Perish the thawed? EDTA reduces DNA degradation during extraction from frozen tissue

Ella Messner; Lev Becker; Mia L. DeSanctis; Elizabeth A. Soranno; Ryan Pianka; Caileigh Pierce; Molly Johnson; Rosalia Falco Poulin; Hannah J. Appiah-Madson; Daniel L. Distel

doi:10.1371/journal.pone.0321872

Abstract

Cryopreservation is the gold standard for preserving high molecular weight (HMW) DNA (>10 kb) in tissue samples. However, frozen tissues are typically thawed either before or during DNA extraction, which can lead to substantial DNA degradation. In this study, we thawed the previously frozen tissues of 10 marine species (five fishes and five invertebrates) in the preservatives EDTA (250 mM, pH 10) or ethanol (EtOH, 95%) and maintained them in their respective preservatives overnight at 4°C before DNA extraction. We then compared the recovery of HMW DNA in these extracts to extracts prepared directly from frozen tissues. To evaluate the effect of these treatments on HMW DNA recovery, we determined the percentage of high molecular weight DNA (%HMW) and yield of HMW DNA normalized by tissue weight (nY) in each DNA extract. The average %HMW values for eight of the 10 species and the average nY values for five of the 10 species were significantly higher in extracts from EDTA-treated tissues compared to extracts from untreated frozen tissues. For all 10 species, we observed no significant decreases in average %HMW or nY values in extracts of EDTA-thawed tissues compared to those extracted directly from frozen tissues. In contrast, EtOH treatment did not significantly improve the average %HMW or nY values in extracts from tissues of nine of the 10 species when compared to extracts prepared directly from frozen tissues. Therefore, investigators may consider EDTA treatment as a simple method for improving HMW DNA recovery from frozen tissues.

Citation: Messner E, Becker L, DeSanctis ML, Soranno EA, Pianka R, Pierce C, et al. (2025) Perish the thawed? EDTA reduces DNA degradation during extraction from frozen tissue. PLoS One 20(6): e0321872. https://doi.org/10.1371/journal.pone.0321872

Editor: Shailender Kumar Verma, University of Delhi, INDIA

Received: October 1, 2024; Accepted: March 11, 2025; Published: June 3, 2025

Copyright: © 2025 Messner et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the manuscript and its Supporting Information files except sequence data, which are deposited to NCBI Nucleotide Database under the accession numbers listed in S1 Table.

Funding: This work was funded by a grant from Cell Signaling Technologies Inc. Annual Research Grant Program ( to DLD) and received support from the Donald Comb Research Scholarship Fund (to DLD), the Ocean Genome Legacy Operations Fund (to DLD), and the Francis Goelet Charitable Lead Trust (to DLD). Resources purchased with funds from the National Science Foundation’s Field Stations and Marine Laboratories program (DBI 1722553 to Northeastern University) were used to generate data for this manuscript. The funders had no role in study design, data collection and analysis, decision to publish, or manuscript preparation.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Cryopreservation at ultracold temperatures, typically -80 to -196°C, is the preferred method for preserving DNA in tissue samples for genetic or genomic research [1–6]. For example, a 2014 survey of 45 genomic resource collections associated with natural history museums and research institutions found that 91% maintained frozen materials, 78% maintained ultracold freezers, and 27% maintained liquid nitrogen dewars [7]. Low temperatures reduce DNA degradation by inhibiting chemical and biological activity, including nuclease activity that can rapidly reduce the average molecular weight of DNA in tissues [5,8]. Such fragmentation renders DNA less suitable for many downstream applications, including long-read DNA sequencing, reduced-representation sequencing, whole genome and metagenome sequence assembly, and preparation of large insert libraries [1,3,9,10].

While freezing may protect against DNA degradation, this protection is lost when the materials are thawed [1,11]. Because most DNA extraction procedures occur in liquid media, tissues must be thawed, at least briefly, either before or during extraction, which potentially allows DNA degradation to occur. To minimize DNA damage due to thawing, researchers often grind frozen tissues in liquid nitrogen or on dry ice before transferring the frozen material to an appropriate DNA extraction medium [12–14]. While effective, these methods are technically demanding, inconvenient, dangerous, and prone to accidental thawing and tissue loss during transfer, especially for small samples.

When applied to fresh tissues, chemical preservatives can substantially reduce DNA degradation during subsequent handling and storage [8]. In this investigation, we ask whether the same is true when applied to frozen tissues. Specifically, we ask whether placing frozen tissues in the chemical preservatives ethylenediaminetetraacetic acid (EDTA) or ethanol (EtOH) during the transition from the frozen to the thawed state can provide simple, convenient, safe, inexpensive, and effective methods for reducing DNA degradation during subsequent handling and DNA extraction.

We chose to evaluate EtOH as it is the most commonly used tissue preservative compatible with DNA preservation. It is widely employed for field collection and long-term storage of biological materials, particularly in natural history collections. EtOH protects DNA by dehydrating and denaturing proteins, thus slowing chemical and enzymatic reactions [15]. While EtOH at 70–95% is inexpensive, easy to obtain, and effective for short-term DNA preservation in biological materials, it is less effective for long-term tissue storage [16]. Additionally, EtOH is flammable and subject to shipping restrictions [8,17].

We chose to evaluate EDTA as it is a common ingredient in many preservative solutions [8] and is the primary active ingredient [18] in DESS [19], a widely used tissue preservative that is as or more effective than EtOH in preventing DNA degradation in tissues from a wide range of organisms [9,18–27]. EDTA reduces DNA degradation in tissues by chelating divalent cations that are required as cofactors by deoxyribonucleases (DNases) [17,18,28,29]. Although EDTA is used most frequently at pH 7.5–8, e.g., in DESS [19], a recent investigation found that EDTA solutions become significantly more effective at preserving HMW DNA when the pH of the solution is raised from 8 to 10, especially for tissues that display rapid DNA degradation in other preservatives [17]. This increased effectiveness correlates with EDTA’s increasing capacity to chelate divalent cations as pH rises [17]. EDTA is inexpensive, readily available, and has low toxicity, but unlike EtOH, it is nonflammable and can be shipped as a non-hazardous material [17].

