Figures
Abstract
Salmonella enterica is a bacterial foodborne pathogen that can infect humans and animals. Proper control of Salmonella requires routine surveillance and interventions across the food-production chain. However, due to limited resources the epidemiology and transmission of non-typhoidal Salmonella serotypes remain poorly understood in several African settings, including within Ghana. Here, we employed bacterial culture and whole genome sequencing (WGS) to investigate the prevalence, virulence and antimicrobial resistance determinants of Salmonella enterica isolates from beef, cattle blood and human patient stool in Greater Tamale Metropolis, Ghana. Enrichment and culture of the specimens yielded 62 isolates in total from beef (31), bovine blood (28) and human diarrhoeal specimens (3). We identified at least 15 STs and 18 different Salmonella serovars. The most frequently detected serovars were Poona (n = 13), Montevideo (n = 10) and Poano (n = 7) with S. Montevideo being the most common from cattle blood. Thirty-two (52%) isolates belonged to novel sequence types (STs), with ST2609 (n = 9) being most common. Four raw beef isolates harboured at least one gene conferring resistance to beta-lactam (blaTEM-1), chloramphenicol (catA), fosfomycin (fosA7), quinolone (qnrD1) or tetracycline (tet(A)). Eight isolates carried IncF, IncI and/or Col3M plasmid replicons. This study recovered Salmonella, often belonging to previously undocumented STs, at high frequencies from cattle and beef and demonstrated that isolates from human diarrhoeal patients are closely related to bovine isolates. The data highlight the need for broader and sustained surveillance and the urgent need for food safety interventions in Ghana.
Citation: Sunmonu GT, Saba CKS, Odih EE, Bright O, Osei EEY, Mensah A, et al. (2025) Genomic analysis of Salmonella enterica from cattle, beef and humans in the Greater Tamale Metropolis of Ghana. PLoS One 20(6): e0325048. https://doi.org/10.1371/journal.pone.0325048
Editor: Leonard Ighodalo Uzairue, Federal University Oye-Ekiti, NIGERIA
Received: November 18, 2024; Accepted: May 6, 2025; Published: June 18, 2025
Copyright: © 2025 Sunmonu et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: The sequence reads were deposited in the European Nucleotide Archive with the study accession PRJEB58695. Individual sequence accession numbers are listed in S1 Table.
Funding: Whole genome sequencing and analysis for this project was supported through SEQAFRICA. The SEQAFRICA project is funded by the Department of Health and Social Care’s Fleming Fund using UK aid. INO is a Calestous Juma Fellow supported by the Bill and Melinda Gates Foundation (INV-036234). The views expressed in this publication are those of the authors and not necessarily those of the UK Department of Health and Social Care, its Management Agent, Mott MacDonald or any of the other funders. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Salmonella enterica is a well-known bacterial foodborne pathogen that causes a wide spectrum of infections in both humans and animals [1]. The enormous and global impact of Salmonella on public health and food safety stems from their aetiologic role in gastroenteritis and systemic infections, including bacteraemia [2,3]. Non-typhoidal Salmonella (NTS) infections, often zoonotic, are primarily caused by Subspecies 1 of Salmonella enterica, are often linked to contaminated animal products, such as poultry, eggs, and dairy, and typically result in gastrointestinal illness in humans [4]. While typically self-limiting, NTS can also lead to severe invasive infections in vulnerable sub-populations, such as young children, the elderly, and immunocompromised individuals, posing a substantial challenge to public health systems worldwide [5].
The incidence of Salmonella infections from meat and other animal products can vary depending on factors such as adherence to food safety regulations, prevalence in animals, handling, cooking methods, and epidemiological surveillance systems in place [6,7]. Salmonella contamination of animal products remains a significant concern for public health worldwide. In the United States, European Union member states, and many other parts of the world, regulatory agencies monitor and track foodborne illnesses, including those caused by Salmonella, through surveillance programs [8]. These programs help to estimate the incidence of Salmonella infections associated with beef consumption.
Despite the high incidence of both gastrointestinal and invasive non-typhoidal Salmonella infections [9,10], Salmonella enterica remains understudied across Africa due to inadequate clinical microbiology laboratory and surveillance infrastructure, as well as insufficient funding for existing systems [11,12]. Previously reported Salmonella serovars in Ghana include Kaapstad (ST4605 from beef and mutton), Hato (ST5308 from chicken; ST3899 from guinea fowl), Lagos (ST2469 from beef and goat) and Infantis (ST603 from goat) [13]. Additionally, Salmonella serovars identified in chicken eggs in Ghana include S. Enteritidis (ST11), S. Hader, and S. Chester. Strains of these serovars carry virulence genes, such as those encoding fimbrial adherence and secretion systems (inv, spa, ssa and sse), and resistance determinants against fluoroquinolones (gyrA (D87N), qnrB81), aminoglycosides (aadA1, aph(3“)-Ib aph(6)-Id), tetracycline (tet(A)), phenicols (catA1) and trimethoprim (dfrA14 and dfrA1) [14]. While some studies [13–16] have investigated the role of meat and other animal products in the spread of Salmonellosis in Ghana, no study has investigated its prevalence in slaughter cattle. Understanding the transmission dynamics and genetic diversity of Salmonella enterica across different reservoirs is crucial for devising effective control strategies and mitigating its associated risks. In this study, we determined the prevalence of Salmonella enterica in the beef value chain and among humans presenting with diarrhoea in hospitals in the Greater Tamale Metropolis of Ghana.
Materials and methods
Ethical considerations
Ethical approval for whole genome sequencing-based surveillance and research for this study was obtained from the Noguchi Memorial Institute for Medical Research, Ghana, NIMIMP-052/21/22.
