tissues, such as roots, stems, and flowers, but also participate in various plant growth and development processes and respond to environmental stresses. In this study, a screening for CDPK family members from the A. konjac genome resulted in the identification of 29 members, divided into four subfamilies (Groups I-IV), together with an analysis of their structure, evolution, and expression profiles in response to phytohormones, and drought, salt, and Pcc stress.
Previous studies on evolutionary analysis of CDPK family members in Arabidopsis [37], rice [38,39], and patchouli [40] found that they are often divided into four subgroups. Similarly, the 29 AkCDPK family genes were divided into four subgroups. This indicates some degree of similarity in the evolution of the CDPK family members and in the diversity of gene structures among different species. In addition, we also found that AkCDPK family members contain 5–11 introns, similar to Medicago truncatula [41] and pineapple [42]. The number of introns among members of AkCDPK Group III in particular showed significant variability. Nuruzzaman et al. published that the rate of intron loss is higher than intron acquisition [43]. Therefore, we hypothesised that AkCDPK Group III may contain the original genes. Moreover, we noticed that in Group III, AkCDPK members contained a unique conserved motif 10, indicating the conservation of gene structural evolution in Group III.
The distribution of CDPK family members on plant chromosomes is not uniform. For example, in tomato they are mainly distributed on chromosomes 1, 10, and 11 [44], whereas in cucumber they are mainly distributed on chromosomes 2 and 5 [45]. In this study, AkCDPK family members were mainly distributed on chromosomes HIC_ASM_0, HIC_ASM_4, and HIC_ASM_5, but not on every chromosome. Gene replication events lead to fragment and tandem duplications, which play crucial roles in genome rearrangement and expansion [46]. In this study, there were only two collinear gene pairs within the family, indicating that AkCDPK had fewer copies or that copies were discarded more frequently during evolution. To further study the homologous relationships of AkCDPK genes in plants, an interspecific collinearity analysis was performed on Arabidopsis and rice. Two A. konjac genes (AkCDPK11 and AkCDPK21) and two Arabidopsis genes were identified as syntenic orthologs between A. konjac and Arabidopsis, five A. konjac genes (AkCDPK9, AkCDPK15, AkCDPK17, AkCDPK24, and AkCDPK29), and seven rice genes were identified as syntenic orthologs between A. konjac and rice and these genes were distributed in four subgroups. We speculate these seven genes play crucial roles in the evolution of the AkCDPK family. Genetic evolutionary selection analysis revealed that most AkCDPK were purified and selected, which was consistent with the results obtained for Chinese cabbage (Brassica rapa) [47] and M. truncatula [41].
There were multiple cis-acting elements in AkCDPK family member promoter regions that responded to plant hormones, stress, growth, and development, suggesting that the expression of AkCDPK may be regulated by phytohormones and stress, as well as being related to plant growth and development. This finding is consistent with the studies on Arachis hypogaea [48] and Hevea brasiliensis [42]. Moreover, RNA-Seq analysis of AkCDPK in different tissues revealed tissue specificity in AkCDPK expression. For example, AkCDPK2, AkCDPK20, and AkCDPK17 were not expressed in the leaf, petiole, root and corm of A. konjac, and the AkCDPK17 homologous genes AtCPK17 and AtCPK34 are involved in the development of Arabidopsis pollen tubes [49], whereas the AoCPK16 gene (AoCPK16 gene is homologous to AtCPK17 and AtCPK34) has high expression levels in pineapple flowers and leaves [42]. CDPK is also involved in the response to various environmental stressors. For example, in Arabidopsis, under cold stress, the AtCPK28 phosphorylation cascade is activated to regulate transcriptional