In this study, we evaluate whether treatment with EDTA or EtOH can improve the recovery of HMW DNA from frozen tissues. Specifically, we thawed the previously frozen tissues of 10 marine species (five fishes and five invertebrates) in the preservatives EDTA (250 mM, pH 10) or EtOH (95%) and maintained them in their respective preservatives overnight at 4°C before DNA extraction. We then determined the percentage of high molecular weight DNA (%HMW) and yield of HMW DNA normalized by tissue weight (nY) in each DNA extract and compared these among treatments.

Materials and methods

Ethics statement

This study followed the guidelines recommended by the National Institutes of Health Guide for the Care and Use of Laboratory Animals and Northeastern University’s Institutional Animal Care and Use Committee policies. Although no live vertebrate animals were used in this study, the general principles of humane animal care were applied to the treatment of live invertebrate animals.

Specimen selection, storage, and sampling

In this investigation, we sampled a wide range of species, storage conditions, and tissues to reflect a diverse selection of materials from which researchers may wish to isolate high molecular weight DNA.

We chose 16 species that represent a wide range of animal taxa, including members of 16 genera, 12 families, and three phyla (S1 Table). DNA and images of all specimens have been deposited into the Ocean Genome Legacy Center Genomic Resource Collection [30] and are available via the Arctos database (arctosdb.org) [31] under the catalog numbers listed in S1 Table.

To reflect the diversity of cryostorage conditions found across many frozen collections, we selected organisms that were frozen whole and stored for various periods and under various conditions, some of which are unknown. Specifically, 10 specimens each of five marine fish and five marine invertebrate species (S1 Table) were used for the qualitative and quantitative comparison of treatments (Fig 1). Specimens of Cololabis saira (Pacific saury), Larimichthys polyactis (redlip croaker), Odontesthes regia (silverside), Sardina pilchardus (European pilchard), Amphioctopus sp. (octopus), Magallana gigas (Pacific oyster), and Penaeus vannamei (whiteleg shrimp) were purchased as whole, frozen individuals at grocery stores and stored at -80°C for 0–43 days before sampling. Specimens of Centropristis striata (black sea bass) were collected in trawls by the Massachusetts Department of Marine Fisheries and maintained as frozen whole specimens at -23°C for 9.8 to 9.9 years before transfer to -80°C for 1 day before tissue sampling. Specimens of Homarus americanus (American lobster) and Mercenaria mercenaria (hard-shell clam) were obtained live from seafood suppliers and frozen at -80°C for 2.1 years before sampling. Specimens of H. americanus and M. mercenaria were euthanized by splitting, i.e., cutting quickly along the longitudinal midline with a large sharp knife. While proposed euthanasia methods are published for some invertebrate taxa, there is a lack of peer-reviewed literature evaluating their effectiveness [32]. Nonetheless, the methods described here have been judged as likely to be humane for lobsters [33]. To our knowledge, reliable data on euthanasia are not available for the bivalve M. mercenaria.

Download:

Fig 1. Experimental Design.

Three frozen tissue samples were collected from each of 10 individuals of 10 marine species (five marine fishes and five marine invertebrates) for a total of 300 samples. One sample from each individual was then thawed in EDTA (250 mM, pH 10) overnight at 4°C and the second was thawed in ethanol (95%) overnight at 4°C, after which DNA was extracted, analyzed, and compared to DNA extracted directly from the third frozen tissue sample, which did not receive liquid preservative treatment.

https://doi.org/10.1371/journal.pone.0321872.g001

Specimens of six additional fish species, Alosa mediocris (hickory shad; N = 3), Brevoortia tyrannus (Atlantic menhaden; N = 6), Cynoscion regalis (weakfish; N = 3), Peprilus triacanthus (Atlantic butterfish; N = 3), Scomberomorus maculatus (Spanish mackerel; N = 6), and Trinectes maculatus (hogchoker; N = 4), were collected in trawls by the Connecticut Department of Energy and Environmental Protection and were maintained as frozen whole specimens for 2.8 to 3.9 years at -80°C before tissue sampling. Because too few specimens were available to achieve statistical power sufficient for preservative treatment comparisons, specimens of these species were used only for qualitative analyses.

The samples we collected also reflected a range of tissues. Samples from all fish specimens were collected from the dorsal musculature posterior to the pectoral fin. Tissue samples from Amphioctopus sp., Magallana gigas, and Mercenaria mercenaria were collected from tentacles, visceral mass, and mantle, respectively. For H. americanus and Penaeus vannamei, tissue samples were collected from the abdominal musculature.

Tissue handling and DNA extraction

All specimens were dissected while frozen on a chilled aluminum plate to minimize thawing. For specimens of all species, excluding H. americanus and M. mercenaria, three tissue samples of 100 mg (avg. = 102.0 ± 7.9 mg) each were rapidly collected from each frozen specimen, placed into 1.5 mL microcentrifuge tubes, and immediately stored at -80°C for 5–31 days before subsequent processing. For each of these specimens, 1 mL of EDTA (250 mM, pH 10) was added to the first of the three frozen tissue samples and 1 mL of EtOH (95%) was added to the second. These samples were stored in their respective preservatives overnight at 4°C. Subsequently, a 25 mg (avg. = 25.5 ± 3.4 mg) subsample was removed from each 100 mg sample and transferred to the Qiagen DNeasy Blood and Tissue kit (Hilden, Germany) lysis solution for DNA extraction. The third tissue sample from each frozen specimen was dissected on a chilled aluminum plate and a 25 mg (avg. = 25.9 ± 4.1 mg) subsample was transferred directly into the lysis solution without additional liquid preservative treatment. For H. americanus and M. mercenaria, 100 mg (avg. = 99.9 ± 16.4 mg) samples were handled as above except (1) tissues were processed immediately rather than being stored at -80°C before 25 mg (avg. = 25.4 ± 1.7 mg) subsamples were taken for DNA extraction and (2) frozen 25 mg (avg. = 25.4 ± 1.4 mg) tissue subsamples with no subsequent liquid preservative treatment were taken directly from frozen specimens for DNA extractions. Samples for all species, excluding Centropristis striata, H. americanus, and M. mercenaria, were re-weighed after preservative treatment but before subsampling. We used this post-treatment weight to calculate changes in mass due to preservative treatment.

