https://orcid.org/0000-0002-4287-2857
Figures
Abstract
Cleft lip and cleft palate are among the most common congenital anomalies and are the result of incomplete fusion of embryonic craniofacial processes or palatal shelves, respectively. We know that genetics play a large role in these anomalies but the list of known causal genes is far from complete. As part of a larger sequencing effort of patients with congenital craniofacial anomalies, we identified a rare candidate variant in transforming growth factor beta receptor 2 (TGFBR2). This variant alters a highly conserved amino acid and is predicted to be pathogenic by a number of metrics. The family history and population genetics suggest that this specific variant would be incompletely penetrant, but this gene has been convincingly implicated in craniofacial development. In order to test the hypothesis this might be a causal variant, we used genome editing to create the orthologous variant in a new mouse model. Surprisingly, Tgfbr2V387M mice did not exhibit craniofacial anomalies or have reduced survival, suggesting Tgfbr2V387M is not a causal variant for cleft palate/ micrognathia. The discrepancy between in silico predictions and mouse phenotypes highlights the complexity of translating human genetic findings to mouse models. We expect these findings will aid in interpretation of future variants seen in TGFBR2 from ongoing sequencing of patients with congenital craniofacial anomalies.
Citation: Michaels J-R, Iyyanar PPR, Husami A, Vontell AM, Brugmann SA, Stottmann RW (2025) Genetic analysis and functional assessment of a TGFBR2 variant in micrognathia and cleft palate. PLoS One 20(6): e0324803. https://doi.org/10.1371/journal.pone.0324803
Editor: James J. Cray Jr, Ohio State University, UNITED STATES OF AMERICA
Received: November 12, 2024; Accepted: April 30, 2025; Published: June 9, 2025
Copyright: © 2025 Michaels et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the manuscript and its Supporting Information files.
Funding: Funding for this project was received from the National Institute of Dental and Craniofacial Research in the form of grants R01DE027091 to Rolf W. Stottmann and R35DE027557 to Samantha A. Brugmann.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Cleft lip/cleft palate are craniofacial congenital anomalies characterized by incomplete fusion of the lip and/or palate during embryonic development. These are the among the most common of all congenital anomalies with an incidence of approximately 1/700 live births [1,2]. Causes of cleft lip and cleft palate are quite diverse with known contributions from genetics and environmental influences (teratogens) as well as the interplay between each [3,4]. Genetic studies of orofacial clefting disorders in humans have identified a handful of genes known to have high association with variable forms of cleft lip/ palate such as IRF6 [5], FOXE1 [6], and TP63 [7]. These studies to date have been plagued with incomplete penetrance complicating a complete understanding of cleft lip/palate genetics [8,9]. We have been sequencing families with syndromic cleft lip/palate but no known genetic diagnosis to continue to build our knowledge of genetic variants leading to these conditions and potentially design future treatments.
Transforming Growth Factor beta (TGF-β) signaling is a classic developmental signaling pathway with extracellular ligands binding to complexes of transmembrane receptor tyrosine kinases. Ligand binding facilitates phosphorylation of type II receptors which then phosphorylates intracellular SMAD proteins such as SMAD2 to ultimately traffic to the nucleus and direct transcription of direct targets [10–13]. TGF-β signaling mediates several key functions during embryonic development including cell proliferation, differentiation, and extracellular matrix formation [14]. TGF superfamily signaling has strongly been associated with craniofacial development [15,16]. While the transforming growth factor beta receptor 2 (Tgfbr2) null mouse embryos die by E10.5 [17], the role of Tgfbr2 in craniofacial development became clear with studies using conditional inactivation in the cranial neural crest cells using the Wnt1-Cre driver. This ablation of Tgfbr2 results in cleft palate due to reduced cell proliferation in the palatal mesenchyme at E14.5 [15,18–22]. In addition, these neural crest specific Tgfbr2 mutants exhibited smaller mandibles with reduced condylar and coronoid processes and a complete lack of the angular process of the mandible in the proximal region [18,23]. Herein, we utilized the power of mouse genetics and precision genome editing to directly test if a candidate human variant in TGFBR2 was a new causal variant for isolated micrognathia and cleft palate.