Experimental design and sample collection
Beef samples were randomly collected from vendors across the Greater Tamale Metropolis, while cattle blood samples were collected at the Greater Tamale Abattoir. The Tamale metropolis comprises north, south, east, west and central areas. An initial survey to identify vendors in these regions was done, and number codes allocated. Similarly, customers who came to slaughter their livestock at the abattoir were given number codes. Using random number generator from Microsoft excel, these codes were input and sampling codes for vendors and blood from cattle were obtained, respectively. These cattle are brought from a range of locations in Ghana, as well as from other countries, including Burkina Faso, Mali, and Niger, to the Greater Tamale Abattoir where they are slaughtered and processed for sale. Blood was collected at slaughter in collaboration with butchers to ensure that the animals experienced no additional harm beyond what is typical in standard butchering practices but no approval from an animal ethics committee was received at the time of collection. To reduce the chance of contamination, the first blood at slaughter was discarded after which 30–35 ml of cattle blood samples were collected aseptically into labelled sterile 50 ml tubes (Falcon®). Butchers and supervising laboratory scientists first sanitized their hands with 70% ethanol and then donned sterile gloves for each blood sample collection. This was repeated for each animal’s blood sampled. Faecal samples were collected from patients with diarrhoea attending the Tamale Central Hospital, Tamale West Hospital and Seventh Day Adventist Hospital between 31st October, 2016–21st May, 2017, using sterile stool containers. No clinical triage documentation is available. We collected and processed a total of 124 beef samples, 150 cattle blood samples, and 80 human stool samples. Stool samples were collected aseptically by patients under clinicians’ instructions using sterile stool-collection containers. All samples (beef, cattle blood and human faecal sample) were transported in ice chests with ice within 2 hrs of collection to the Spanish Laboratory Complex of the University for Development Studies, Tamale, Ghana for analyses for processing and isolation of bacteria. Coded bacterial isolates and meta-data for retrospective sequence generation and analysis in this study were processed in October 2022. The investigators did not have access to patient identifying information.
Salmonella isolation and identification
Salmonella enterica were isolated on Xylose Deoxycholate (XLD) agar after pre-enrichment on peptone and selective enrichment on Modified Semi-Solid Rappaport-Vassiliadis (MSRV) agar. Bacterial colonies having morphological characteristics similar to Salmonella (a black centre and a slightly red coloured translucent zone) were sub-cultured to obtain pure colonies and Gram stained. PCR targeting the invA gene (284 bp) as described by Rahn et al. (1992) [17], using PCR oligonucleotides using PCR oligonucleotides invA139f GTGAAATTATCGCCACGTTCGGGCAA and invA141r TCATCGCACCGTCAAGGAACC as described previously [18]. PCR products were separated on 1.5% (w/v) agarose gels, stained with gel red (Biotium) and visualized using a transilluminator (UVP GelMax Imager).
Further biochemical profiling and biotyping of the isolates, was conducted using the Gram-negative (GN) test kit (Ref: 21341) on VITEK 2 systems (version 2.0, Marcy-l’Etoile, France, Biomérieux) according to manufacturer’s instructions. Strains identified as Salmonella biochemically, were whole genome sequenced.
DNA extraction, library preparation and whole genome sequencing
Genomic DNA of the isolates was extracted using Wizard DNA extraction kit (Promega; Wisconsin, USA) in accordance with manufacturer’s protocols. The extracted DNA was quantified using a dsDNA Broad Range quantification assay on a Qubit fluorometer (Invitrogen; California, USA). DNA libraries were prepared using NEBNext Ultra II FS DNA library kit for Illumina with 96-unique indexes (New England Biolabs, Massachusetts, USA; Cat. No: E6609L). The DNA libraries were quantified using dsDNA High Sensitivity quantification assay on a Qubit fluorometer (Invitrogen; California, USA) and their average fragment length was determined using 2100 Bioanalyzer (Agilent). Libraries were sequenced on an Illumina MiSeq (Illumina, California, USA). The raw sequence reads were de novo assembled using SPAdes v3.15.3 [19] as implemented in the GHRU assembly pipeline (https://gitlab.com/cgps/ghru/pipelines/dsl2/pipelines/assembly). The details of the sequencing statistics showing sequencing depth, coverage and read length is presented in S1 Table and European Nucleotide Archive accessions (PRJEB58695) are in S2 Table.
Sequence typing of Salmonella genomes
Sequence reads were deposited in the Salmonella database for Salmonella on EnteroBase v1.2.0 [20] to determine the multi-locus sequence types (MLST) using the Achtman 7 Gene scheme. The Salmonella genome assemblies were analysed using the Salmonella In-Silico Typing Resource (SISTR) for the prediction of serovars and serogroups [21] (https://github.com/phac-nml/sistr_cmd).
Identification of plasmid replicons, antimicrobial resistance and virulence genes
Plasmid replicons present in the assembled genomes were detected using PlasmidFinder [22]. Antimicrobial resistance (AMR) genes carried by the isolates and the drug classes to which they possibly conferred resistance were predicted using AMRFinderPlus v3.10.24 [23] and its associated database (version 2022-04-04.1). We also detected the virulence genes present in the isolates using ARIBA [24] with the virulence factor database (VFDB).