DNA was extracted using the Qiagen DNeasy Blood and Tissue kit (Hilden, Germany) according to the manufacturer’s protocol, with overnight digestions at 56°C and the following modifications: (1) after digestion, 4 µL of RNase A (100 mg/mL; Qiagen; Hilden, Germany) were added to each subsample and subsamples were incubated at room temperature for 2 minutes before proceeding with the extraction protocol and (2) DNA was eluted with two sequential 50 µL volumes of buffer AE and combined for a total of 100 µL.

DNA analysis

For qualitative visualization, 3 µL (between 4.98 and 720 ng DNA) of each purified DNA sample were size-separated by gel electrophoresis (0.8% agarose, 1X TAE, 5 volts/cm for 50 minutes), stained with 1% GelRed nucleic acid stain (Biotium; Fremont, CA), and imaged using a Gel Doc XR+ Molecular Imager (Bio-Rad; Hercules, CA). The first two and last two lanes of each gel were loaded with 0.33, 0.66, or 1 µL of Quick-Load Purple 1 kb Plus DNA Ladder (100 µg/mL; New England Biolabs; Ipswich, MA) as molecular weight standards. The specific volumes of ladder used are indicated in each figure legend.

To determine %HMW and nY, we analyzed 1 μL (between 1.66 and 240 ng DNA) of each DNA extract using the Agilent Technologies TapeStation 2200 DNA Analyzer (Santa Clara, CA) with Genomic DNA ScreenTapes and TapeStation Analysis Software version A.02.02 (SR1). In this investigation DNA fragments greater than 10 kb are considered HMW and fragments from 150 bp to 10 kb are considered low molecular weight (LMW). As in [17], we estimated the %HMW for each sample as 100 minus the percentage of low molecular weight DNA (%LMW) as measured by the DNA Analyzer. This method avoids the exclusion of DNA fragments greater than the 60 kb resolution limit of the DNA Analyzer from the %HMW estimate.

The normalized yield of HMW DNA (nY) was calculated for each sample by multiplying the %HMW by the total amount of DNA in the sample (%HMW x concentration x elution volume), then dividing that product by the weight of the tissue used for the extraction multiplied by a correction ratio (CR) to account for the effect of treatment on tissue mass.

For all species, excluding C. striata, H. americanus, and M. mercenaria, CR was determined by dividing the initial weight of the whole sample by its post-treatment weight [18].

For C. striata, H. americanus, and M. mercenaria, a post-treatment weight was not determined, and therefore, tissue weights were not corrected (i.e., CR = 1).

To evaluate DNA purity, optical absorbance was measured for 2 µL of each sample (between 3.32 and 480 ng DNA) at 230, 260, and 280 nm using a Nanodrop 1000 droplet spectrophotometer (Thermo Fisher Scientific; Waltham, MA) and the A₂₆₀/A₂₈₀ and A₂₆₀/A₂₃₀ absorbance ratios were calculated.

All statistics were analyzed and visualized in RStudio [34,35] using the tidyverse version 2.0.0 [36], conover.test version 1.1.6 [37], multcompView version 0.1–10 [38], cowplot version 1.1.3 [39], stringr version 1.5.1 [40], and rstatix version 0.7.2 [41] packages. The effect of preservative treatment on %HMW and nY values were analyzed independently for each species. To determine whether the data followed a normal distribution, a Shapiro-Wilk normality test was performed. If the data were normally distributed, Mauchly’s test of sphericity was performed, followed by a one-way repeated measures ANOVA and a Bonferroni-corrected Tukey post-hoc test. If the data were not normally distributed, a Friedman χ² test was performed, followed by a Bonferroni-corrected Conover post-hoc test.

PCR amplification and DNA sequencing

The suitability of the extracted DNA for typical downstream applications was evaluated as in [17]. Briefly, the barcode segment [42] of the cytochrome c oxidase subunit 1 (COI) gene from each DNA extract was amplified by polymerase chain reaction (PCR) and Sanger sequenced. PCR amplifications for all fish species used the primers FISHCOILBC (5’–TCAACYAATCAYAAAGATATYGGCAC–3’) and FISHCOIHBC (5’–ACTTCYGGGTGRCCRAARAATCA–3’) [43]. For invertebrate species, primers LCO1490_t1 (5’–TGTAAAACGACGGCCAGTGGTCAACAAATCATAAAGATATTGG–3’) and HCO2198_t2 (5’–CAGGAAACAGCTATGACTAAACTTCAGGGTGACCAAAAAATCA–3’) [44] were used. Each reaction consisted of 17.5 µL of OneTaq 2X Master Mix with Standard Buffer (New England Biolabs; Ipswich, MA), 14.1 µL of ultrapure water, 2 µL of DNA template, and 0.7 µL of each of the forward and reverse primers. The thermocycling conditions for fish species were: 30 seconds at 94°C; 30 cycles of 30 seconds at 94°C, 40 seconds at 52°C, and 60 seconds at 68°C; 5 minutes at 68°C; hold at 4°C. The thermocycling conditions for invertebrate species were: 30 seconds at 94°C; 34 cycles of 30 seconds at 94°C, 50 seconds at 45°C, and 60 seconds at 68°C; 5 minutes at 68°C; hold at 4°C. PCR success was evaluated by gel electrophoresis, as described above; when appropriately sized bands were visualized on the gel, the PCR amplification was considered successful.

