Figures
Abstract
The Cholistan Desert of Pakistan harbors unique reptile diversity, including ecologically significant agamid lizards of the genera Calotes and Uromastyx, yet their genetic structure remains poorly understood. This study presents the first mitochondrial DNA barcode assessment of these taxa in the region, analyzing 658 bp of the cytochrome c oxidase I (COI) gene from 19 specimens collected across seven desert sites. We employed a combination of distance-based (p-distance, K2P) and phylogenetic methods (Maximum Likelihood, Bayesian Inference) to evaluate genetic diversity and evolutionary relationships. Results revealed pronounced divergence between genera (24–30% K2P distance), with Uromastyx populations showing remarkably low intraspecific variation (0–1%), contrasting with higher diversity in Calotes (0–14%). Demographic analyses suggested stable populations (Tajima’s D = 0.93, p > 0.10), though haplotype networks indicated limited gene flow (Nm = 0.12). Our findings: (1) provide the first genetic baseline for these ecologically important desert lizards, (2) identify Uromastyx as potentially more vulnerable to genetic erosion, and (3) demonstrate the utility of COI barcoding for rapid biodiversity assessment in understudied arid ecosystems. The study highlights the Cholistan Desert as an evolutionary significant zone for agamid lizards while underscoring the need for integrated taxonomic approaches to address potential cryptic diversity. All sequence data are publicly available (GenBank PQ896696-PQ896705) to support future conservation genomic studies.
Citation: Hussain J, Afzal G, Haider MZ, Qadeer I, Perveen S, Ahmad HI, et al. (2025) Genetic diversity and phylogenetic relationships of Calotes and Uromastyx in the Cholistan Desert, Pakistan, based on COI gene analysis. PLoS One 20(6): e0324053. https://doi.org/10.1371/journal.pone.0324053
Editor: Taslima Sheikh, Sunrise University, INDIA
Received: January 29, 2025; Accepted: April 18, 2025; Published: June 17, 2025
Copyright: © 2025 Hussain et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All nucleotide sequences are deposited in GenBank (Accession Nos. PQ896696-PQ896705). Original gel images and laboratory protocols are provided as Supporting Information (S1 File).
Funding: The authors extend their appreciation to the Deanship of Research and Graduate Studies at King Khalid University for funding this work through large group research project under a grant number (R.G.P. 2/7/45).
Competing interests: The authors have declared that no competing interests exist.
Introduction
Cholistan is an arid desert region in the Province of Punjab, Pakistan that has a rich and diverse wildlife, especially reptiles who are threatened primarily by habitat degradation and predation. The diversty of herpetofauna in Pakistan is remarkable and includes 24 amphibian species and 195 reptiles; 13 reptiles are endemic [1,2]. Of these, the lizard is the foremost prominent group which composes families like Agamidae and Uromastycidae [3]. However, the conservation issue of reptiles is faced with some challenges this is evidenced by the International Union for Conservation of Nature (IUCN) Red List classification which reported that about 27.6% of reptiles are threatened with extinction risk and with many remaining unassessed Red List assessment [4].
The Cholistan Desert of Pakistan is a suitable habitat for a wide variety of reptilian species Calotes and Uromastyx. Molecular genetics of these lizards have not been well explored thus leaving large gaps on their phylogenetic tree and overall genetic variability. The genus Calotes is relatively frequent and these lizards occurs widely in the Oriental region: they are commonly found in plantation and garden environments where human interference is fairly common [5]. The genus Calotes is known for 34 species, where few of those are challenging for taxonomic classification and conservational biology [6,7].
Uromastyx (spiny-tailed lizard) on the other hand is however comprised of 17 species based on morphological identification. However, their phylogenetic analysis and classification is still ambiguous and continues to be an area of discussion [8,9]. Uromastyx hardwickii ranges from North Africa through the Indo-Pakistan subcontinent is particularly endangered due to threats as habitat loss and poaching the for the purpose of meat, skin and oil [10]. Yet, numerous kinds of the Uromastyx species are currently threatened by overexploitation, which includes documented export of more than 367,000 specimens between 1977 and 2005 [11]. Similarly, the genus Calotes—particularly the C. versicolor complex—has undergone repeated reassessments as molecular data uncover hidden diversity across South and Southeast Asia [5,12]. These studies collectively highlight the limitations of morphology-based taxonomy and underscore the necessity of genetic approaches for accurate biodiversity assessment.