Results
A potentially pathogenic TGFBR2 variant involved in craniofacial anomalies
We performed whole genome sequencing as part of a larger project on the human genetics of cleft lip/palate phenotypes. One recruited family had two affected children with cleft palate and micrognathia from unaffected parents with a previous maternal family history of cleft palate. No other significant phenotypes were noted in the affected children. Standard genome sequence variant analysis for rare variants in the affected children identified a candidate variant in transforming growth factor beta receptor 2 (TGFBR2, NCBI Gene ID: 7048) which was present in both affected children and the unaffected mother. This variant (NM_003242.5:c.1159G > A; Chr3(GRCh37):g.30713824G > A; p.Val387Met) changes the amino acid at position 387 from a valine to a methionine. This variant has been noted previously (rs35766612) and is present at extremely low levels in control population databases with an overall allele frequency of 0.0017 and 4 homozygotes in gnomAD v4 [24], a virtually identical allele frequency of 0.0017 in the Regeneron million exome collection, and a combined annotation dependent depletion (CADD: [25] score of 24.4). The nucleotide sequence in this region of the genome is moderately conserved across phylogeny, but the amino acid code is faithfully conserved except for the D. melanogaster genome (Fig 1a). The change from valine to methionine only has a small physicochemical distance with a Grantham score of 21 (0–215) but is in the protein kinase domain which is critical for TGFBR2 function [26]. The variant is predicted to be “deleterious” by SIFT [27] (score = 0), “disease causing” by MutationTaster [28] (prob = 1), “probably damaging” by PolyPhen-2 [29] (score = 0.996), and “intolerant” by MetaDome [30] (score = 0.27). Previous reports in ClinVar [31] have conflicting interpretations of pathogenicity but were evaluated in different pathological contexts such as Marfan syndrome, Loeys-Dietz syndrome and aortic disease. We therefore hypothesized that this variant may be a cause of incompletely penetrant cleft palate and micrognathia in humans.
(a) TGFBR2 protein domain structure. Amino acid V387 is in an area of highly conserved sequence in the kinase domain.
A novel mouse model of Tgfbr2V387M
Given the known role for Tgfbr2 in craniofacial development and the incomplete penetrance of many craniofacial genetic variants in human, we created a mouse model to test the pathogenicity of this missense variant. This portion of the TGFBR2 protein is highly conserved between human (Fig 2a) and mouse (Fig 2b). CRISPR-CAS9 genome editing was used in one cell mouse embryos with injection of a mixture containing Cas9-gRNA and both variant knock-in and silent wild-type donors. Multiple founders were identified with the desired knock-in with Sanger sequencing and were bred to wild-type females. Animals from this outcross and their progeny were used in the analysis reported here. We designate this allele as Tgfbr2em1Rstot but refer to it hereafter as Tgfbr2V387M. Genotyping was performed with a combination of Sanger sequencing (mutant allele shown in Fig 2c) and PCR followed by restriction digest as a variant in the donor oligonucleotide created a BspH1 recognition site (Fig 2d).
The amino acid and DNA sequence of Tgfbr2 shows high conservation between human (a) and mouse (b). (c) Sanger sequence of mice showing desired sequence change from G to A indicated by the red box in mutants. (d) PCR genotyping followed by restriction digest indicating ability to clearly differentiate wild-type, heterozygous, and homozygous mutant mice. (e) Survival of all mice are not significantly different than Mendelian expectations.
Tgfbr2V387M variant does not cause any craniofacial phenotypes
We first analyzed survival of Tgfbr2V387M/wt heterozygotes from crosses with wild-type animals and saw no reduced recovery of heterozygotes (n = 20 from 32 total animals; Chi-squared p-value = 0.157; Fig 2e, Table 1). To test if homozygotes have a phenotype, we intercrossed heterozygotes and saw no deviation from expected ratios of Tgfbr2V387M/wt heterozygotes or Tgfbr2V387M/V387M homozygotes from 66 weaned animals (Chi-squared p-value = 0.716; Fig 2e, Table 1). Cleft palate was not observed in any animals during the course of this study. Given that cleft palate is perinatal lethal in mouse models, we interpret these findings to suggest that cleft palate was very rarely, if ever, present in animals carrying this predicted pathogenic variant. One mechanism commonly resulting in cleft palate is obstruction of palatal shelf elevation and/or closure due to the posterior displacement of the tongue in micrognathia [32]. While this was not severe enough to cause cleft palate in these animals, if present at all, we tested if mutants may have micrognathia as suggested by the human participants. We performed skeletal preparations of animals born from Tgfbr2V387M/wt heterozygous intercrosses to highlight cartilage and bone and measured the length of the mandible as well as the total head length (Fig 3a and 3b). Analysis did not show any reduction between genotypes in mandible length as an isolated measurement, or relative to skull length, at postnatal day (P)120 (Fig 3g–3k, n = 24). We also examined the roof of the mouth for any subtle deficits such as abnormal rugae or high arched palate, and noted no abnormalities (Fig 3c and 3d). We additionally performed histological analysis of a number of Tgfbr2V387M/V387M homozygous mutants at E18.5 and P0 and did not observe craniofacial phenotypes in these animals either (Fig 3e and 3f). Finally, to assess if any subtle craniofacial abnormalities are present, we measured the skull length, skull width, and snout length in P120 head skeletal preparations. None of the aforementioned measurements in Tgfbr2V387M/wt heterozygous or Tgfbr2V387M/V387M homozygous heads were significantly different from wild-type heads (Fig 3h–3k). Thus, we conclude that the Tgfbr2V387M missense variant did not lead to any craniofacial phenotypes in mouse.