All PCR products were bidirectionally sequenced by Sanger sequencing at Psomagen (Rockville, MD) using an ABI 3730XL Analyzer (Applied Biosystems; Foster City, CA). Sequences were analyzed with Geneious Prime (Auckland, New Zealand). Ends were automatically trimmed to remove primers sequences and sequence regions with greater than 1% error probability. Sequences greater than 500 bp in length and with a greater than 98% Q20 score were considered successful. Assembled contigs and sequences were deposited into the GenBank [45] database under the accession numbers listed in S1 Table.

Results

DNA was recovered from all samples, species, and treatments; %HMW values ranged from 3.85 to 86.21% and nY values ranged from 0.00030 to 0.44367 µg DNA/mg tissue (S2 Table). Treatment significantly affected %HMW and nY in eight and six of the 10 statistical models, respectively (Figs 2 and 3; Table 1). The absorbance and absorbance ratios A₂₆₀, A₂₆₀/A₂₈₀, and A₂₆₀/A₂₃₀ and Tapestation DNA Analyzer data are presented in S2 Table.

Download:

Table 1. The effect of preservative treatments on average percentages of high molecular weight DNA (%HMW) and average yields of high molecular weight DNA normalized by tissue weight (nY) for DNA extracts from frozen tissues of 10 specimens of each of 10 marine species.

https://doi.org/10.1371/journal.pone.0321872.t001

Download:

Fig 2. Percentage of high molecular weight DNA.

Average values for percentage of high molecular weight DNA (%HMW) were determined for extracts prepared from frozen tissue samples collected from each of 10 individuals of 10 marine species (five marine fishes and five marine invertebrates). One sample from each individual was then thawed in EDTA (250 mM, pH 10; maroon) overnight at 4°C and the second was thawed in ethanol (95%; blue) overnight at 4°C, after which DNA was extracted, analyzed, and compared to DNA extracted directly from the third frozen tissue sample, which did not receive liquid preservative treatment (yellow). Error bars represent standard error. Within each histogram, treatments bearing different lower-case letters are significantly different at p < 0.05; matching lower-case letters indicate statistically indistinguishable treatments; an absence of letters indicates no significant differences among all treatments in a given model.

https://doi.org/10.1371/journal.pone.0321872.g002

Download:

Fig 3. Normalized yield of high molecular weight DNA.

Average values for yields of high molecular weight DNA normalized by tissue weight (nY) were determined for extracts prepared from frozen tissue samples collected from each of 10 individuals of 10 marine species (five marine fishes and five marine invertebrates). One sample from each individual was then thawed in EDTA (250 mM, pH 10; maroon) overnight at 4°C and the second was thawed in ethanol (95%; blue) overnight at 4°C, after which DNA was extracted, analyzed, and compared to DNA extracted directly from the third frozen tissue sample, which did not receive liquid preservative treatment (yellow). Error bars represent standard error. Within each histogram, treatments bearing different lower-case letters are significantly different at p < 0.05; matching lower-case letters indicate statistically indistinguishable treatments; an absence of letters indicates no significant differences among all treatments in a given model. Note that y-axis scales differ among species.

https://doi.org/10.1371/journal.pone.0321872.g003

Effect of treatments on %HMW

DNA extracts from muscle tissue samples of all five of the fish species examined quantitatively (Centropristis striata, Cololabis saira, L. polyactis, O. regia, and Sardina pilchardus) yielded significantly greater %HMW values when thawed in EDTA before DNA extraction as compared to those isolated directly from frozen tissues (Fig 2). This effect was most extreme in tissues of Centropristis striata, where DNA extracts from EDTA-thawed tissues yielded an average %HMW value more than three-fold higher than extracts from frozen tissues (54.8 ± 13.9% vs. 14.9 ± 7.6%). DNA extracts from EDTA-thawed tissues also yielded higher %HMW values than those from EtOH-thawed tissues for four of the five fish species (Centropristis striata, Cololabis saira, L. polyactis, and S. pilchardus). No significant differences in %HMW values were observed between DNA extracts obtained from EtOH-thawed tissues and those obtained directly from frozen tissues among these five fish species.

Similarly, DNA extracts from tissues of three of the five invertebrate species (H. americanus, Magallana gigas, and Mercenaria mercenaria) yielded significantly greater %HMW values when isolated from tissues thawed in EDTA compared to those purified directly from frozen tissues (Fig 2). This difference was greatest in H. americanus, where tissues thawed in EDTA yielded an average %HMW value more than two-fold greater than extracts prepared directly from frozen tissues (45.3 ± 13.3% vs. 19.4 ± 10.0%). DNA extracts from tissues of two of the five invertebrate species (H. americanus and Magallana gigas) showed significantly greater %HMW values when thawed in EDTA than when thawed in EtOH. For four of the five invertebrate species (Amphioctopus sp., H. americanus, M. gigas, and P. vannamei), %HMW values of DNA extracts from EtOH-thawed tissues were not significantly different or significantly lower than those from frozen tissues.

For all 10 species, we observed no significant decreases in %HMW values in extracts of EDTA-thawed tissues compared to those extracted directly from frozen tissues.

Effect of treatments on nY

Patterns observed for nY were similar to those seen in %HMW. For three of the five fish species (Centropristis striata, Cololabis saira, and O. regia), the nY values of DNA extracts from muscle tissue samples were significantly greater when thawed in EDTA before extraction as compared to those isolated directly from frozen tissues (Fig 3). This effect was most extreme in tissues of O. regia, where the average nY value of DNA extracts from EDTA-thawed tissues was more than four-fold higher than extracts from frozen tissues (0.02400 ± 0.02350 µg DNA/mg tissue vs. 0.00511 ± 0.00358 µg DNA/mg tissue). The nY values of DNA extracts from EDTA-thawed tissues were also greater than those from EtOH-thawed tissues for two of the five fish species (Centropristis striata and Cololabis saira). No significant differences in nY values were observed between DNA extracts obtained from EtOH-thawed tissues and those obtained directly from frozen tissues for all five of the fish species.