Mitochondrial DNA markers, particularly the cytochrome c oxidase subunit I (COI) gene, have emerged as powerful tools for resolving such taxonomic uncertainties in reptiles [13]. The COI gene’s utility stems from its high mutation rate, which provides resolution at both species and population levels, as demonstrated in recent agamid studies [12,14]. This study provides the first COI barcode data for Cholistan’s Calotes and Uromastyx, addressing a key knowledge gap in Agamidae research. We document genetic diversity in threatened populations like U. hardwickii (historically overexploited) while demonstrating COI’s utility for rapid biodiversity assessment in arid ecosystems. Our findings establish both baseline genetic data and a framework for future genomic studies of these ecologically important desert lizards.
Materials and methods
Sample collection
A total of 19 individual lizard specimens were collected from seven selected sites in the Cholistan Desert (28°15′N to 29°45′N, 70°00′E to 72°00′E) between April and August 2024. Specimens were identified in the field based on morphological characteristics following standard taxonomic keys [5], with voucher specimens deposited at the Islamia University of Bahawalpur Zoological Museum (IUB-ZM2024–001–019). Blood and tissue samples were obtained from identified species of Calotes and Uromastyx using sterile techniques. Venous blood was obtained by using sterile hypodermic needles and syringes. The blood samples were preserved in Ethylenediamine tetraacetic acid (EDTA) blood collecting tubes and kept refrigerated at –20 °C to ensure DNA integrity before extraction. In addition, samples of the lizard tail samples were also collected and preserved as required for DNA extraction. After the study, the lizards were reintroduced into their original environment. This study was conducted following the approval of the research synopsis (Approval No. 1112/AS&R) and in strict adherence to the ethical guidelines for animal research as outlined by the Institutional Bio-Safety Committee (IBSC) of the Islamia University of Bahawalpur (Approval No. 455/ORIC). Throughout the research process, no procedures involving anesthesia, euthanasia, or animal sacrifice were employed. Furthermore, no instances of individual animal suffering were observed during the course of the study.
DNA extraction
The extraction of DNA was done using Thermo Fischer Scientific Gene JET Genomic DNA Purification kit for TAQ DNA Polymerase, TAQ Buffer, dNTPs. For blood samples, the extraction protocol included enzymatic lysis using proteinase K, followed by purification through a spin-column method. In brief, 100 µL of whole blood was treated with 200 µL of lysis buffer and 20 µL of proteinase K and incubated at 56°C for 10 minutes. This process started with transferring of 20 µL of proteinase K into a microcentrifuge tube to which anticoagulated blood was added either 50–100 µL for non-nucleated blood or 5–10 µL for nucleated blood; the final volume each tube was topped up to 220 µL with PBS. The sample was then treated with 200 µL of Buffer AL at the temperature 56°C for 10 minutes. Two hundred microliters of ethanol were added and vortexed to get a homogeneous solution. The mixture recovered was then applied to DNeasy Mini spin column placed in a collection tube and centrifugation was done at 6000 x g (8000 rpm) for one minute. The spin column was then washed in Buffer AW1 and AW2 to remove the remaining contaminants followed by DNA samples were air-dried, and DNA was eluted with Buffer AE to get rid of contaminants and obtain DNA for further applications.
Primer design
The mitochondrial cytochrome c oxidase subunit I (COI) gene was targeted for genetic diversity and phylogenetic analysis. The primers used for PCR amplification were as follows:
- • Forward Primer: 5’ GGTCAACAAATCATAAAGATATTGG 3’
- • Reverse Primer: 5’ TAAACTTCAGGGTGACCAAAAAATCA 3’
These primers enhanced amplification of target DNA sequence for further characterization.