reprogramming downstream of Ca2+ signalling, positively regulating the response to cold stress [50]. In wheat, the TaCDPK27 gene enhanced resistance to salt stress by reducing ROS production, increasing antioxidant enzyme (POD, SOD, and CAT) activity, and reducing damage to photosystem II [51]. Similarly, in potatoes, StCDPK2 actively participates in salt resistance by enhancing the antioxidant system [52]. In rape (Brassica napus), BnaCPK5 interacts with the ABA-responsive element-binding factors, BnaABF3 and BnaABF4, enhancing its drought resistance [53]. In rice, OsCPK10 positively mediates plant tolerance to drought and rice blast disease by enhancing their antioxidant capacity and protecting them from ROS damage [54]. In this study, all 18 tested genes were induced by mannitol and salt, and 16 genes were induced by Pcc. The expression level of the Group I gene AkCDPK15 was significantly altered under mannitol-, salt-, and Pcc-induced stress. Therefore, the ORF sequence of AkCDPK15 was cloned and its response to drought and salt was analysed using tobacco AkCDPK15-overexpressing tobacco strains. Plants under drought stress often experience changes in a series of physiological indicators, such as cell membrane damage, accumulation of oxides, and changes in enzyme activity [55,56]. A dot plate experiment showed that the root length of AkCDPK15-overexpressing strains was significantly longer than that of the WT strain under mannitol (100 mM) and salt (200 mM NaCl) stress for 14 days. Furthermore, after 14 days water deficit, the activity of POD, SOD, and CAT and the content of proline and soluble sugar of the AkCDPK15-overexpressing strains were significantly higher than those of the WT strain, whereas the MDA and H2O2 contents were significantly decreased compared to those of the WT strains. Under normal cultivation conditions, there were no significant differences in these physiological indicators between the AkCDPK15-overexpressing and WT strains. Taken together, these findings show that AkCDPK15 positively regulates drought and salt resistance in transgenic tobacco.
Conclusion
In brief, 29 AkCDPK genes of A. konjac were identified, which could be divided into four subgroups and were unevenly distributed on 12 chromosomes. The gene motifs of these AkCDPK genes were highly conserved. There was one segmentally duplicated gene pair and one tandemly duplicated gene pair in the AkCDPK family. Between A. konjac and Arabidopsis, there were two syntenic blocks from CDPKs and six between A. konjac and rice. Furthermore, most AkCDPK genes underwent purifying selection during the evolutionary process. What’s more, based on the predicted AkCDPK promoters, those AkCDPK genes are related to phytohormone induction, defence and stress responses, and other functions. AkCDPK exhibited tissue specificity, and the qRT-PCR analysis showing that AkCDPK responded to salt, drought, and Pcc stress. Finally, AkCDPK15 was cloned, and shown to positively regulate plant drought and salt tolerance.
Supporting information
S1 Table. CDPK amino acid sequences of A. thaliana, O. sativa, and A. konjac.
https://doi.org/10.1371/journal.pone.0325453.s001
(XLSX)
S2 Table. NCBI accession IDs for the transcriptome of A. konjac.
https://doi.org/10.1371/journal.pone.0325453.s002
(XLSX)
S4 Table. Duplications of CDPK genes among A. konjac, A. thaliana, and O. sativa.
https://doi.org/10.1371/journal.pone.0325453.s004
(XLSX)
S6 Table. Annotation of cis-acting regulatory elements in AkCDPK promoters.
https://doi.org/10.1371/journal.pone.0325453.s006
(XLSX)
S7 Table. AkCDPK15 phosphorylation site information.
https://doi.org/10.1371/journal.pone.0325453.s007
(XLSX)
S1 Fig. Western blot gel electrophoresis of AkCDPK15.
https://doi.org/10.1371/journal.pone.0325453.s008
(TIF)
S2 Fig. Gel electrophoresis of identification of AkCDPK15 transgenic strains.
https://doi.org/10.1371/journal.pone.0325453.s009
(TIF)
S3 Fig. Identification map of phosphorylation sites in AkCDPK15.