Phylogenetic analysis
We annotated the genomes of all S. enterica genomes using Prokka v1.14.6 [25] with default parameters and constructed a core genome alignment using Panaroo v1.3.2 [26] in ‘strict’ mode and excluding invalid genes. A core genome phylogeny was then inferred from the resulting alignment using RaxML-NG v1.1.0 [27] with the generalised time reversible gamma model, 20 random and parsimony-based starting trees, and 1000 bootstrap replicates with convergence estimation every 50 iterations. Bootstrapping converged after 700 replicates. To determine the degree of phylogenetic relatedness between the strains, reference-based phylogenies were also constructed for each serovar with at least five genomes. Complete representative reference sequences for each serovar were systematically selected from the National Center for Biotechnology Information Reference Sequence (RefSeq) database (https://www.ncbi.nlm.nih.gov/refseq/) using BactinspectorMax v0.1.3 (https://gitlab.com/antunderwood/bactinspector). Accession numbers for the selected references include GCF_000486765.2 (Poano), GCF_900478385.1 (Poona), and GCF_003031875.1 (Montevideo). For each serovar, the sequence reads were then mapped to the chromosome of the respective reference genome using BWA (v0.7.17) [28] and variants were called and filtered using BCFtools v1.9 [29] as implemented in the GHRU single nucleotide polymorphism (SNP) phylogeny pipeline (https://gitlab.com/cgps/ghru/pipelines/snp_phylogeny). Variant positions were concatenated into a pseudoalignment and used to generate a maximum likelihood tree using IQ-TREE v1.6.8 [30]. SNP distances between the genome pairs were calculated using snp-dists v.0.8.2 (https://github.com/tseemann/snp-dists).
Results
Prevalence of Salmonella in the studied specimens
Culture and initial tests on MSRV and XLD yielded presumptive Salmonella from 37/124 (29.8%) raw beef samples, of which 31 (25% of the 124 specimens) were eventually confirmed as S. enterica based on whole genome sequencing (WGS). For the cattle blood samples, 37/150 (24.7%) were positive for presumptive Salmonella, and 28/150 (18.7%) were confirmed positive. Among the human faecal samples, recorded 3/80 (3.8%) were positive for presumptive Salmonella, all of which were confirmed to be S. enterica based WGS. In all, the genomes of sixty-two Salmonella isolates were sequenced in this study; 31 were from raw beef, 28 from blood of slaughtered cattle, and three from human stool.
Salmonella serotypes, sequence types, and phylogeny
The most common serotypes detected in this study were Poona (n = 13, 21%), Montevideo (n = 10, 16.1%), Poano (n = 7, 11.3%), Chester (n = 5, 8.1%) and Give (n = 4, 6.5%). Other represented serotypes include; Gaminara (n = 3), Llandoff (n = 3), Muenster (n = 3), Odozi (n = 3), Bredeney (n = 1), Labadi (n = 1), Pisa (n = 1), Scarborough (n = 1), Vinohrady (n = 1), Yoruba (n = 1), I 1,3,19:z:- (n = 2), I 28:g,t:- (n = 2) and I 4:y:- (n = 1) (S3 Table).
The most common sequence types (STs) were ST2609 and ST411 which were represented by ten (14.5%) and four (6.5%) isolates respectively (Fig 1). As many as 32 (51.6%), including all 10 Montevideo (ST10441) and seven isolates of the rare Poano serotype (ST10439 (n = 6), ST10437 (n = 1)) belonged to a novel ST (S4 Table). The 13 S. Poona isolates belonged to ST2609 (n = 10), ST308 (n = 2), and novel ST10442 [1]. Four of the Chester serotype strains belong to ST411 while one is a single locus variant of the sequence type (ST411*). The four Give serotype belong to ST516 (Fig 1, S3 Table).
A mid-point rooted maximum likelihood phylogenetic tree based on core genome and created using IQ-Tree annotated with ST, serotypes, location of isolation, host of isolates and virulence genes not shared by all isolated in the assembled genomes. The data are available in interactive format on Microreact (https://microreact.org/project/frWNVcb5zLZy22GfXAbBnL-ghru-ghcks2006-salmonella-enterica).
The most serotype and sequence type diversity in this study was seen among raw beef and slaughtered cattle blood isolates. Uncommonly recovered ST306 (n = 1), ST308 (n = 2), ST321 (n = 1), ST2176 (n = 1), ST7643 (n = 1), ST8515 (n = 2) and ST8631 (n = 1) were found only in raw beef isolates and ST516 (n = 4) was found only in blood of slaughtered cattle. Two of the human stool isolates belong to Montevideo serotype and a previously unreported sequence type (ST10441) while the third belongs to ST2152 and the Gaminara serotype (Fig 1, S3 Table). Both of these serotypes and STs were also recovered from bovine sources in the study.
A core genome-based phylogeny of 62 Salmonella isolates from this study is presented in Fig 1. Isolates belonging to the same serovar clustered together on the phylogenetic tree, except the three S. Muenster strains. Two of the S. Muenster strains, belonging to a Novel ST (ST10440), clustered together and away from the third (ST321) strain, which was located on a distinct branch on the tree and most closely related to the four S. Give strains. To determine the phylogenetic relatedness between isolates belonging to the same serovar, we reconstructed whole genome reference-based phylogenies for each distinct serovar with ≥5 genomes (S1 Fig). The two human S. Montevideo isolates were identical (0 SNPs) to six other S. Montevideo isolates from cattle blood (n = 5) and meat (n = 1). The two remaining animal S. Montevideo isolates differed by 1–2 SNPs from the rest of the S. Montevideo strains (S5 Table). Conversely, the S. Poano isolate from beef was distantly related (≥600 SNPs) to the six isolates from cattle blood, which were almost identical (≤1 SNP) (S6 Table). Among the S. Poona isolates, one beef isolate was identical to seven isolates from cattle blood (≤1 SNP) (S7 Table).