Polymerase chain reaction (PCR) and gene amplification
PCR was performed in a 25 µL reaction mixture containing 12.5 µL of 2X DreamTaq PCR Master Mix (Thermo Fisher Scientific), 1.0 µL (10 pmol) of each primer, 2.0 µL of template DNA (~50 ng), and 8.5 µL of nuclease-free water. Amplification was conducted using a Bio-Rad T100™ Thermal Cycler under the following conditions: initial denaturation at 95°C for 4 min, followed by 35 cycles of denaturation at 94°C for 35 sec, annealing at 65°C for 45 sec, and extension at 72°C for 90 sec, with a final extension at 72°C for 8 min. The amplification procedure was finished with a final extension step that lasted eight minutes at 72°C. To confirm effective amplification, the PCR products were seen on a 1.5% agarose gel stained with SYBR® Safe DNA and documented under UV light using a GelDoc™ XR+ system (Bio-Rad, USA). Out of 19, 10 lizard’ specimens were amplified and sequenced of COI gene. Amplified PCR products were sent for sequencing to verify the species identity and comprehend the genetic makeup of the lizard samples (Calotes and Uromastyx).
DNA sequencing and data processing
Successful amplicons (~600–650 bp) were purified using the ExoSAP-IT™ PCR Product Cleanup Reagent (Thermo Fisher Scientific) and sent for bidirectional Sanger sequencing using an ABI 3730XL DNA Analyzer (1st BASE, Singapore). Sequences were checked for quality, assembled, and trimmed using BioEdit v7.2.5. The obtained DNA sequences were submitted to the NCBI GenBank with the accession numbers (PQ896696- PQ896705).
Molecular diversity and demographic analysis
The edited COI sequences were aligned using ClustalW implemented in MEGA 11 [15]. A multiple sequence alignment was performed to compare the collected sequences with reference sequences from GenBank. Analysis of population differentiation through pairwise tests (φST) alongside population structure patterns by Analysis of Molecular Variance (AMOVA) was run in Arlequin version 3.5.1.3. The data analysis for haplotypes was conducted through DnaSp ver. 5 program. A ND2 haplotype network was created through the median-joining (MJ) approach [16] with POPART [17].
Phylogenetic analysis
Phylogenetic relationships were inferred using the maximum likelihood (ML) and Bayesian inference (BI) methods. The ML tree was constructed in IQ-TREE v2.1.3 [18] with the best-fit nucleotide substitution model determined by ModelFinder. Support for nodes was evaluated using 1000 bootstrap replicates. The BI analysis was performed in BEAST v1.10.4 [19] with a Yule speciation model [20] and Markov Chain Monte Carlo (MCMC) sampling for 10 million generations. The first 25% of trees were discarded as burn-in, and posterior probabilities were estimated from the remaining trees. Genetic distances were computed using the p-distance model in MEGA 11. The outgroup sequence used for phylogenetic analysis was Agama agama (voucher CIBIO.983), a taxonomically related species from the family Agamidae. The final phylogenetic tree was visualized using FigTree v1.4.4.
Results
Genetic distance analysis
The pairwise genetic distances were analysed by the p-distance model in MEGA 11 software. The genetic distance analysis revealed clear patterns of evolutionary divergence among the 10 analyzed samples. The genetic distances in Table 1 presented as percentage values, shows the degree of genetic separation between the samples, while the upper triangular values show the standard error associated with each pairwise comparison. The results indicated two distinct genetic lineages within the dataset. The genetic analysis of samples IS.1 to IS.6 produced very small genetic distances (between 0.0% and 1.0%) which demonstrates these belongs to the same species (Uromastyx). The samples show low evolutionary divergence which support their genetic classification as a single genetic cluster.
On the other hand, samples IS.7 to IS.10 form a separate lineage, with intra-group genetic distances of 0.0% to 14.0%, indicating a closer evolutionary relationship among them. However, their genetic distances from samples IS.1 to IS.6 are significantly higher, ranging from 24.0% to 30.0%, confirming their classification as a distinct species. Results from samples IS.7 and IS.9 indicate 0.0% genetic distance which proves their exact genetic identity supporting their species placement. The genetic distance value of 0.0% from both samples IS.8 and IS.10 verifies that these two specimens belong to the same species (Calotes). The genetic separation between these two clusters aligns with known taxonomic distinctions between Calotes and Uromastyx. The obtained DNA sequences of these 10 samples were submitted to the NCBI GenBank, with the following accession numbers: PQ896696 to PQ896705, providing a valuable reference for future genetic and evolutionary studies.