https://doi.org/10.1371/journal.pone.0325453.s010
(TIF)
References
- 1. Peng Y, van Wersch R, Zhang Y. Convergent and Divergent Signaling in PAMP-Triggered Immunity and Effector-Triggered Immunity. Mol Plant Microbe Interact. 2018;31(4):403–9. pmid:29135338
- 2. Thulasi Devendrakumar K, Li X, Zhang Y. MAP kinase signalling: interplays between plant PAMP- and effector-triggered immunity. Cell Mol Life Sci. 2018;75(16):2981–9. pmid:29789867
- 3. Kopecká R, Kameniarová M, Černý M, Brzobohatý B, Novák J. Abiotic Stress in Crop Production. Int J Mol Sci. 2023;24(7):6603. pmid:37047573
- 4. Agurla S, Gahir S, Munemasa S, Murata Y, Raghavendra AS. Mechanism of Stomatal Closure in Plants Exposed to Drought and Cold Stress. Adv Exp Med Biol. 2018;1081:215–32. pmid:30288712
- 5. Harper JF, Breton G, Harmon A. Decoding Ca(2+) signals through plant protein kinases. Annu Rev Plant Biol. 2004;55:263–88. pmid:15377221
- 6. Ludwig AA, Romeis T, Jones JDG. CDPK-mediated signalling pathways: specificity and cross-talk. J Exp Bot. 2004;55(395):181–8. pmid:14623901
- 7. Atif RM, Shahid L, Waqas M, Ali B, Rashid MAR, Azeem F, et al. Insights on Calcium-Dependent Protein Kinases (CPKs) Signaling for Abiotic Stress Tolerance in Plants. Int J Mol Sci. 2019;20(21):5298. pmid:31653073
- 8. Hamel L-P, Sheen J, Séguin A. Ancient signals: comparative genomics of green plant CDPKs. Trends Plant Sci. 2014;19(2):79–89. pmid:24342084
- 9. Boudsocq M, Sheen J. CDPKs in immune and stress signaling. Trends Plant Sci. 2013;18(1):30–40. pmid:22974587
- 10. Yip Delormel T, Boudsocq M. Properties and functions of calcium-dependent protein kinases and their relatives in Arabidopsis thaliana. New Phytol. 2019;224(2):585–604. pmid:31369160
- 11. Seybold H, Boudsocq M, Romeis T. CDPK Activation in PRR Signaling. Methods Mol Biol. 2017;1578:173–83. pmid:28220424
- 12. Liese A, Romeis T. Biochemical regulation of in vivo function of plant calcium-dependent protein kinases (CDPK). Biochim Biophys Acta. 2013;1833(7):1582–9. pmid:23123193
- 13. da Cruz TI, Rocha DC, Lanna AC, Dedicova B, Vianello RP, Brondani C. Calcium-Dependent Protein Kinase 5 (OsCPK5) Overexpression in Upland Rice (Oryza sativa L.) under Water Deficit. Plants (Basel). 2023;12(22):3826. pmid:38005723
- 14. Zhu X, Wang F, Li S, Feng Y, Yang J, Zhang N, et al. Calcium-Dependent Protein Kinase 28 Maintains Potato Photosynthesis and Its Tolerance under Water Deficiency and Osmotic Stress. Int J Mol Sci. 2022;23(15):8795. pmid:35955930
- 15. Wang B, Zhang Y, Bi Z, Liu Q, Xu T, Yu N, et al. Impaired Function of the Calcium-Dependent Protein Kinase, OsCPK12, Leads to Early Senescence in Rice (Oryza sativa L.). Front Plant Sci. 2019;10:52. pmid:30778363
- 16. Hu J, Wang B, Yang T, Li N, Yang H, Yu Q, et al. A calcium-dependent protein kinase gene SpCPK33 from Solanum pennellii associated with increased cold tolerance in tomato. J Plant Physiol. 2022;279:153834. pmid:36272175
- 17. Yue J-Y, Jiao J-L, Wang W-W, Jie X-R, Wang H-Z. Silencing of the calcium-dependent protein kinase TaCDPK27 improves wheat resistance to powdery mildew. BMC Plant Biol. 2023;23(1):134. pmid:36882703
- 18. Goher F, Bai X, Liu S, Pu L, Xi J, Lei J, et al. The Calcium-Dependent Protein Kinase TaCDPK7 Positively Regulates Wheat Resistance to Puccinia striiformis f. sp. tritici. Int J Mol Sci. 2024;25(2):1048. pmid:38256123
- 19. Li L, Yang M, Wei W, Zhao J, Yu X, Impaprasert R, et al. Characteristics of Amorphophallus konjac as indicated by its genome. Sci Rep. 2023;13(1):22684. pmid:38114626
- 20. Gao Y, Zhang Y, Feng C, Chu H, Feng C, Wang H, et al. A chromosome-level genome assembly of Amorphophallus konjac provides insights into konjac glucomannan biosynthesis. Comput Struct Biotechnol J. 2022;20:1002–11. pmid:35242290
- 21. Wei H, Yang M, Ke Y, Liu J, Chen Z, Zhao J, et al. Comparative physiological and transcriptomic profiles reveal regulatory mechanisms of soft rot disease resistance in Amorphophallus spp. Physiological and Molecular Plant Pathology. 2022;118:101807.