Virulence factors, plasmid replicons and antimicrobial resistance gene profiles of Salmonella
All the isolates carry multiple genes that have been shown to be important for Salmonella virulence. The curli (csg) genes were present in all Salmonella isolates as well as the fimbrial operon bcf, and fim) genes. All the isolates had at least two ste fimbrial genes, steB and steC. Long polar fimbriae (lpf) genes were present in isolates from all serovars except S. Bredeney, Chester, Gaminara, Give, Odozi, Poano, Poona, and Scarborough, accounting for 38.7% (24/62) of the isolates. Only the S. Montevideo strains carried the virulence factor ratB, associated with long-term intestinal persistence and the I 1,3,19:z:- strain carry shdA, which encodes an autotransporter. The inv, org, prg, sif, spa, ssa, ssc, sse, ssp and sop type III secretion system effector genes were detected in all the isolates while avr was present in 91.9% (57/62) of the isolates. Thirty-eight (61.3%) of the isolates also carry the cytholethal distending toxin gene, cdtB. Genes involved in host cell manipulation and invasion such as: slrP, sptP, sicP, sicA, pipB, mig-14, misL, sinH and sseL were present in all isolates while pipB2 was present in 66.1% (41/62) of isolates (Fig 1, S3 Table). The virulence genes gogB and grvA were absent in all strains.
Most of the Salmonella enterica isolates (58/62) harbour no AMR genes. However, four isolates from raw beef carry at least one of the gene conferring resistance to beta-lactam (blaTEM-1), chloramphenicol (catA), fosfomycin (fosA7), quinolone (qnrD1) and tetracycline (tet(A)) (S3 Table). The plasmid replicons identified in this study were IncFII(S) (n = 4), IncFII(SARC14) (n = 2), IncFII (n = 1), IncFIB(AP001918) (n = 1), IncI2(Delta) (n = 1), Col3M (n = 1) and IncI1-I(Gamma) (n = 1). The plasmid replicons were spread across eight isolates (6 raw beef and 2 blood of slaughtered cattle isolates). Four of the ST2609 serovar Poona isolates harbour one of either IncFII(S) or IncFII(SARC14) while one raw beef isolate (GH-CKS-124B_S12) harbour three plasmid replicons (IncFII(SARC14), IncFII and IncI2(Delta)) (S3 Table).
Discussion
In this study, we recovered Salmonella enterica isolates from beef, cattle blood and, to a lesser extent, from human stools. We employed a robust pre-enrichment (with peptone), enrichment (on MSRV agar) and selection (on XLD agar) protocol however it is possible that the use of multiple enrichment media, e.g., selenite might have recovered other Salmonellae. In spite of this limitation, 31 (25%) of beef samples yielded a Salmonella isolate and considerable diversity was seen – at least 15 STs and 18 different Salmonella serovars recovered from cattle blood, raw beef and human stool from this study. Most of these serovars and STs have not been previously documented in Ghana, highlighting the need for more precise surveillance through whole genome sequencing, which contributes to our understanding of Salmonella serovar diversity in Ghana and underscores the importance of continued monitoring to inform targeted public health interventions.
A few serovars that are globally disseminated and highly prevalent worldwide were detected in this study, including Montevideo, Muenster and Poona but most of the serovarieties detected in the present study were uncommon in the literature overall (e.g., S. Poano and Odozi) or outside African settings (e.g., S. Yoruba) [16,31–34]. Recovery of serovars like S. Give and S. Yoruba, adds to data that suggests that these are endemic in Africa. A number of STs belonging to these and more commonly reported serovars were novel. With the exception of antimicrobial-resistant S. Poona isolated from poultry meat [35] and humans [36], and S. Give isolated from milk and associated utensils [16], most of the Salmonella serovars identified in this study have not yet been reported in Ghana. S. Gaminara has been associated with citrus and other fruits [37–40] and water [41,42] whereas in this study, one human stool and raw beef isolate was identified as S. Gaminara. Isolation of S. Montevideo has also been reported in buffalo meat in Egypt [43], in both cattle and human in the US [44], in non-diarrhoeic dogs in Grenada, West Indies [45] and in dairy farms in Uruguay [46]. Similarly, in this study S. Montevideo was present in human stool, raw beef and blood of slaughter cattle. Interestingly, with the exception of S. Give serovars of 14 isolates recently reported from food-preparation sources in Northern Ghana (Fresno, Give, Orleans, Infantis, Agona and Plymouth) [16] were not seen in this study. S. Give again, was the only one of the 14 serovars from this or the Sunmonu et al study that was recently reported from the poultry food chain in Nigeria [47]. Detection of uncommon serovars, the limited overlap in serovar type in different studies and the wide variety of serovars overall even with small sample sizes highlight a surveillance gap for foodborne Salmonella in Ghana and elsewhere in West Africa, and points to the need for further and larger epidemiological studies to identify serovars and lineages of regional significance. The identification of these serovars in various sources further underscores the importance of understanding reservoirs and transmission pathways within Ghana.
Some of the serovars identified in this study have been previously implicated in human infections. S. Montevideo has been associated with bacteraemia [48] and linked to foodborne illness outbreaks involving contaminated vegetables and spices [49]. Similarly, S. Poona has been reported to cause bacteraemia [50] and has been involved in foodborne outbreaks from cucumbers [51]. S. Give has been connected to an outbreak of gastroenteritis in Germany, which involved 115 cases linked to the consumption of raw minced pork [52]. Additionally, S. Give has been reported to cause brain abscess and bacteraemia in India [53]. In the US, multistate outbreak of S. Chester infections was associated with frozen meals, affecting 44 people [54]. S. Muenster has been isolated from human blood and livestock in the same household in Burkina Faso [55] and it has also been found in humans with clinical diarrhoea in Egypt [56]. S. Bredeney has been implicated in cases of bacteraemia in Cyprus [57]. The presence of these serovars in cattle meat and blood in Ghana, further highlights their potential to cause human infections.