Genetic diversity of Calotes and Uromastyx species
Genetic analysis of Calotes and Uromastyx species based on partial COI sequences revealed significant levels of genetic diversity, gene flow, and population differentiation using DnaSP analysis. A total of 10 sequences were analyzed, comprising six from Uromastyx and four from Calotes. DnaSP analysis identified a total of 5 haplotypes and 46 number of segregating sites. The Uromastyx population exhibited a lower number of segregating sites (S = 2) and nucleotide diversity (Pi = 0.00815) compared to Calotes (S = 21, Pi = 0.10072). Haplotype diversity was slightly higher in Uromastyx (Hd = 0.73333) than in Calotes (Hd = 0.66667), but the average number of nucleotide differences was considerably greater in Calotes (K = 14.000) than in Uromastyx (K = 1.13333), indicating greater genetic variation within the Calotes population. The total dataset revealed 46 segregating sites, five haplotypes, and an overall nucleotide diversity (PiT) of 0.16643. Genetic differentiation estimates showed a significant chi-square value (Chi² = 10.000, P = 0.0404), suggesting moderate differentiation between the two populations. The fixation index (Fst) was 0.80681, indicating a high level of genetic differentiation, with low gene flow (Nm = 0.12) between the populations. Additional genetic divergence metrics, including Nei’s Gst (0.17214) and Hudson’s Snn (1.00000), further supported strong differentiation. The pairwise genetic distance (Dxy = 0.28177) and net nucleotide divergence (Da = 0.22734) suggested substantial genetic separation between Calotes and Uromastyx within the Cholistan Desert.
Pairwise comparisons indicated an average of 72.511 nucleotide differences across 430.71 analyzed sites, with an overall nucleotide diversity (Pi) of 0.15823. At the individual site level, 676 positions were analyzed, identifying 195 polymorphic sites and an average of 104.946 differences, with a Pi value of 0.15525. Within Uromastyx, the number of polymorphic sites was low (S = 2), with an average nucleotide difference (k) of 1.133 and nucleotide diversity (Pi) of 0.00815. In contrast, Calotes exhibited a higher level of polymorphism (S = 21), with k = 14.000 and Pi = 0.10072, suggesting greater genetic variation. The total dataset showed 46 polymorphic sites and 55 mutations, with an average nucleotide difference (k) of 23.133 and nucleotide diversity (PiT) of 0.16643. Between populations, 32 fixed differences were observed, with 21 mutations polymorphic in Calotes but monomorphic in Uromastyx, and two mutations polymorphic in Uromastyx but monomorphic in Calotes. The genetic divergence between populations was substantial, with an average nucleotide difference of 39.167 and nucleotide substitution per site (Dxy) of 0.28177, increasing to 0.35387 with Jukes and Cantor correction. The net nucleotide substitution per site (Da) was 0.22734, reflecting significant evolutionary separation. Pairwise analysis further supported these findings, with k = 23.133, an observed variance of 333.4364, and a coefficient of variation (C.V.) of 0.8091. Ramos-Onsins and Rozas’ R2 statistic (0.2514) suggested demographic influences on genetic variation.
Demographic analyses
Demographic analyses based on Fu’s Fs, Tajima’s D, and other neutrality tests provided insights into the evolutionary history and population dynamics of Calotes and Uromastyx species in the Cholistan Desert. A total of 10 sequences were analyzed, covering 683 nucleotide sites, with 139 sites remaining after excluding alignment gaps. The number of polymorphic (segregating) sites was 46, with 55 total mutations. The average number of pairwise nucleotide differences (k) was 23.133, and nucleotide diversity (Pi) was 0.16643. Haplotype analysis revealed five distinct haplotypes, with a haplotype diversity (Hd) of 0.867 and a variance of 0.00509. Fu’s Fs statistic was 7.007, and Strobeck’s S statistic was 0.008, suggesting moderate genetic variation within the populations. Fu and Li’s D and F test statistics were 1.61114 and 1.66242, respectively, while Achaz’s Y statistic was 0.39171. Statistical significance was detected for Fu and Li’s D (P < 0.02) and F (P < 0.05), indicating potential deviations from neutrality, possibly due to population expansion or purifying selection. Tajima’s D statistic was 0.93030 (P > 0.10), indicating no significant departure from neutrality, suggesting a stable population size. The analyses showed no significant evidence of selection pressure, and the presence of multiple haplotypes with moderate genetic diversity suggests a relatively stable but slightly structured population.