Similarly, for two of the five invertebrate species (M. gigas and P. vannamei), the nY values of DNA extracts were significantly greater when isolated from tissues thawed in EDTA compared to those purified directly from frozen tissues (Fig 3). This difference was greatest in P. vannamei, where the average nY value of tissues thawed in EDTA was nearly eight-fold greater than extracts prepared directly from frozen tissues (0.15825 ± 0.09017 µg DNA/mg tissue vs. 0.01981 ± 0.01359 µg DNA/mg tissue). The nY values of DNA extracts from tissues of three of the five invertebrate species (Amphioctopus sp., M. gigas, and P. vannamei) were significantly greater when thawed in EDTA than when thawed in EtOH. The nY values of DNA extracted from frozen tissues were significantly greater than those from tissues thawed in EtOH for only one species (Amphioctopus sp.).

For all 10 species, we observed no significant decreases in nY values in extracts of EDTA-thawed tissues compared to those extracted directly from frozen tissues.

Qualitative DNA analyses

The quantitative results for the 10 species described above are consistent with qualitative observations made by gel electrophoresis (S1 Fig). Gel electrophoresis also revealed qualitatively similar trends for DNA extracts from tissues of six additional fish species for which too few specimens were available for conclusive statistical analyses (S2 Fig).

PCR amplification and DNA sequencing

To determine if DNA extracts were of sufficient quality for downstream applications, PCR amplification and COI sequencing success were evaluated for all 16 species. Across all species and treatments, 96% of PCR amplifications were successful as determined by the presence of a single appropriately sized band on an electrophoretic gel (S2 Table). Specifically, only 1 of 125 (0.8%) reactions from extracts of EDTA-thawed tissues was unsuccessful, whereas 6 (4.8%) and 8 (6.4%) reactions from extracts of EtOH-thawed and frozen tissues were unsuccessful, respectively. These failed reactions were limited to three species: Centropristis striata, T. maculatus, and Amphioctopus sp.

The overall success rate of sequencing was also high, with 92.5% of reactions producing sequences longer than 500 bp and with Q20 scores greater than 98% (S2 Table). Specifically, 7 (5.6%), 11 (8.8%), and 10 (8.0%) of 125 reactions each from extracts of EDTA-thawed, EtOH-thawed, and frozen tissues were unsuccessful, respectively. These failed reactions were limited to eight species—six fishes and two invertebrates. Note that all sequencing reactions for T. maculatus were unsuccessful, regardless of treatment. In all cases, successful sequences from the same organism were identical regardless of treatment. Additionally, sequencing revealed that two species of octopus, Amphioctopus aegina (N = 8) and A. fangsiao (N = 2), were present among our specimens although they were all purchased as A. membranaceus. These are closely related sister species and so were grouped together as Amphioctopus sp. in our analysis.

Discussion

Cryopreservation is one of the most common ways that individual researchers and curators of biological collections preserve tissues for genetic and genomic research applications [2]. Under optimal conditions, cryopreservation can indefinitely maintain DNA integrity in tissues [8,46,47]. Storage in liquid nitrogen dewars (-196°C) is considered best for HMW DNA preservation, effectively halting enzymatic and chemical activity [5]. Storage in ultracold freezers (-80°C) dramatically reduces but does not entirely halt enzymatic activity, so gradual DNA degradation may still occur [8,46,48]. Nonetheless, storage at -80°C is an excellent option that can preserve DNA in tissues for decades [48]. Storage at -20°C in standard laboratory freezers may also be suitable for shorter-term preservation of HMW DNA in tissues [8].

However, because most DNA extractions are performed in liquid media, frozen tissue samples must typically be thawed either before or during DNA extraction, potentially exposing their DNA to chemical or enzymatic degradation. In this investigation, we show that thawing frozen tissues in EDTA (250 mM, pH 10) and maintaining them in this preservative overnight at 4°C can significantly improve the recovery of HMW DNA from those tissues. For eight of the 10 fish and invertebrate species examined, %HMW values were up to three-fold greater in DNA extracts from EDTA-treated tissues compared to extracts from untreated frozen tissues. Similarly, nY values were improved up to eight-fold in extracts from five of the 10 species examined compared to extracts prepared directly from frozen tissues. Indeed, we observed significant improvement in %HMW, nY, or both in nine of the 10 species examined.

Importantly, we observed no significant decreases in %HMW or nY values for extracts of EDTA-thawed tissues compared to those extracted directly from frozen tissues, nor were harmful effects observed on PCR amplification or DNA sequencing. Indeed, success rates for PCR amplification and Sanger sequencing of the mitochondrial COI gene were highest for DNA extracts from tissues thawed in EDTA.

Furthermore, EDTA treatment was effective in improving recovery of HMW DNA from a variety of frozen tissue types across a broad range of taxa. Significant improvements in %HMW, nY, or both were observed in tissue types derived from dorsal musculature, tentacles, mantle, and abdominal musculature from representatives of three phyla (Chordata, Mollusca, and Arthropoda), including 5 fish and 4 invertebrate species. Additionally, we saw qualitative evidence for reduced DNA degradation in extracts of EDTA-thawed samples from an additional six fish species where statistical analyses were not performed.

In contrast, EtOH treatment provided little or no protection for DNA during the transition from frozen tissue to purified DNA. Specifically, for nine of the 10 species examined, average %HMW values for extracts from EtOH-thawed tissues were not significantly different or were significantly lower than those from frozen tissues. The same is true for nY in all 10 species.