A very concerning finding in this study is that Salmonella belonging to serovars Gaminara and Montevideo were recovered from three of 80 human stool specimens and that all three isolates were closely related to bovine isolates. S. Montevideo isolates were also the most common serovar of slaughter cattle blood isolates. The data in this suggest possible interchange of Salmonella between humans and livestock/meat but the limited number of human isolates (n = 3) restricts conclusions about transmission between livestock/meat and humans.
The IncFII(S) plasmid replicon was detected more commonly than any other in Salmonella genomes from this study. Plasmids with this replicon have been reported beta-lactam [58–61], tetracycline [58,61] and aminoglycoside [58] resistance, as well as virulence [58,59] in Salmonella. Other plasmid replicons detected in this study such as: IncFII(SARC14) [62], IncFII [61,63], IncFIB(AP001918) [61], IncI2(Delta), Col3M [64] and IncI1-I(Gamma) [65] have been reported to carry AMR genes in Salmonella. However, in this study none of the isolates carrying IncFII(S) and IncFII(SARC14) replicons harbour any resistance genes. This may reflect a lack of selective pressure in Ghana’s beef production sector. However, the presence of replicons associated with resistance means that platforms are in place for rapid evolution to resistance. The S. Bredeney ST306 isolate harbouring the plasmid-mediated quinolone resistance gene qnrD1 carries Col3M and IncI1-I(Gamma) plasmid replicons and one of the S. Poona ST308 isolates (GH-CKS-124B_S12) carrying IncFII, IncFIB(AP001918) and IncI2(Delta) also harbours tetracycline (tet(A)) and beta-lactamase (blaTEM-1) resistance genes. IncI2 plasmids are commonly reported from E. coli, where they carry multiple AMR genes [66], but rarely present in Salmonella and when detected, do not usually harbour any resistance determinants [46,67]. In this study, we found an IncI2 replicons in a Salmonella Poona isolate that carried resistance genes but also two other replicons. As long-read sequencing was not conducted in this study, it is not possible to fully understand the nature of the genetic elements carried by this and other strains as well as to decipher which resistance genes are on which replicon.
Not all recent studies conducted along the beef food chain in Ghana have recovered Salmonella [68], but most have [13,15,16,69,70] and therefore preventive actions need to be stepped up. These should include improved hygiene and sanitation practices, strengthened surveillance and monitoring systems, stricter food safety standards and regulations, vaccination and treatment programs for cattle, and public health awareness campaigns.
Conclusion
This study has identified a range of Salmonella serovars in slaughter cattle and beef in Ghana. The serovarieties and virulence gene repertoires of the recovered strains suggest pathogenic potential and recovery of strains belonging to two lineages identified from humans visiting health centres in the region further gives cause for concern. While antimicrobial resistance was not common in this study, resistance genes and mobile elements capable of carrying resistance genes were identified in many of the isolates, emphasizing the need to avoid transmission of Salmonella across One Health boundaries in Ghana. As a first step to effectively combat the spread of Salmonella, it is essential to foster collaboration among various stakeholders in the One Health framework to boost surveillance, including public health officials, veterinarians, food safety experts, and environmental scientists, thus creating a comprehensive and integrated approach to AMR surveillance, and then control.
Supporting information
S1 Fig. Reference-based phylogeny of Salmonella serovars with at least five genomes.
https://doi.org/10.1371/journal.pone.0325048.s001
(DOCX)
S3 Table. Isolates’ metadata including plasmid replicon, AMR and virulence profile.
https://doi.org/10.1371/journal.pone.0325048.s004
(CSV)
Acknowledgments
We thank Ayorinde Afolayan, Faith I. Oni, and Abeeb Adeniyi for technical assistance and Jola-Ade Ajiboye, Kesiena Akpede and Pernille Nilsson for logistic support and other members of the SEQAFRICA (Phase I) consortium, particularly Rene S. Hendriksen.
References
- 1. Andino A, Hanning I. Salmonella enterica: survival, colonization, and virulence differences among serovars. ScientificWorldJournal. 2015;2015:520179.
- 2. Teklemariam AD, Al-Hindi RR, Albiheyri RS, Alharbi MG, Alghamdi MA, Filimban AAR, et al. Human salmonellosis: a continuous global threat in the farm-to-fork food safety continuum. Foods. 2023;12(9).
- 3. Ruby T, McLaughlin L, Gopinath S, Monack D. Salmonella’s long-term relationship with its host. FEMS Microbiol Rev. 2012;36(3):600–15. pmid:22335190
- 4. Tanner JR, Kingsley RA. Evolution of Salmonella within hosts. Trends Microbiol. 2018;26(12):986–98. pmid:29954653
- 5. Hajra D, Nair AV, Chakravortty D. Decoding the invasive nature of a tropical pathogen of concern: the invasive non-Typhoidal Salmonella strains causing host-restricted extraintestinal infections worldwide. Microbiol Res. 2023;277:127488. pmid:37716125
- 6. Ehuwa O, Jaiswal AK, Jaiswal S. Salmonella, food safety and food handling practices. Foods. 2021;10(5).
- 7. Ferrari RG, Rosario DKA, Cunha-Neto A, Mano SB, Figueiredo EES, Conte-Junior CA. Worldwide epidemiology of salmonella serovars in animal-based foods: a meta-analysis. Appl Environ Microbiol. 2019;85(14):e00591-19. pmid:31053586
- 8. European Food Safety A, European Centre for Disease P C. The European union one health 2020 zoonoses report. EFSA J. 2021;19(12):e06971.