(a-D) Skeletal preparations of animals at postnatal day (P) 60 from the lateral view (a,b) or focused on the palatal surface (c,d) do not appear any different between wild-type (a,c) and Tgfbr2 V387M/V387M homozygous mutants (b,d). (e,f) Histological analysis of wild-types (e) and mutants (f) at E18.5 also did not reveal any differences. Quantification of mandible length (g), skull length (h), skull width (i), ratio of mandible length to skull (j) or snout length (k) showed no difference between genotypes. Scale bars in a-f indicate 1 mm. Statistical values shown are from a one-way ANOVA.
Tgfbr2V387M variant does not lead to alterations in Smad phosphorylation levels.
Binding of TGFβ ligands to TGFβR2 leads to heterodimerization with TGFβR1, which in turn phosphorylates the receptor associated SMAD2, which is the predominant SMAD downstream of TGFβ signaling during craniofacial development [14,33]. We therefore investigated the phosphorylated levels of SMAD2 (p-SMAD2) in the mandibles of Tgfbr2V387M/wt heterozygous or Tgfbr2V387M/V387M homozygous animals compared to wildtype at E13.5 (Fig 4). Our analysis did not reveal any significant difference in ratio of p-SMAD2 levels to total SMAD-2 level in either class of mutant. These data together show that the Tgfbr2V387M mutation did not alter the level of TGFβR2-dependent phosphorylation of target proteins, further consistent with our hypothesis that the variant is not pathogenic.
Western blot analysis with antibodies for phosphorylated SMAD2 (p-SMAD2), and SMAD2 antibodies. Quantification shows the ratio of pSMAD2 to total SMAD2 is not significantly different among genotypes. Statistical values shown are from one-way ANOVA.
Discussion
Here we present a novel missense variant mouse allele of Tgfbr2 created to assess the hypothesis the variant is causing disrupted craniofacial development with cleft palate due to micrognathia (as part of a presentation of Pierre Robin Sequence). While this variant was predicted to be deleterious by multiple algorithms, our findings in the mouse do not support a biological role for this variant as we do not observe reduced survival of Tgfbr2V387M/wt heterozygous or Tgfbr2V387M/V387M homozygous animals and do not find any phenotypes reminiscent of human participants. Furthermore, we do not see molecular evidence of disrupted TGFβ signaling. We conclude this is not likely to be a causal variant in human genetics but recognize this might be a failure of the mouse model to accurately recapitulate human biology.
TGFBR2 has known roles in human biology
Heterozygous missense variants in TGFBR2 are well established to cause Loeys-Dietz Syndrome [34,35]. While cleft palate can be seen in some of these patients (two of the first six TGFBR2 participants reported), the more common clinical characteristics include arterial aneurysm/dissection, skeletal phenotypes such as scoliosis or joint laxity, and craniosynostosis. The patients reported here were not known to have any clinical characteristics of Loeys-Dietz Syndrome and this particular variant we find has been most often classified as (likely) benign when analyzed in this context by clinical geneticists.