The descriptive statistics in Table 2 show the genetic variation in Calotes and Uromastyx revealing moderate genetic diversity within the analyzed COI sequences. The haplotype diversity (Hd = 0.867) indicates a relatively high level of genetic variation among individuals. Nucleotide diversity (π = 0.16643) and the Watterson estimator (θw = 0.13987) suggest considerable polymorphism, with 46 segregating sites (S) identified. The average number of nucleotide differences (Π = 23.133) further supports the presence of genetic differentiation. Tajima’s D (D = 0.93030) was not statistically significant, indicating that the population is likely evolving neutrally without strong selection pressures. However, Fu’s FS test (FS = 7.007) suggests a deviation from neutrality, possibly due to demographic expansion or selection. The Ramos-Onsins and Rozas R2 statistic (R2 = 0.2514) and raggedness index (r = 0.1057) also indicate potential population structure changes. The estimated expansion parameter (τ = 5.518) and expected expansion time (texp = 17.615) further suggest that these populations may have undergone past demographic changes.
Population genetic structure analysis
In Table 3, AMOVA results revealed significant genetic differentiation between Uromastyx and Calotes populations. The variance among populations accounted for 40.42% of the total genetic variation, while the remaining 59.58% was attributed to within-population diversity. The fixation index (FST = 0.40421) suggests moderate to high genetic differentiation between the two species, indicating restricted gene flow and potential reproductive isolation. The highly significant P-value (0.00880, P < 0.01) were obtained from permutation tests confirms that the observed genetic structure is unlikely to have arisen by chance.
The molecular diversity indices indicate substantial differences between Uromastyx and Calotes. The number of substitutions was significantly higher in Calotes (85 substitutions) compared to Uromastyx (2 substitutions), highlighting greater genetic diversity within Calotes. Similarly, Calotes exhibited a much larger number of private substitution sites (84), reinforcing its higher intraspecific variability. The nucleotide diversity (Pi) was also considerably higher in Uromastyx (250.600) than in Calotes (111.333), suggesting greater genetic variation within Uromastyx. However, Calotes exhibited a higher Theta_S (46.36) compared to Uromastyx (0.87), indicating a larger historical population size or a recent population expansion in Calotes.
The ND2 haplotype network (Fig 1), constructed using the median-joining (MJ) approach in POPART, reveals clear genetic separation between Calotes (red) and Uromastyx (green), with no shared haplotypes. Calotes exhibits a more interconnected network, suggesting recent diversification and possible gene flow, while Uromastyx shows more dispersed haplotypes, indicating a historically structured population with limited genetic exchange. The greater mutational divergence in Uromastyx suggests longer evolutionary separation, whereas Calotes appears to have undergone recent genetic diversification, likely due to environmental adaptation or population expansion. The distinct clustering of haplotypes supports strong genetic isolation between the species, reinforcing their classification as separate evolutionary units.
Results of phylogenetic analysis
The phylogenetic relationships among the analyzed taxa were inferred using the Neighbor-Joining (NJ) method with the Maximum Composite Likelihood approach (Fig 2). The resulting phylogenetic tree presents two well-supported major clades, corresponding to the Calotes (blue) and Uromastyx (green) species, with Agama agama serving as an outgroup to root the tree.
The Calotes clade groups together samples IS.7 PQ896702, IS.8 PQ896703, IS.9 PQ896704, and IS.10 PQ896705, along with reference sequences of Calotes versicolor and Calotes vultuosus. The close association of study samples with C. versicolor suggests their genetic affinity with this species. The Uromastyx clade contains samples IS.1 PQ896696, IS.2 PQ896697, IS.3 PQ896698, IS.4 PQ896699, IS.5 PQ896700, and IS.6 PQ896701, clustering with reference sequences of Uromastyx dispar. The genetic structure within this clade suggests a degree of variation among the Uromastyx samples, likely due to population-level differentiation.