- 22. Newberg LA. Error statistics of hidden Markov model and hidden Boltzmann model results. BMC Bioinformatics. 2009;10:212. pmid:19589158
- 23. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215(3):403–10. pmid:2231712
- 24. Finn RD, Bateman A, Clements J, Coggill P, Eberhardt RY, Eddy SR, et al. Pfam: the protein families database. Nucleic Acids Res. 2014;42(Database issue):D222–30. pmid:24288371
- 25. Mistry J, Chuguransky S, Williams L, Qureshi M, Salazar GA, Sonnhammer ELL, et al. Pfam: The protein families database in 2021. Nucleic Acids Res. 2021;49(D1):D412–9. pmid:33125078
- 26. Bailey TL, Boden M, Buske FA, Frith M, Grant CE, Clementi L, et al. MEME SUITE: tools for motif discovery and searching. Nucleic Acids Res. 2009;37(Web Server issue):W202–8. pmid:19458158
- 27. Chao J, Li Z, Sun Y, Aluko OO, Wu X, Wang Q, et al. MG2C: a user-friendly online tool for drawing genetic maps. Mol Hortic. 2021;1(1):16. pmid:37789491
- 28. Lescot M, Déhais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, et al. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002;30(1):325–7. pmid:11752327
- 29. Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol. 2013;30(4):772–80. pmid:23329690
- 30. Kumar S, Nei M, Dudley J, Tamura K. MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief Bioinform. 2008;9(4):299–306. pmid:18417537
- 31. Letunic I, Bork P. Interactive Tree of Life (iTOL) v6: recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Res. 2024;52(W1):W78–82. pmid:38613393
- 32. Waterhouse AM, Procter JB, Martin DMA, Clamp M, Barton GJ. Jalview Version 2--a multiple sequence alignment editor and analysis workbench. Bioinformatics. 2009;25(9):1189–91. pmid:19151095
- 33. Hu B, Jin J, Guo A-Y, Zhang H, Luo J, Gao G, et al. GSDS 2.0: an upgraded gene feature visualization server. Bioinformatics. 2015;31(8):1296–7. pmid:25504850
- 34. Wang D, Zhang Y, Zhang Z, Zhu J, Yu J. KaKs_Calculator 2.0: a toolkit incorporating gamma-series methods and sliding window strategies. Genomics Proteomics Bioinformatics. 2010;8(1):77–80. pmid:20451164
- 35. Wang Y, Tang H, Debarry JD, Tan X, Li J, Wang X, et al. MCScanX: a toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012;40(7):e49. pmid:22217600
- 36. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT Method. Methods. 2001;25(4):402–8. pmid:11846609
- 37. Cheng S-H, Willmann MR, Chen H-C, Sheen J. Calcium signaling through protein kinases. The Arabidopsis calcium-dependent protein kinase gene family. Plant Physiol. 2002;129(2):469–85. pmid:12068094
- 38. Asano T, Tanaka N, Yang G, Hayashi N, Komatsu S. Genome-wide identification of the rice calcium-dependent protein kinase and its closely related kinase gene families: comprehensive analysis of the CDPKs gene family in rice. Plant Cell Physiol. 2005;46(2):356–66. pmid:15695435
- 39. Ray S, Agarwal P, Arora R, Kapoor S, Tyagi AK. Expression analysis of calcium-dependent protein kinase gene family during reproductive development and abiotic stress conditions in rice (Oryza sativa L. ssp. indica). Mol Genet Genomics. 2007;278(5):493–505. pmid:17636330
- 40. Liu X, Zeeshan Ul Haq M, Yu J, Liu Y, Yang H, Cui H, et al. Identification of the CDPK gene family in patchouli and functional analysis in response to continuous cropping stress. Front Plant Sci. 2023;14:1300073. pmid:38078089