Tgfbr2 in craniofacial biology
TGFβ signaling plays multiple critical roles in cell proliferation, apoptosis, differentiation, and epithelial mesenchymal transition during embryonic development [14]. The binding of ligands (TGFβ1, TGFβ2 or TGFβ3) to the TGFBR2 receptor initiates the heterodimeric binding of TGFBR1. This heterodimerization leads to the phosphorylation of TGFBR1, which results in the phosphorylation of receptor associated SMADs such as SMAD2 and/or SMAD3 depending on the context [14,15]. Among the mouse orthologues of TGFβ ligands, null mutants of Tgfβ2 [36]and Tgfβ3 [37,38] develop cleft palate with a penetrance of 23% and 100%, respectively. Tgfβ3 is exclusively expressed in the palatal epithelia including the medial edge epithelia and midline epithelial seam during palatal fusion and is critical for p-SMAD2 activation, but not p-SMAD3 [39]. Smad2 is critical for embryonic development as Smad2-/- embryos die by E8.5, while Smad3-/- mice survive postnatally [33,40]. Interestingly, some of the Smad2 heterozygous mice develop severe mandibular hypoplasia with proboscis-like phenotype [33].
Since Tgfbr2 homozygous null embryos die by E10.5 [17], a Wnt1-Cre mediated deletion was employed to gain additional information regarding the role of Tgfbr2 in craniofacial development [18]. Wnt1-Cre;Tgfbr2flox/flox mutants have a completely penetrant complete failure of fusion in the secondary palate, likely due to reduced proliferation of the neural crest cells as they facilitate horizontal growth of the palatal shelves during mid-gestation (E14.5) [15,18–22]. This neural crest specific ablation of Tgfbr2 results in an increase in the mRNA expression of Tgfβ2 and Tgfbr3. In these mutants, upregulated TGFβ2 binds and signals through TGFBR3 to activate non-canonical TGFβ signaling via p38 MAPK signaling resulting in defective cell proliferation [19]. Interestingly, the cleft palate phenotype of Tgfbr2 mutants is rescued by the haploinsufficiency of Tgfβ2 (82.5%) or Tgfbr1 (91.7%) [19]. These findings further highlight the intricacy of the unique roles played by individual TGFβ ligands and receptors during normal development and in the pathogenesis of craniofacial malformations. Our data on the Tgfbr2V387M mutation revealed that levels of p-SMAD2, a critical downstream regulator of the TGFβ signaling, was not affected in these mutants, implying that the mutation does not affect receptor-dependent downstream signaling. This is understandable given the lack of craniofacial phenotype in these mutants. In addition, neural crest-specific inactivation of Tgfbr2 resulted in a hypoplastic mandible with severe defects in the proximal region [18,23]. This conditional ablation of Tgfbr2 also leads to skull defects which are also seen in Loeys-Dietz Syndrome patients. Neither the mouse model we report here, nor the sequenced family, show any evidence for craniosynostosis or defects of the calvaria.
Mouse as a model for human congenital craniofacial anomalies.
Genetic similarities, experimental tools and overall conserved processes of development and disease between mouse and humans have supported the rise of the mouse as the most powerful mammalian model of human development and disease. The power in this approach has only grown with the advent of CRISPR-CAS9 mediated genome editing and the ability to manipulate the genome to model specific variants seen in human patients. Thus, we took this approach with the aim of assessing pathogenicity of a specific variant identified through whole genome sequencing. In addition to addressing specific hypotheses about genetic causes of human disease, these mouse models can facilitate experiments to determine underlying molecular mechanism(s) and potentially test proof of concept experiments for therapeutic interventions.
One alternative explanation for our data is that the Tgfbr2V387M variant is a risk factor for cleft lip/palate in humans, but this is not recapitulated in the mouse due to subtle differences in the two models. While the processes of craniofacial development broadly, and palatogenesis specifically, are quite similar, between mice and humans, there are some developmental differences [41,42]. In general, however, there is concordance between the mouse and human model. A recent review compiled a list of mouse models with cleft palate and human disorders associated with those genes [43]. In this comparison, 15 human diseases with cleft palate as a phenotypic feature had a corresponding mouse models cataloged and all were noted to have cleft palate, including the Tgfb2 ligand itself [36]. Another review found a similarly very high concordance [41]. Even in the biochemical pathway we are considering here, we have mentioned multiple mutants of the TGFβ signaling cascade which have cleft palate in mouse mutants [18,36].
Another variable to consider is genetic background. We conducted our experiments with mice on a C57BL/6J background. Mouse strains are known to have different sensitivities to clefting, including environmental influences [44], but the C57BL/6J mouse has not been previously shown to be particularly refractory to craniofacial differences. Indeed, the previously described conditional ablation of Tgfbr2 in the neural crest cell lineage (Wnt1-Cre; Tgfbr2floxl/flox) was also in the C57BL/6J background [18], further reiterating that the background may not be the attributing factor for the lack of cleft palate phenotype in our analysis. A classic mouse model of Treacher Collins Syndrome is also more acutely affected in C57BL/6J as compared to the DBA strain [45]. Thus, it is more likely that this Tgfbr2 variant is not a causal allele for cleft palate or micrognathia leading to palate disruption in mammals despite the deep conservation and in silico predicted pathogenicity. In this case, the population data was not consistent with a highly penetrant phenotype. These population frequency datasets are getting more powerful with the addition of new data and will therefore become increasingly valuable and predictive in future analyses. The ability to recapitulate human variants in a genetically tractable model like the mouse will continue to be an attractive experimental option in future studies of human disease genetics.