The phylogenic tree for the species of Calotes and Uromastyx were established with Bayesian Evolutionary Analysis through BEAST software with the help of Fig Tree v1.4 (Fig 3). The analysis used the General Time Reversible (GTR) model and performed the strict clock approach to calculate divergence time and posterior probabilities of each node. The phylogenetic tree was rooted to Agama agama outgroup as a measure of obtaining the evolutionary basal line. The posterior probability values are given above the branches signifying the measure of the clade support. The tree topology distinctly separates two major clades: one comprising Calotes versicolor and Calotes vultuosus, and the other containing Uromastyx dispar sequences. The high posterior probability values at key nodes support the reliability of these clades. Within the Calotes clade, multiple accessions of C. versicolor cluster closely, indicating low genetic divergence among them. Conversely, the Uromastyx clade exhibits slightly higher divergence, suggesting greater genetic diversity within the species. Additionally, the inclusion of samples IS.1_PQ896696 to IS.10_PQ896705 within these clades demonstrates their taxonomic affiliation. The samples IS.7_PQ896702, IS.3_PQ896698, and IS.5_PQ896700 cluster within the Uromastyx lineage, while IS.10_PQ896705, IS.9_PQ896704, and IS.8_PQ896703 are firmly placed within the Calotes clade. This suggests that the analyzed specimens are genetically aligned with their respective reference sequences. The phylogenetic reconstruction also highlights genetic divergence patterns, indicating that Uromastyx has undergone more significant evolutionary changes compared to Calotes. The findings provide strong molecular evidence for the distinct evolutionary pathways of these genera, reinforcing their taxonomic classification.
Discussion
The present study provides the first comprehensive assessment of genetic diversity and phylogenetic relationships of Calotes and Uromastyx lizards in the Cholistan Desert, Pakistan, based on mitochondrial COI gene sequences. Our results revealed significant genetic divergence between these genera, with distinct evolutionary lineages. We contextualize these results in light of existing literature, emphasizing their implications for conservation and species delineation.
The analysis of COI sequences demonstrated notable genetic differentiation between Calotes and Uromastyx, with pairwise distances ranging from 24% to 30%, consistent with their taxonomic separation at the genus level. Within Uromastyx, low intraspecific divergence (0.0–1.0%) suggests a closely related group, likely representing U. hardwickii, the only species documented in this region. This finding corroborates earlier studies that reported minimal mitochondrial divergence among Uromastyx populations in arid zones [8,21,22]. However, the higher nucleotide diversity in Calotes (π = 0.10072 vs. Uromastyx: π = 0.00815) indicates greater genetic variability, possibly reflecting adaptive responses to heterogeneous habitats or historical population expansions. Similar patterns were observed in Calotes versicolor populations across South Asia, where environmental gradients drove localized genetic structuring [5].
In this study, the AMOVA results further emphasized this divergence, with 40.42% of genetic variation attributed to differences between genera (FST = 0.404). Such pronounced differentiation aligns with studies on other agamid lizards, where desert-dwelling species exhibit stronger population structure due to habitat fragmentation [9,23]. Restricted gene flow (Nm = 0.12) between Calotes and Uromastyx likely stems from ecological niche partitioning—Uromastyx inhabits arid scrublands, while Calotes occupies vegetated areas—a phenomenon documented in sympatric agamids [24].
The ML and BI phylogenies resolved Calotes and Uromastyx as monophyletic clades, with Agama agama as a robust outgroup. Within Calotes, the clustering of Cholistan samples with C. versicolor (bootstrap >90%) supports their identification as members of this widespread species complex. However, the high intraspecific divergence (up to 14%) in our samples raises questions about potential cryptic diversity. Comparable findings were reported by Maulana, Pakpahan [12] in Indonesian Calotes, where COI-based analyses revealed unresolved species complexes. While mitochondrial markers alone cannot conclusively delineate species, our results echo calls for integrative taxonomic approaches combining morphology and nuclear genes (e.g., RAG1) to clarify these boundaries [14].
In our study, the low genetic distances among Cholistan specimens (for Uromastyx) contrast with the deep divergences observed between Saharo-Arabian congeners [21]. This uniformity may reflect recent colonization or bottleneck events, as proposed for Saara hardwickii in India [25]. Notably, the absence of shared haplotypes between genera in the median-joining network underscores their long-term evolutionary isolation, consistent with fossil evidence placing their divergence in the mid-Miocene [26]. Neutrality tests (Tajima’s D = 0.93030, P > 0.10; Fu’s FS = 7.007) suggested stable population sizes without recent bottlenecks. However, the raggedness index (r = 0.1057) and expansion parameter (τ = 5.518) imply past demographic fluctuations, possibly linked to Pleistocene climatic shifts that repeatedly altered desert habitats [9]. The higher haplotype diversity in Uromastyx (Hd = 0.733) compared to Calotes (Hd = 0.667) may reflect differential survival during aridification, as Uromastyx’s burrowing behavior buffers against environmental extremes [10].