- 9. Marks F, von Kalckreuth V, Aaby P, Adu-Sarkodie Y, El Tayeb MA, Ali M, et al. Incidence of invasive salmonella disease in sub-Saharan Africa: a multicentre population-based surveillance study. Lancet Glob Health. 2017;5(3):e310–23. pmid:28193398
- 10. Feasey NA, Dougan G, Kingsley RA, Heyderman RS, Gordon MA. Invasive non-typhoidal salmonella disease: an emerging and neglected tropical disease in Africa. Lancet. 2012;379(9835):2489–99. pmid:22587967
- 11.
Schneidman M, Dacombe RJ, Carter J. Laboratory professionals in Africa: the backbone of quality diagnostics. Washington, DC: World Bank; 2014.
- 12. Kennedy B, Shobo CO, Zishiri OT, Bester LA. Surveillance of Salmonella spp. in the environment of public hospitals in KwaZulu-Natal, South Africa. J Hosp Infect. 2020;105(2):205–12. pmid:32114055
- 13. Tay MYF, Adzitey F, Sultan SA, Tati JM, Seow KLG, Schlundt J. Whole-genome sequencing of nontyphoidal salmonella enterica isolates obtained from various meat types in Ghana. Microbiol Resour Announc. 2019;8(15).
- 14. Archer EW, Chisnall T, Tano-Debrah K, Card RM, Duodu S, Kunadu AP-H. Prevalence and genomic characterization of Salmonella isolates from commercial chicken eggs retailed in traditional markets in Ghana. Front Microbiol. 2023;14:1283835. pmid:38029182
- 15. Adzitey F, Teye GA, Amoako DG. Prevalence, phylogenomic insights, and phenotypic characterization of Salmonella enterica isolated from meats in the Tamale metropolis of Ghana. Food Sci Nutr. 2020;8(7):3647–55. pmid:32724627
- 16. Sunmonu GT, Adzitey F, Odih EE, Tibile BA, Ekli R, Aduah M, et al. Genomic characterization of foodborne Salmonella enterica and Escherichia coli isolates from Saboba district and Bolgatanga Municipality Ghana. PLoS One. 2025;20(2):e0315583.
- 17. Rahn K, De Grandis SA, Clarke RC, McEwen SA, Galán JE, Ginocchio C, et al. Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol Cell Probes. 1992;6(4):271–9. pmid:1528198
- 18. Jibril AH, Okeke IN, Dalsgaard A, Kudirkiene E, Akinlabi OC, Bello MB, et al. Prevalence and risk factors of Salmonella in commercial poultry farms in Nigeria. PLoS One. 2020;15(9):e0238190. pmid:32966297
- 19. Prjibelski A, Antipov D, Meleshko D, Lapidus A, Korobeynikov A. Using SPAdes De Novo assembler. Curr Protoc Bioinformatics. 2020;70(1):e102. pmid:32559359
- 20. Zhou Z, Alikhan N-F, Mohamed K, Fan Y, Agama Study Group, Achtman M. The EnteroBase user’s guide, with case studies on Salmonella transmissions, Yersinia pestis phylogeny, and Escherichia core genomic diversity. Genome Res. 2020;30(1):138–52. pmid:31809257
- 21. Yoshida CE, Kruczkiewicz P, Laing CR, Lingohr EJ, Gannon VPJ, Nash JHE, et al. The Salmonella In Silico Typing Resource (SISTR): an open web-accessible tool for rapidly typing and subtyping draft Salmonella genome assemblies. PLoS One. 2016;11(1):e0147101. pmid:26800248
- 22. Carattoli A, Zankari E, García-Fernández A, Voldby Larsen M, Lund O, Villa L, et al. In silico detection and typing of plasmids using PlasmidFinder and plasmid multilocus sequence typing. Antimicrob Agents Chemother. 2014;58(7):3895–903. pmid:24777092
- 23. Feldgarden M, Brover V, Gonzalez-Escalona N, Frye JG, Haendiges J, Haft DH, et al. AMRFinderPlus and the reference gene catalog facilitate examination of the genomic links among antimicrobial resistance, stress response, and virulence. Sci Rep. 2021;11(1):12728. pmid:34135355
- 24. Hunt M, Mather AE, Sánchez-Busó L, Page AJ, Parkhill J, Keane JA, et al. ARIBA: rapid antimicrobial resistance genotyping directly from sequencing reads. Microb Genom. 2017;3(10):e000131. pmid:29177089
- 25. Seemann T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. 2014;30(14):2068–9. pmid:24642063
- 26. Tonkin-Hill G, MacAlasdair N, Ruis C, Weimann A, Horesh G, Lees JA, et al. Producing polished prokaryotic pangenomes with the Panaroo pipeline. Genome Biol. 2020;21(1):180. pmid:32698896
- 27. Kozlov AM, Darriba D, Flouri T, Morel B, Stamatakis A. RAxML-NG: a fast, scalable and user-friendly tool for maximum likelihood phylogenetic inference. Bioinformatics. 2019;35(21):4453–5. pmid:31070718
- 28. Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009;25(14):1754–60. pmid:19451168
- 29. Danecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO. Twelve years of SAMtools and BCFtools. Gigascience. 2021;10(2).