Methods
DNA sequencing
DNA was collected as part of an IRB-approved recruitment protocol and purified using the Qiagen DNeasy Kit and manufacturer’s protocols (Qiagen, USA). Whole genome sequencing was done at Novogene USA to an average depth of at least 30x with standard protocols.
Variant discovery
VCF format small SNP and InDels were annotated and filtered using standardized protocols using GoldenHelix VarSeq and Qiagen – Qiagen Clinical Interpreter – Translational (formerly Ingenuity) variant analysis software packages. The variant annotation and interpretation analyses were generated through the use of Ingenuity® Variant Analysis™ software https://wwusingtics.com/products/ingenuity-variant-analysis from QIAGEN, Inc. Variants were filtered based on population frequencies. Subsequently, variants known or predicted to have semantic similarity with Micrognathia, and cleft palate were discovered using Phenotype Driven Ranking (PDR) filter.
Mouse model creation
Mice (NCBI Taxon ID 10090) were created at the Cincinnati Children’s transgenic animal and genome editing core (RRID:SCR_022642). Mouse zygotes (C57BL/6N strain) were injected with 200 ng/μl CAS9 protein (IDT and ThermoFisher), 100 ng/μl Tgfbr2-specific sgRNA (AGGTCAAGTCGTTCTTCACT), 75 ng/μl single-stranded donor oligo- nucleotide (KI) to create the Tgfbr2 variant (AGAGCTGGGCAAGCAGTACTGGCTGATCACGGCGTTCCACGCGAAGGGCAACCTGCAGGAGTACCTCACGAGGCATGTCATCAGCTGGGAGGACCTGAGGAAGCTGGGCAGCTCCCTGGCCCGGGGATCGCTCATCTCCACAGTGACCACACTCCTTGTGGGAGGCC; IDT, Iowa) and 75 ng/μl single-stranded donor oligo- nucleotide of wild-type sequence (WT-S) with silent variants (TGTTGGCCAGGTCATCCACAGACAGAGTAGGGTCCAGGCGCAAGGACAGCCCGAAGTCACACAGGCAACAGGTCAAGTCGTTCTTCAcgAGaATGTTAGAGCTCTTGAGGTCCCTGTGAACAATGGGCATCTTG; IDT, Iowa) followed by surgical implantation into pseudo-pregnant female (CD-1 strain) mice. Both donors are used together to prevent possible lethality of homozygous target mutations. Silent mutations (indicated by the lowercase letters in Fig 2b) are also introduced in the knock-in donor to prevent recutting of the target allele by CRISPR and to create a restriction enzyme site to facilitate genotyping. PCR genotyping was performed by amplification of genomic DNA (F:CATCGCTCATCTCCACAGTGAC and R:TGAAGCCAGGCATGAAGTCTGAG primers).
The PCR products were subject to digestion with BspH1 or Sanger Sequencing and pups exhibiting editing of interest were then crossed to wild-type (C57BL/6J) mice and the resulting progeny were Sanger sequenced (CCHMC DNA Sequencing and Genotyping Core) to confirm the alleles generated. Propagation of the Tgfbr2 allele was done by crossing to wild-type C57BL/6J mice and/or intercross. Further genotyping was with a combination of PCR followed by restriction digest and/or Sanger sequencing.
Animal housing
All experiments using mice in this study were performed using ethically acceptable procedures as approved by the Institutional Animal Care and Use Committee at Nationwide Children’s Hospital (AR21–00067). Mice were fed mouse breeder diet and housed in ventilated cages with a 12 h light/12 h dark cycle. Animals were euthanized with carbon dioxide asphyxiation consistent with standard practices. No anesthesia and/or analgesia methods were required and all efforts were made to alleviate animal suffering.