These genetic patterns have urgent conservation implications. Both genera face habitat loss from agricultural expansion and overharvesting (Uromastyx for meat, Calotes for pet trade). The low genetic diversity in Uromastyx signals vulnerability to inbreeding, mirroring declines in North African populations [11]. Conversely, Calotes’ variability may confer resilience, but its reliance on fragmented vegetation necessitates habitat corridors. Regionally, our findings advocate for IUCN reassessments of U. hardwickii, currently listed as Least Concern, and underscore the Cholistan Desert as a biogeographic refugium worthy of protected status.
Conclusion
This study represents the first comprehensive genetic assessment of Calotes and Uromastyx lizards in the Cholistan Desert, Pakistan, utilizing mitochondrial COI gene analysis to elucidate patterns of diversity, differentiation, and evolutionary relationships. Our results confirm the distinct phylogenetic separation between these genera, with significant genetic divergence (24–30%) that aligns with their established taxonomic classification. Within Uromastyx, low intraspecific variation suggests a relatively homogeneous population, likely corresponding to U. hardwickii, while the higher diversity observed in Calotes points to potential cryptic lineages or adaptations to local ecological conditions. The findings contribute to a growing body of evidence highlighting the utility of COI barcoding for preliminary species identification and conservation prioritization in understudied arid ecosystems. By providing baseline genetic data, this study not only advances our understanding of agamid lizard evolution in Cholistan Desert in South Punjab, Pakistan but also establishes a framework for ongoing biodiversity monitoring in the region. Further integrative research, combining morphological, ecological, and genomic approaches, will be essential to clarify species boundaries and inform effective management strategies for these taxa in one of Pakistan’s most fragile desert ecosystems.
Acknowledgments
The authors extend their appreciation to the Deanship of Research and Graduate Studies at King Khalid University for funding this work through large group research project under a grant number (R.G.P. 2/7/45).
References
- 1. Ali W, Javid A, Hussain SM, Azmat H, Jabeen G. The amphibians and reptiles collected from different habitat types in district Kasur, Punjab, Pakistan. Pakistan Journal of Zoology. 2016;48(4).
- 2. Khan MS. Checklist of amphibians of Pakistan. Pakistan Journal of Wildlife. 2010;1(2):37–42.
- 3.
Khan M. Amphibians and Reptiles of Pakistan. Malabar, Florida: Krieger Publishing Company. 2006.
- 4. Böhm M, Collen B, Baillie JE, Bowles P, Chanson J, Cox N, et al. The conservation status of the world’s reptiles. Biological Conservation. 2013;157:372–85.
- 5. Gowande G, Pal S, Jablonski D, Masroor R, Phansalkar PU, Dsouza P, et al. Molecular phylogenetics and taxonomic reassessment of the widespread agamid lizard Calotes versicolor (Daudin, 1802) (Squamata, Agamidae) across South Asia. VZ. 2021;71:669–96.
- 6. Wang K, Deepak V, Das A, Grismer LL, Liu S, Che J. Systematic revision of the Calotes jerdoni complex (Reptilia: Squamata: Agamidae) in the Pan-Himalaya. VZ. 2024;74:169–92.
- 7. Huang Y, Li H, Wang Y, Li M, Hou M, Cai B. Taxonomic review of the Calotesversicolor complex (Agamidae, Sauria, Squamata) in China, with description of a new species and subspecies. Zookeys. 2023;1187:63–89. pmid:38161713
- 8. Amer SAM, Kumazawa Y. Mitochondrial DNA sequences of the Afro-Arabian spiny-tailed lizards (genus Uromastyx; family Agamidae): phylogenetic analyses and evolution of gene arrangements. Biological Journal of the Linnean Society. 2005;85(2):247–60.
- 9. Silva P. Global warming drives range shifts in spiny-tailed lizards (Squamata: Agamidae: Uromastyx) in the African and Arabian deserts. Ecophysiology of Uromastyx desert lizards and consequences for current and future distribution. 2021;191:59.