- 41. Zhao P, Liu Y, Kong W, Ji J, Cai T, Guo Z. Genome-Wide Identification and Characterization of Calcium-Dependent Protein Kinase (CDPK) and CDPK-Related Kinase (CRK) Gene Families in Medicago truncatula. Int J Mol Sci. 2021;22(3):1044. pmid:33494310
- 42. Zhang B, Song Y, Zhang X, Wang Q, Li X, He C, et al. Identification and expression assay of calcium-dependent protein kinase family genes in Hevea brasiliensis and determination of HbCDPK5 functions in disease resistance. Tree Physiol. 2022;42(5):1070–83. pmid:35022787
- 43. Nuruzzaman M, Manimekalai R, Sharoni AM, Satoh K, Kondoh H, Ooka H, et al. Genome-wide analysis of NAC transcription factor family in rice. Gene. 2010;465(1–2):30–44. pmid:20600702
- 44. Li Y, Zhang H, Liang S, Chen X, Liu J, Zhang Y, et al. Identification of the CDPK Gene Family in Solanum habrochaites and Its Function Analysis under Stress. Int J Mol Sci. 2022;23(8):4227. pmid:35457042
- 45. Fedorowicz-Strońska O, Koczyk G, Kaczmarek M, Krajewski P, Sadowski J. Genome-wide identification, characterisation and expression profiles of calcium-dependent protein kinase genes in barley (Hordeum vulgare L.). J Appl Genet. 2017;58(1):11–22. pmid:27447459
- 46. Vision TJ, Brown DG, Tanksley SD. The origins of genomic duplications in Arabidopsis. Science. 2000;290(5499):2114–7. pmid:11118139
- 47. Wu P, Wang W, Duan W, Li Y, Hou X. Comprehensive Analysis of the CDPK-SnRK Superfamily Genes in Chinese Cabbage and Its Evolutionary Implications in Plants. Front Plant Sci. 2017;8:162. pmid:28239387
- 48. Fan S, Yang S, Li G, Wan S. Genome-Wide Identification and Characterization of CDPK Gene Family in Cultivated Peanut (Arachis hypogaea L.) Reveal Their Potential Roles in Response to Ca Deficiency. Cells. 2023;12(23):2676. pmid:38067104
- 49. Myers C, Romanowsky SM, Barron YD, Garg S, Azuse CL, Curran A, et al. Calcium-dependent protein kinases regulate polarized tip growth in pollen tubes. Plant J. 2009;59(4):528–39. pmid:19392698
- 50. Ding Y, Yang H, Wu S, Fu D, Li M, Gong Z, et al. CPK28-NLP7 module integrates cold-induced Ca2+ signals and transcriptional reprogramming in Arabidopsis. Sci Adv. 2022;8(26):eabn7901. pmid:35767615
- 51. Yue J-Y, Jiao J-L, Wang W-W, Wang H-Z. The Calcium-Dependent Protein Kinase TaCDPK27 Positively Regulates Salt Tolerance in Wheat. Int J Mol Sci. 2022;23(13):7341. pmid:35806346
- 52. Grossi CEM, Santin F, Quintana SA, Fantino E, Ulloa RM. Calcium-dependent protein kinase 2 plays a positive role in the salt stress response in potato. Plant Cell Rep. 2022;41(3):535–48. pmid:33651205
- 53. Cheng H, Pan G, Zhou N, Zhai Z, Yang L, Zhu H, et al. Calcium-dependent Protein Kinase 5 (CPK5) positively modulates drought tolerance through phosphorylating ABA-Responsive Element Binding Factors in oilseed rape (Brassica napus L.). Plant Sci. 2022;315:111125. pmid:35067297
- 54. Bundó M, Coca M. Calcium-dependent protein kinase OsCPK10 mediates both drought tolerance and blast disease resistance in rice plants. J Exp Bot. 2017;68(11):2963–75. pmid:28472292
- 55. Godwin J, Farrona S. Plant Epigenetic Stress Memory Induced by Drought: A Physiological and Molecular Perspective. Methods Mol Biol. 2020;2093:243–59. pmid:32088901
- 56. Sato H, Mizoi J, Shinozaki K, Yamaguchi-Shinozaki K. Complex plant responses to drought and heat stress under climate change. Plant J. 2024;117(6):1873–92. pmid:38168757