Skeletal preps and pictures
Skeletons from P60 or P120 animals were stained with Alcian Blue and Alizarin Red to visualize cartilage and bone, respectively. Briefly, animals were skinned, eviscerated and fixed for 2 days in 95% ethanol. They were stained overnight at room temperature in 0.03% (w/v) Alcian Blue solution (Sigma- Aldrich, A3157) containing 80% ethanol and 20% glacial acetic acid. Samples were destained in 95% ethanol for 24 h followed by pre-clearing in 1% KOH overnight at room temperature. Skeletons were then stained overnight in 0.005% Alizarin Red solution (Sigma-Aldrich, A5533) containing 1% KOH. A second round of clearing was performed by incubating tissues in 20% glycerol/1% KOH solution for 24 h. Finally, they were transferred to 50% glycerol/50% ethanol for photography. Skeletal preparations were imaged using a Zeiss Discovery.V12 Stereoscope and length measurements were recorded for mandibular bones and skull length (tip of nasal bone to basioccipital bone). For skull width, measurements were made between the bilateral zygomatic processes at the third molar level. For snout length, measurements were made between the premaxilla to the anterior end of the first molar tooth.
Histology
Hematoxylin & Eosin (H&E) fixation was in Bouin’s solution followed by washes in 70% ethanol. For H&E staining, embryos were embedded in paraffin and cut to 10 μm sections before staining using standard techniques (Behringer, 2014). All images were taken via Zeiss Discovery.V12 Stereoscope. Paired images are shown at the same magnification.
Western blot analysis
Western blot analysis was carried out as previously described [46]. Briefly, mandibles from E13.5 Tgfbr2V387M/wt heterozygous or Tgfbr2V387M/V387M homozygous, and wildtype littermates were micro-dissected and homogenized in RIPA buffer with protease and phosphatase inhibitors (Pierce). Proteins were quantified using BCA assay (Pierce) and 20 µg of protein was separated on a 4–20% mini-Protean TGX stain-free gels (Bio-Rad). Proteins were transferred to 0.45 µm PVDF membrane by Turbo blot transfer and imaged using stain free imaging (Bio-Rad). Blots were blocked with Everyblot blocking buffer (Bio-Rad) for 10 minutes. Primary antibodies were p-SMAD2 (1:1000; Cell Signaling) and SMAD2 (1:1000; Cell Signaling). Blots were washed in 1X TBST and probed with anti-rabbit IgG-HRP conjugate (Abcam; 1:3000) and developed using Clarity ECL substrate (Bio-Rad). Western blot images were quantified using the AlphaView Software. Band intensities of p-SMAD2 or SMAD2 for each lane were normalized to their respective total protein levels from stain free total protein gel images. The relative intensities of p-SMAD2 were normalized to their SMAD2 levels and analyzed ordinary one-way ANOVA with Tukey’s multiple comparison post-hoc test.
Statistics
All statistical analyses were performed using GraphPad Prism 9.5.1. Ordinary one-way ANOVA with Dunnett’s post-hoc multiple comparisons test was performed for comparison of mandible lengths. ANOVA P values are indicated on all graphs. The data shown are the median ± 95% confidence interval. No samples were excluded from analyses.
Acknowledgments
We appreciate comments on the manuscript from the Stottmann laboratory group. The Regeneron Genetics Center, and its collaborators (collectively, the “Collaborators”) bear no responsibility for the analyses or interpretations of the data presented here. Any opinions, insights, or conclusions presented herein are those of the authors and not of the Collaborators.
References
- 1. Mossey PA, Little J, Munger RG, Dixon MJ, Shaw WC. Cleft lip and palate. Lancet. 2009;374(9703):1773–85. pmid:19747722
- 2. Murray JC. Gene/environment causes of cleft lip and/or palate. Clin Genet. 2002;61(4):248–56. pmid:12030886
- 3. Beames TG, Lipinski RJ. Gene-environment interactions: aligning birth defects research with complex etiology. Development. 2020;147(21):dev191064. pmid:32680836
- 4. Dixon MJ, et al. Cleft lip and palate: understanding genetic and environmental influences. Nat Rev Genet. 2011;12(3):167–78.
- 5.
Schutte BC, et al. Irf6-related disorders. In: Adam MP, editor. GeneReviews. Seattle (WA): University of Washington; 1993.
- 6. Moreno L, et al. Foxe1 association with both isolated cleft lip with or without cleft palate and isolated cleft palate. Hum Mol Genet. 2009;18(24):4879–96.
- 7.
Sutton VR, van Bokhoven H. Tp63-related disorders. In: Adam MP, editor. GeneReviews. Seattle (WA); 1993.