- 30. Nguyen L-T, Schmidt HA, von Haeseler A, Minh BQ. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol Biol Evol. 2015;32(1):268–74. pmid:25371430
- 31. Darboe S, Bradbury RS, Phelan J, Kanteh A, Muhammad A-K, Worwui A, et al. Genomic diversity and antimicrobial resistance among non-typhoidal Salmonella associated with human disease in the Gambia. Microb Genom. 2022;8(3):000785. pmid:35302932
- 32. Jibril AH, Okeke IN, Dalsgaard A, Menéndez VG, Olsen JE. Genomic analysis of antimicrobial resistance and resistance plasmids in Salmonella serovars from poultry in Nigeria. Antibiotics (Basel). 2021;10(2):99. pmid:33498344
- 33. Ramtahal MA, Amoako DG, Ismail A, Bester L, Abia ALK, Essack SY. Salmonella Yoruba: a rare serotype revealed through genomic sequencing along the farm-to-fork continuum of an intensive poultry farm in KwaZulu-Natal, South Africa. Acta Trop. 2022;234:106620. pmid:35907503
- 34. Worley J, Meng J, Allard MW, Brown EW, Timme RE. Salmonella enterica phylogeny based on whole-genome sequencing reveals two new clades and novel patterns of horizontally acquired genetic elements. mBio. 2018;9(6).
- 35. Dekker D, Eibach D, Boahen KG, Akenten CW, Pfeifer Y, Zautner AE, et al. Fluoroquinolone-resistant Salmonella enterica, Campylobacter spp., and Arcobacter butzleri from local and imported poultry meat in Kumasi, Ghana. Foodborne Pathog Dis. 2019;16(5):352–8. pmid:30907631
- 36. Kudirkiene E, Andoh LA, Ahmed S, Herrero-Fresno A, Dalsgaard A, Obiri-Danso K, et al. The Use of a combined bioinformatics approach to locate antibiotic resistance genes on plasmids from whole genome sequences of Salmonella enterica serovars from humans in Ghana. Front Microbiol. 2018;9:1010. pmid:29867897
- 37. Cook KA, Dobbs TE, Hlady WG, Wells JG, Barrett TJ, Puhr ND, et al. Outbreak of Salmonella serotype Hartford infections associated with unpasteurized orange juice. JAMA. 1998;280(17):1504–9. pmid:9809731
- 38. Parish ME. Coliforms, Escherichia coli and Salmonella serovars associated with a citrus-processing facility implicated in a salmonellosis outbreak. J Food Prot. 1998;61(3):280–4. pmid:9708296
- 39. Yuk HG, Schneider KR. Adaptation of Salmonella spp. in juice stored under refrigerated and room temperature enhances acid resistance to simulated gastric fluid. Food Microbiol. 2006;23(7):694–700. pmid:16943071
- 40. Hassan R, Whitney B, Williams DL, Holloman K, Grady D, Thomas D, et al. Multistate outbreaks of Salmonella infections linked to imported Maradol papayas - United States, December 2016-September 2017. Epidemiol Infect. 2019;147:e265. pmid:31502532
- 41. Patchanee P, Molla B, White N, Line DE, Gebreyes WA. Tracking salmonella contamination in various watersheds and phenotypic and genotypic diversity. Foodborne Pathog Dis. 2010;7(9):1113–20. pmid:20528467
- 42. McEgan R, Chandler JC, Goodridge LD, Danyluk MD. Diversity of Salmonella isolates from central Florida surface waters. Appl Environ Microbiol. 2014;80(21):6819–27. pmid:25172861
- 43. Abd-Elghany SM, Fathy TM, Zakaria AI, Imre K, Morar A, Herman V. Prevalence of multidrug-resistant Salmonella enterica serovars in Buffalo meat in Egypt. Foods. 2022;11(18).
- 44. Afema JA, Mather AE, Sischo WM. Antimicrobial resistance profiles and diversity in Salmonella from humans and cattle, 2004-2011. Zoonoses Public Health. 2015;62(7):506–17.
- 45. Amadi VA, Hariharan H, Arya G, Matthew-Belmar V, Nicholas-Thomas R, Pinckney R, et al. Serovars and antimicrobial resistance of non-typhoidal Salmonella isolated from non-diarrhoeic dogs in Grenada, West Indies. Vet Med Sci. 2017;4(1):26–34. pmid:29468078
- 46. Casaux ML, D’Alessandro B, Vignoli R, Fraga M. Phenotypic and genotypic survey of antibiotic resistance in Salmonella enterica isolates from dairy farms in Uruguay. Front Vet Sci. 2023;10:1055432. pmid:36968467
- 47. Aworh MK, Nilsson P, Egyir B, Owusu FA, Hendriksen RS. Rare serovars of non-typhoidal Salmonella enterica isolated from humans, beef cattle and abattoir environments in Nigeria. PLoS One. 2024;19(1):e0296971. pmid:38252613
- 48. Kim JY, Park YJ, Lee SO, Song W, Jeong SH, Yoo YA, et al. Case report: Bacteremia due to Salmonella enterica serotype montevideo producing plasmid-mediated AmpC beta-lactamase (DHA-1). Ann Clin Lab Sci. 2004;34(2):214–7.
- 49. Nguyen SV, Harhay DM, Bono JL, Smith TPL, Fields PI, Dinsmore BA, et al. Comparative genomics of Salmonella enterica serovar montevideo reveals lineage-specific gene differences that may influence ecological niche association. Microb Genom. 2018;4(8):e000202. pmid:30052174
- 50. Fukushima K, Yanagisawa N, Sekiya N, Izumiya H. Bacteremia caused by Salmonella poona in a healthy adult in Tokyo, Japan. Intern Med. 2020;59(2):289–92. pmid:31534082
- 51. Laughlin M, Bottichio L, Weiss J, Higa J, McDonald E, Sowadsky R, et al. Multistate outbreak of Salmonella poona infections associated with imported cucumbers, 2015-2016. Epidemiol Infect. 2019;147:e270.