Interestingly, thawing frozen tissue samples in EDTA prior to DNA extraction improved recovery of HMW DNA from frozen tissues maintained under a range of cryostorage conditions. For example, %HMW and nY values were significantly improved for H. americanus and Mercenaria mercenaria, which were stored at -80°C for two years, as well as C. striata, which was stored under less ideal conditions at -23°C for nine years. These results indicate that regardless of freezer storage conditions, EDTA treatment can improve the recovery of HMW DNA.

In conclusion, our results indicate that, although cryopreservation can provide excellent protection for HMW DNA, substantial DNA degradation can occur during the preparation of frozen tissues for DNA extraction. In these experiments, we took care to minimize the thawing of frozen tissues before DNA extraction by working quickly and subsampling tissues on a chilled aluminum plate. Nonetheless, we observed substantial DNA degradation in most extracts prepared directly from frozen tissues. While this degradation might have been reduced by performing the tissue dissections under colder conditions, e.g., in liquid nitrogen or on dry ice, such stringent conditions are difficult, inconvenient, dangerous, and expensive to maintain. Our results show that thawing frozen tissues in EDTA provides a convenient alternative that reduces DNA degradation and allows tissues to be safely subsampled, weighed, and handled at room temperature with significantly reduced DNA degradation.

Finally, we note that tissues of different types and taxonomic origin may vary widely in physical, chemical, and biological properties, e.g., hardness, surface area to volume ratio, permeability, pH, chemical composition, enzymatic activity, etc., and that these properties can influence the performance of preservative treatments. Nonetheless, in this investigation, EDTA improved the recovery of HMW DNA across a wide variety of marine animal species and tissues, suggesting the potential of this method for broader application. Further investigation is warranted to determine if EDTA treatment can improve DNA recovery from frozen tissues of other marine and non-marine organisms across the tree of life, thereby adding value to the enormous variety of samples held in frozen research collections worldwide.

Supporting information

S1 Fig. Visualization of DNA extracts by gel electrophoresis for 10 marine species.

DNA was extracted from frozen tissue samples collected from each of 10 individuals of 10 marine species (five marine fishes and five marine invertebrates) that were thawed in EDTA (250 mM, pH 10; lanes 1–10) or ethanol (95%; lanes 11–20) overnight at 4°C or extracted directly from frozen tissues without subsequent liquid preservative treatment (lanes 21–30). Lanes marked with an L contain 0.66 μL of Quick Load Purple 1 kb Plus DNA Ladder (100 μg/mL; New England Biolabs; Ipswich, MA), except for Centropristis striata, for which lanes marked with an L contain 1 μL of Quick Load Purple 1 kb Plus DNA Ladder. Specimens are presented in the same order across all treatments.

https://doi.org/10.1371/journal.pone.0321872.s001

(PDF)

S2 Fig. Qualitative visualization of DNA extracts from six additional fish species by gel electrophoresis.

DNA was extracted from tissues of six additional marine fish species that were thawed in EDTA (250 mM, pH 10; lanes 1–2) or ethanol (95%; lanes 3–4) overnight at 4°C or extracted directly from frozen tissues without subsequent liquid preservative treatment (lanes 5–6) from two randomly selected specimens of each species. Lanes marked with an L contain 0.66 μL of Quick Load Purple 1 kb Plus DNA Ladder (100 μg/mL; New England Biolabs; Ipswich, MA). Specimens are presented in the same order across all treatments.

https://doi.org/10.1371/journal.pone.0321872.s002

(PDF)

S3 Fig. Raw gel images for S1 Fig.

DNA was extracted from frozen tissue samples collected from each of 10 individuals of 10 marine species (five marine fishes and five marine invertebrates) that were thawed in EDTA (250 mM, pH 10; lanes 21–30) or ethanol (95%; lanes 11–20) overnight at 4°C or extracted directly from frozen tissues without subsequent liquid preservative treatment (lanes 1–10). Lanes marked with an L contain either 0.33 or 0.66 μL of Quick Load Purple 1 kb Plus DNA Ladder (100 μg/mL; New England Biolabs; Ipswich, MA), except for Centropristis striata, for which lanes marked with an L contain 1 μL of Quick Load Purple 1 kb Plus DNA Ladder. Specimens are presented in the same order across all treatments. Dashes indicate empty lanes.

https://doi.org/10.1371/journal.pone.0321872.s003

(PDF)

S4 Fig. Raw gel images for S2 Fig.

DNA was extracted from tissues of six additional marine fish species that were thawed in EDTA (250 mM, pH 10; lanes 3–4) or ethanol (95%; lanes 5–6) overnight at 4°C or extracted directly from frozen tissues without subsequent liquid preservative treatment (lanes 1–2) from two randomly selected specimens of each species. Lanes marked with an L contain 0.66 μL of Quick Load Purple 1 kb Plus DNA Ladder (100 μg/mL; New England Biolabs; Ipswich, MA). Specimens are presented in the same order across all treatments.

https://doi.org/10.1371/journal.pone.0321872.s004

(PDF)

S1 Table. Specimen information.

Taxonomic, source, collection, and storage information as well as Ocean Genome Legacy (OGL) catalog and NCBI accession numbers are presented for specimens of 16 marine fish and invertebrate species. N/a indicates samples for which NCBI accession numbers were not assigned due to sequencing failures.

https://doi.org/10.1371/journal.pone.0321872.s005

(PDF)

S2 Table. Supporting data.