- 8. Leslie EJ. Genetic models and approaches to study orofacial clefts. Oral Dis. 2022;28(5):1327–38. pmid:34923716
- 9. Reynolds K, Zhang S, Sun B, Garland MA, Ji Y, Zhou CJ. Genetics and signaling mechanisms of orofacial clefts. Birth Defects Res. 2020;112(19):1588–634. pmid:32666711
- 10. Massague J. TGFbeta signalling in context. Nat Rev Mol Cell Biol. 2012;13(10):616–30.
- 11. Ross S, Hill CS. How the Smads regulate transcription. Int J Biochem Cell Biol. 2008;40(3):383–408. pmid:18061509
- 12. Schmierer B, Hill CS. TGFbeta-SMAD signal transduction: molecular specificity and functional flexibility. Nat Rev Mol Cell Biol. 2007;8(12):970–82. pmid:18000526
- 13. Shi Y, Massagué J. Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell. 2003;113(6):685–700. pmid:12809600
- 14. Chai Y, Ito Y, Han J. Tgf-beta signaling and its functional significance in regulating the fate of cranial neural crest cells. Crit Rev Oral Biol Med. 2003;14(2):78–88.
- 15. Iwata J, Parada C, Chai Y. The mechanism of TGF-β signaling during palate development. Oral Dis. 2011;17(8):733–44. pmid:21395922
- 16. Ueharu H, Mishina Y. BMP signaling during craniofacial development: new insights into pathological mechanisms leading to craniofacial anomalies. Front Physiol. 2023;14:1170511. pmid:37275223
- 17. Oshima M, Oshima H, Taketo MM. TGF-beta receptor type II deficiency results in defects of yolk sac hematopoiesis and vasculogenesis. Dev Biol. 1996;179(1):297–302. pmid:8873772
- 18. Ito Y, Yeo JY, Chytil A, Han J, Bringas P Jr, Nakajima A, et al. Conditional inactivation of Tgfbr2 in cranial neural crest causes cleft palate and calvaria defects. Development. 2003;130(21):5269–80. pmid:12975342
- 19. Iwata J, Hacia JG, Suzuki A, Sanchez-Lara PA, Urata M, Chai Y. Modulation of noncanonical TGF-β signaling prevents cleft palate in Tgfbr2 mutant mice. J Clin Invest. 2012;122(3):873–85. pmid:22326956
- 20. Iwata J, Suzuki A, Pelikan RC, Ho T-V, Sanchez-Lara PA, Chai Y. Modulation of lipid metabolic defects rescues cleft palate in Tgfbr2 mutant mice. Hum Mol Genet. 2014;23(1):182–93. pmid:23975680
- 21. Iwata J, Suzuki A, Yokota T, Ho T-V, Pelikan R, Urata M, et al. TGFβ regulates epithelial-mesenchymal interactions through WNT signaling activity to control muscle development in the soft palate. Development. 2014;141(4):909–17. pmid:24496627
- 22. Iwata J. Fibroblast growth factor 9 (fgf9)-pituitary homeobox 2 (pitx2) pathway mediates transforming growth factor beta (tgfbeta) signaling to regulate cell proliferation in palatal mesenchyme during mouse palatogenesis. J Biol Chem. 2012;287(4):2353–63.
- 23. Oka K, Oka S, Sasaki T, Ito Y, Bringas P Jr, Nonaka K, et al. The role of TGF-beta signaling in regulating chondrogenesis and osteogenesis during mandibular development. Dev Biol. 2007;303(1):391–404. pmid:17204263
- 24. Chen S, Francioli LC, Goodrich JK, Collins RL, Kanai M, Wang Q, et al. A genomic mutational constraint map using variation in 76,156 human genomes. Nature. 2024;625(7993):92–100. pmid:38057664
- 25. Rentzsch P, Witten D, Cooper GM, Shendure J, Kircher M. CADD: predicting the deleteriousness of variants throughout the human genome. Nucleic Acids Res. 2019;47(D1):D886–94. pmid:30371827
- 26. Lin HY, Wang XF, Ng-Eaton E, Weinberg RA, Lodish HF. Expression cloning of the TGF-beta type II receptor, a functional transmembrane serine/threonine kinase. Cell. 1992;68(4):775–85. pmid:1310899
- 27. Ng PC, Henikoff S. SIFT: predicting amino acid changes that affect protein function. Nucleic Acids Res. 2003;31(13):3812–4. pmid:12824425
- 28. Schwarz JM, Cooper DN, Schuelke M, Seelow D. MutationTaster2: mutation prediction for the deep-sequencing age. Nat Methods. 2014;11(4):361–2. pmid:24681721
- 29.