- 10. Joshi DS, Pandya PJ, Dudiya DD, Parmar SI. A comprehensive review of the indian spiny-tailed lizard Saara hardwickii (Gray, 1827) from Indian Subcontinent. Munis Entomology & Zoology. 2025;20(1):1460–8.
- 11.
Wa B. Ecological and genetic studies on the Arabian spiny-tailed lizard Uromastyx aegyptia microlepis (Blanford, 1875) in the state of Kuwait. United Kingdom: Bangor University. 2024.
- 12. Maulana MI, Pakpahan S, Darmawan A, Ariyanti Y. Genetic Relationship and the Putative Occurrence of A Species Complex Within the Indonesian Calotes (Daudin, 1802) (Squamata, Agamidae) Genus Based on COI Gene Sequences. HAYATI J Biosci. 2024;31(5):1019–29.
- 13. Antil S, Abraham JS, Sripoorna S, Maurya S, Dagar J, Makhija S, et al. DNA barcoding, an effective tool for species identification: a review. Mol Biol Rep. 2023;50(1):761–75. pmid:36308581
- 14. Vasconcelos R, Montero-Mendieta S, Simó-Riudalbas M, Sindaco R, Santos X, Fasola M, et al. Unexpectedly High Levels of Cryptic Diversity Uncovered by a Complete DNA Barcoding of Reptiles of the Socotra Archipelago. PLoS One. 2016;11(3):e0149985. pmid:26930572
- 15. Tamura K, Stecher G, Kumar S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol. 2021;38(7):3022–7. pmid:33892491
- 16. Bandelt HJ, Forster P, Röhl A. Median-joining networks for inferring intraspecific phylogenies. Mol Biol Evol. 1999;16(1):37–48. pmid:10331250
- 17. Leigh JW, Bryant D. popart: full‐feature software for haplotype network construction. Methods Ecol Evol. 2015;6(9):1110–6.
- 18. Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, von Haeseler A, et al. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Mol Biol Evol. 2020;37(5):1530–4. pmid:32011700
- 19. Suchard MA, Lemey P, Baele G, Ayres DL, Drummond AJ, Rambaut A. Bayesian phylogenetic and phylodynamic data integration using BEAST 1.10. Virus Evol. 2018;4(1):vey016. pmid:29942656
- 20. Gernhard T. The conditioned reconstructed process. J Theor Biol. 2008;253(4):769–78. pmid:18538793
- 21. Tamar K, Metallinou M, Wilms T, Schmitz A, Crochet P, Geniez P, et al. Evolutionary history of spiny‐tailed lizards (Agamidae: Uromastyx) from the Saharo‐Arabian region. Zoologica Scripta. 2017;47(2):159–73.
- 22. Abdel-Latif HMR, Soliman AA, Gewaily MS, Amer AA, Shukry M, Khalil RH, et al. Dietary effects of Saccharomyces cerevisiae and Allium sativum on growth, antioxidant status, hepatic and intestinal histoarchitecture, expression of growth- and immune-related genes, and resistance of Oreochromis niloticus to Aeromonas sobria. Fish Shellfish Immunol. 2024;148:109493. pmid:38461877
- 23.
Zug GR, Brown HH, Schulte JA, Vindum JV. Systematics of the garden lizards, Calotes versicolor group (Reptilia, Squamata, Agamidae), in Myanmar: Central dry zone populations. 2006.
- 24. Wagner P, Ihlow F, Hartmann T, Flecks M, Schmitz A, Böhme W. Integrative approach to resolve the Calotes mystaceus Duméril & Bibron, 1837 species complex (Squamata: Agamidae). Bonn Zoological Bulletin. 2021;70(1):141–71.
- 25. Sharma C, Das A, Mohanty S, Singh U, Das S. DNA sequence monomorphism of Indian spiny-tailed lizard Saara hardwickii suggests urgent conservation. Journal of Entomology and Zoology Studies. 2018;6(1):1547–51.
- 26. Wilms TM, Böhme W, Wagner P, Lutzmann N, Schmitz A. On the phylogeny and taxonomy of the genus Uromastyx Merrem, 1820 (Reptilia: Squamata: Agamidae: Uromastycinae)—resurrection of the genus Saara Gray, 1845. Bonner Zoologische Beiträge. 2009;56(1/2):55–99.