Supporting data are presented for DNA extracts of tissues from specimens of 16 marine fish and invertebrate species that were thawed in EDTA (250 mM, pH 10) or ethanol (95%) overnight at 4°C or extracted directly from frozen tissues without subsequent liquid preservative treatment. Specifically, species, sample ID, specimen and replicate numbers, treatments, initial and post-treatment sample weights, correction ratios, measured and corrected weights of tissue subsamples used for DNA extraction, A₂₆₀, A₂₆₀/A₂₈₀ ratios, and A₂₆₀/A₂₃₀ ratios calculated using the Nanodrop 1000 droplet spectrophotometer, total and low molecular weight (150 bp–10kb) DNA concentration values determined by the Agilent Tapestation DNA Analyzer 2200, percentages of low molecular weight (%LMW) and high molecular weight (%HMW) DNA and nY calculated based on Tapestation data, as well as mitochondrial COI PCR amplification and sequencing success are presented for each DNA sample analyzed in this study. N/a indicates samples for which data were not collected.

https://doi.org/10.1371/journal.pone.0321872.s006

(PDF)

Acknowledgments

We thank Bob and Eileen Matz, the Comb family, Emily Condon and the Northeastern University co-op program, the Northeastern University Marine Science Center community, and the many others who have supported the Ocean Genome Legacy Center at Northeastern University. We would also like to thank the Connecticut Department of Energy and Environmental Protection, the National Oceanic and Atmospheric Administration Fisheries, and the Grabowski lab at Northeastern University for donating specimens used in this study.