Adzhubei I, Jordan DM, Sunyaev SR. Predicting functional effect of human missense mutations using PolyPhen-2. Curr Protoc Hum Genet. John Wiley & Sons, Inc. 2013. p. Unit7 20.
- 30. Wiel L, Baakman C, Gilissen D, Veltman JA, Vriend G, Gilissen C. MetaDome: pathogenicity analysis of genetic variants through aggregation of homologous human protein domains. Hum Mutat. 2019;40(8):1030–8. pmid:31116477
- 31. Landrum MJ, Lee JM, Riley GR, Jang W, Rubinstein WS, Church DM, et al. ClinVar: public archive of relationships among sequence variation and human phenotype. Nucleic Acids Res. 2014;42(Database issue):D980-5. pmid:24234437
- 32. Diewert VM. Craniofacial growth during human secondary palate formation and potential relevance of experimental cleft palate observations. J Craniofac Genet Dev Biol Suppl. 1986;2:267–76. pmid:3491117
- 33. Nomura M, Li E. Smad2 role in mesoderm formation, left-right patterning and craniofacial development. Nature. 1998;393(6687):786–90. pmid:9655392
- 34. Loeys B. A syndrome of altered cardiovascular, craniofacial, neurocognitive and skeletal development caused by mutations in TGFBR1 or TGFBR2. Nat Genet. 2005;37(3):275–81.
- 35.
Loeys BL, Dietz HC. Loeys-dietz syndrome. In: Adam MP editor. GeneReviews((R)). Seattle (WA); 1993
- 36. Sanford LP, Ormsby I, Gittenberger-de Groot AC, Sariola H, Friedman R, Boivin GP, et al. TGFbeta2 knockout mice have multiple developmental defects that are non-overlapping with other TGFbeta knockout phenotypes. Development. 1997;124(13):2659–70. pmid:9217007
- 37. Kaartinen V, Voncken JW, Shuler C, Warburton D, Bu D, Heisterkamp N, et al. Abnormal lung development and cleft palate in mice lacking TGF-beta 3 indicates defects of epithelial-mesenchymal interaction. Nat Genet. 1995;11(4):415–21. pmid:7493022
- 38. Proetzel G, Pawlowski SA, Wiles MV, Yin M, Boivin GP, Howles PN, et al. Transforming growth factor-beta 3 is required for secondary palate fusion. Nat Genet. 1995;11(4):409–14. pmid:7493021
- 39. Cui X-M, Chai Y, Chen J, Yamamoto T, Ito Y, Bringas P, et al. TGF-beta3-dependent SMAD2 phosphorylation and inhibition of MEE proliferation during palatal fusion. Dev Dyn. 2003;227(3):387–94. pmid:12815624
- 40. Liu Y, Festing M, Thompson JC, Hester M, Rankin S, El-Hodiri HM, et al. Smad2 and Smad3 coordinately regulate craniofacial and endodermal development. Dev Biol. 2004;270(2):411–26. pmid:15183723
- 41. Gritli-Linde A. The etiopathogenesis of cleft lip and cleft palate: usefulness and caveats of mouse models. Curr Top Dev Biol, 2008. 84:37–138.
- 42. Yu K. Differences in oral structure and tissue interactions during mouse vs. human palatogenesis: implications for the translation of findings from mice. Front Physiol. 2017;8:154.
- 43. Funato N, Nakamura M, Yanagisawa H. Molecular basis of cleft palates in mice. World J Biol Chem. 2015;6(3):121–38. pmid:26322171
- 44. Biddle FG, Fraser FC. Genetics of cortisone-induced cleft palate in the mouse-embryonic and maternal effects. Genetics. 1976;84(4):743–54. pmid:1010312
- 45. Dixon J, Jones NC, Sandell LL, Jayasinghe SM, Crane J, Rey J-P, et al. Tcof1/Treacle is required for neural crest cell formation and proliferation deficiencies that cause craniofacial abnormalities. Proc Natl Acad Sci U S A. 2006;103(36):13403–8. pmid:16938878
- 46. Iyyanar PPR, Nazarali AJ. Hoxa2 inhibits bone morphogenetic protein signaling during osteogenic differentiation of the palatal mesenchyme. Front Physiol. 2017;8:929. pmid:29184513