- 52. Jansen A, Frank C, Prager R, Oppermann H, Stark K. Nation-wide outbreak of Salmonella give in Germany, 2004. Z Gastroenterol. 2005;43(8):707–13.
- 53. Afreen S, Ray P, Muthuvel R, Agarwal A, Angrup A. Salmonella enterica serovar Give causing brain abscess and bacteremia: a case report. Indian J Med Microbiol. 2024;48:100526.
- 54. Centers for Disease Control and Prevention. Multistate outbreak of salmonella chester infections associated with frozen meals -- 18 states, 2010. MMWR Morb Mortal Wkly Rep. 2013;62(48):979–82.
- 55. Post AS, Diallo SN, Guiraud I, Lompo P, Tahita MC, Maltha J, et al. Supporting evidence for a human reservoir of invasive non-typhoidal Salmonella from household samples in Burkina Faso. PLoS Negl Trop Dis. 2019;13(10):e0007782. pmid:31609964
- 56. Osman KM, Marouf SH, Alatfeehy N. Antimicrobial resistance and virulence-associated genes of Salmonella enterica subsp. Enterica serotypes Muenster, Florian, Omuna, and Noya strains isolated from clinically diarrheic humans in Egypt. Microb Drug Resist. 2013;19(5):370–7. pmid:23621859
- 57. Grynik A, Shaukat S, Htut EEP, Karas JA. An unusual dual infection with Salmonella bredeney, including bacteraemia, and enterohaemorrhagic Escherichia coli O157 that posed a therapeutic dilemma. J Med Microbiol. 2012;61(Pt 10):1480–2. pmid:22820693
- 58. Kang H, Kim H, Kim H, Jeon JH, Kim S, Park Y, et al. Genetic characteristics of extended-spectrum beta-lactamase-producing Salmonella isolated from retail meats in South Korea. J Microbiol Biotechnol. 2024;34(5):1101–8. pmid:38563109
- 59. Fatima S, Ishaq Z, Irfan M, AlAsmari AF, Achakzai JK, Zaheer T, et al. Whole-genome sequencing of multidrug resistance Salmonella typhi clinical strains isolated from Balochistan, Pakistan. Front Public Health. 2023;11:1151805. pmid:37261234
- 60. Luk-In S, Chatsuwan T, Pulsrikarn C, Bangtrakulnonth A, Rirerm U, Kulwichit W. High prevalence of ceftriaxone resistance among invasive Salmonella enterica serotype Choleraesuis isolates in Thailand: the emergence and increase of CTX-M-55 in ciprofloxacin-resistant S. Choleraesuis isolates. Int J Med Microbiol. 2018;308(4):447–53.
- 61. Campioni F, Vilela FP, Cao G, Kastanis G, Dos Prazeres Rodrigues D, Costa RG. Whole genome sequencing analyses revealed that Salmonella enterica serovar Dublin strains from Brazil belonged to two predominant clades. Sci Rep. 2022;12(1):10555.
- 62. García-Soto S, Abdel-Glil MY, Tomaso H, Linde J, Methner U. Emergence of Multidrug-resistant Salmonella enterica subspecies enterica Serovar infantis of multilocus sequence type 2283 in German Broiler Farms. Front Microbiol. 2020;11:1741. pmid:32765483
- 63. Akinyemi KO, Fakorede CO, Linde J, Methner U, Wareth G, Tomaso H, et al. Whole genome sequencing of Salmonella enterica serovars isolated from humans, animals, and the environment in Lagos, Nigeria. BMC Microbiol. 2023;23(1):164. pmid:37312043
- 64. Krüger GI, Pardo-Esté C, Zepeda P, Olivares-Pacheco J, Galleguillos N, Suarez M, et al. Mobile genetic elements drive the multidrug resistance and spread of Salmonella serotypes along a poultry meat production line. Front Microbiol. 2023;14:1072793. pmid:37007466
- 65. Hurtado R, Barh D, Weimer BC, Viana MVC, Profeta R, Sousa TJ, et al. WGS-based lineage and antimicrobial resistance pattern of Salmonella typhimurium isolated during 2000-2017 in Peru. Antibiotics (Basel). 2022;11(9):1170. pmid:36139949
- 66. Zhang P, Essendoubi S, Keenliside J, Reuter T, Stanford K, King R. Genomic analysis of Shiga toxin-producing Escherichia coli O157:H7 from cattle and pork-production related environments. NPJ Sci Food. 2021;5(1):15.
- 67. Webb HE, Tagg KA, Kim JY, Miller EA, Johnson TJ, Peñil-Celis A, et al. Five complete salmonella enterica serotype reading genomes recovered from patients in the United States. Microbiol Resour Announc. 2022;11(7):e0038822. pmid:35727013
- 68. Asati DA, Abdulai PM, Boateng KS, Appau AAA, Ofori LA, Agyekum TP. Food safety knowledge and practices among raw meat handlers and the microbial content of raw meat sold at Kumasi abattoir butchery shops in Kumasi, Ghana. BMC Public Health. 2024;24(1):975. pmid:38584288
- 69. Adjei VY, Mensah GI, Parry-Hanson Kunadu A, Tano-Debrah K, Ayi I, Addo KK. Microbial safety of beef along beef value chains in the Ashaiman municipality of Ghana. Front Vet Sci. 2022;9:813422. pmid:35812857
- 70. Nkekesi B, Amenya P, Aboagye G, Kortei NK. Street-vended grilled beef sausages as potential vehicles of bacterial and fungal pathogens: an exploratory survey in Ho, the capital city of the Volta Region of Ghana. Food Sci Nutr. 2023;11(11):7013–25. pmid:37970393