References

1. Blom MPK. Opportunities and challenges for high-quality biodiversity tissue archives in the age of long-read sequencing. Mol Ecol. 2021;30(23):5935–48. pmid:33786900
- View Article
- PubMed/NCBI
- Google Scholar
2. Card D, Shapiro B, Giribet G, Moritz C, Edwards S. Museum genomics. Annu Rev Genet. 2021;55:633–59.
- View Article
- Google Scholar
3. Minich JJ, Moore ML, Allsing NA, Aylward A, Murray ER, Tran L, et al. Generating high-quality plant and fish reference genomes from field-collected specimens by optimizing preservation. Commun Biol. 2023;6(1):1246. pmid:38071270
- View Article
- PubMed/NCBI
- Google Scholar
4. Phillips CD, Dunnum JL, Dowler RC, Bradley LC, Garner HJ, MacDonald KA, et al. Curatorial guidelines and standards of the American Society of Mammalogists for collections of genetic resources. J Mammalogy. 2019;100(5):1690–4.
- View Article
- Google Scholar
5. Zimkus BM, Ford LS. Best practices for genetic resources associated with natural history collections: Recommendations for practical implementation. Collection Forum. 2014;28(1–2):77–112.
- View Article
- Google Scholar
6. Jackson JA, Laikre L, Baker CS, Kendall KC. Guidelines for collecting and maintaining archives for genetic monitoring. Conservation Genet Resour. 2011;4(2):527–36.
- View Article
- Google Scholar
7. Zimkus BM, Ford LS, editors. Genetic resource collections associated with natural history museums: A survey and analysis to establish a benchmark of standards. DNA Banking for the 21st Century: Proceedings of the US Workshop on DNA Banking; 2014 2014-01: The William L. Bowen Center at the Missouri Botanical Garden.
8. Nagy ZT. A hands-on overview of tissue preservation methods for molecular genetic analyses. Org Divers Evol. 2010;10(1):91–105.
- View Article
- Google Scholar
9. Oosting T, Hilario E, Wellenreuther M, Ritchie PA. DNA degradation in fish: Practical solutions and guidelines to improve DNA preservation for genomic research. Ecol Evol. 2020;10(16):8643–51. pmid:32884647
- View Article
- PubMed/NCBI
- Google Scholar
10. Dahn HA, Mountcastle J, Balacco J, Winkler S, Bista I, Schmitt AD, et al. Benchmarking ultra-high molecular weight DNA preservation methods for long-read and long-range sequencing. Gigascience. 2022;11:giac068. pmid:35946988
- View Article
- PubMed/NCBI
- Google Scholar
11. Hanner R, Corthals A, Dessauer HC. Salvage of genetically valuable tissues following a freezer failure. Mol Phylogenet Evol. 2005;34(2):452–5. pmid:15619456
- View Article
- PubMed/NCBI
- Google Scholar
12. Wang TY, Wang L, Zhang JH, Dong WH. A simplified universal genomic DNA extraction protocol suitable for PCR. Genet Mol Res. 2011;10(1):519–25. pmid:21476197
- View Article
- PubMed/NCBI
- Google Scholar
13. Athanasio CG, Chipman JK, Viant MR, Mirbahai L. Optimisation of DNA extraction from the crustacean Daphnia. PeerJ. 2016;4:e2004. pmid:27190714
- View Article
- PubMed/NCBI
- Google Scholar
14. Fan H, Gulley ML. DNA extraction from fresh or frozen tissues. In: Killeen AA, editor. Mol Pathol Protoc. Totowa, NJ: Humana Press; 2001. p. 5–10.
15. Dessauer H, Cole C, Hafner M. Collection and storage of tissues. Mol Syst. 1996:29–47.
- View Article
- Google Scholar
16. Kilpatrick CW. Noncryogenic preservation of mammalian tissues for DNA extraction: an assessment of storage methods. Biochem Genet. 2002;40(1–2):53–62. pmid:11989787
- View Article
- PubMed/NCBI
- Google Scholar
17. DeSanctis ML, Soranno EA, Messner E, Wang Z, Turner EM, Falco R, et al. Greater than pH 8: The pH dependence of EDTA as a preservative of high molecular weight DNA in biological samples. PLoS One. 2023;18(1):e0280807. pmid:36689492
- View Article
- PubMed/NCBI
- Google Scholar
18. Sharpe A, Barrios S, Gayer S, Allan-Perkins E, Stein D, Appiah-Madson HJ, et al. DESS deconstructed: Is EDTA solely responsible for protection of high molecular weight DNA in this common tissue preservative? PLoS One. 2020;15(8):e0237356. pmid:32817618
- View Article
- PubMed/NCBI
- Google Scholar
19. Seutin G, White BN, Boag PT. Preservation of avian blood and tissue samples for DNA analyses. Can J Zool. 1991;69(1):82–90.
- View Article
- Google Scholar
20. Carvalhais LC, Dennis PG, Poudel A, Birt HWG, Bhuiyan SA, Card SD, et al. Simple solution to preserve plant samples for microbiome analyses. Mol Ecol Resour. 2022;22(3):1055–64. pmid:34695303
- View Article
- PubMed/NCBI
- Google Scholar
21. Dawson MN, Raskoff KA, Jacobs DK. Field preservation of marine invertebrate tissue for DNA analyses. Mol Mar Biol Biotechnol. 1998;7(2):145–52. pmid:11541322
- View Article
- PubMed/NCBI
- Google Scholar
22. Gaither MR, Szabó Z, Crepeau MW, Bird CE, Toonen RJ. Preservation of corals in salt-saturated DMSO buffer is superior to ethanol for PCR experiments. Coral Reefs. 2010;30(2):329–33.
- View Article
- Google Scholar
23. Gordeeva NV, Kobyliansky SG, Evseenko SA. A method for fixation of fish larvae for morphological and genetic studies. J Ichthyol. 2019;59(5):818–22.
- View Article
- Google Scholar
24. Lee KM, Adams M, Klassen JL. Evaluation of DESS as a storage medium for microbial community analysis. PeerJ. 2019;7:e6414. pmid:30740279
- View Article
- PubMed/NCBI
- Google Scholar
25. Michaud CL, Foran DR. Simplified field preservation of tissues for subsequent DNA analyses. J Forensic Sci. 2011;56(4):846–52. pmid:21480896
- View Article
- PubMed/NCBI
- Google Scholar
26. Mulcahy DG, Macdonald KS 3rd, Brady SG, Meyer C, Barker KB, Coddington J. Greater than X kb: a quantitative assessment of preservation conditions on genomic DNA quality, and a proposed standard for genome-quality DNA. PeerJ. 2016;4:e2528. pmid:27761327
- View Article
- PubMed/NCBI
- Google Scholar
27. Tatangelo V, Franzetti A, Gandolfi I, Bestetti G, Ambrosini R. Effect of preservation method on the assessment of bacterial community structure in soil and water samples. FEMS Microbiol Lett. 2014;356(1):32–8. pmid:24840085
- View Article
- PubMed/NCBI
- Google Scholar
28. Kolarevic A, Yancheva D, Kocic G, Smelcerovic A. Deoxyribonuclease inhibitors. Eur J Med Chem. 2014;88:101–11. pmid:25042005
- View Article
- PubMed/NCBI
- Google Scholar
29. Guéroult M, Picot D, Abi-Ghanem J, Hartmann B, Baaden M. How cations can assist DNase I in DNA binding and hydrolysis. PLoS Comput Biol. 2010;6(11):e1001000. pmid:21124947
- View Article
- PubMed/NCBI
- Google Scholar
30. Falco R, Appiah-Madson HJ, Distel DL. The Ocean Genome Legacy: a genomic resource repository for marine life. Biopreserv Biobank. 2022;20(1):104–6. pmid:35108094
- View Article
- PubMed/NCBI
- Google Scholar
31. Cicero C, Koo MS, Braker E, Abbott J, Bloom D, Campbell M, et al. Arctos: Community-driven innovations for managing natural and cultural history collections. PLoS One. 2024;19(5):e0296478. pmid:38820381
- View Article
- PubMed/NCBI
- Google Scholar
32. Wahltinez SJ, Stacy NI, Hadfield CA, Harms CA, Lewbart GA, Newton AL, et al. Perspective: Opportunities for advancing aquatic invertebrate welfare. Front Vet Sci. 2022;9:973376. pmid:36458054
- View Article
- PubMed/NCBI
- Google Scholar
33. Conte F, Voslarova E, Vecerek V, Elwood R, Coluccio P, Pugliese M. Humane slaughter of edible decapod crustaceans. Animals. 2021;11(4).
- View Article
- Google Scholar
34. RStudio Team. RStudio: Integrated development for R. Boston, MA: RStudio, PBC; 2020.
35. R Core Team. R: A language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing; 2021.
36. Wickham H, Averick M, Bryan J, Chang W, McGowan L, François R, et al. Welcome to the tidyverse. JOSS. 2019;4(43):1686.
- View Article
- Google Scholar
37. Dinno A. conover.test: conover-iman test of multiple comparisons using rank sums. 2024.
38. Graves S, Piepho H-P, Selzer L, Dorai-Raj S. multcompview: visualizations of paired comparisons. 2024.
39. Wilke CO. cowplot: Streamlined plot theme and plot annotations for ‘ggplot2’. 2024.
40. Wickham H. stringr: Simple, consistent wrappers for common string operations. 2023.
41. Kassambara A. rstatix: Pipe-friendly framework for basic statistical tests. 2023.
42. Hebert PDN, Ratnasingham S, deWaard JR. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc Biol Sci. 2003;270 Suppl 1(Suppl 1):S96-9. pmid:12952648
- View Article
- PubMed/NCBI
- Google Scholar
43. Handy SM, Deeds JR, Ivanova NV, Hebert PDN, Hanner RH, Ormos A, et al. A single-laboratory validated method for the generation of DNA barcodes for the identification of fish for regulatory compliance. J AOAC Int. 2011;94(1):201–10. pmid:21391497
- View Article
- PubMed/NCBI
- Google Scholar
44. Foottit RG, Maw HEL, Havill NP, Ahern RG, Montgomery ME. DNA barcodes to identify species and explore diversity in the Adelgidae (Insecta: Hemiptera: Aphidoidea). Mol Ecol Resour. 2009;9 Suppl s1:188–95. pmid:21564978
- View Article
- PubMed/NCBI
- Google Scholar
45. Sayers EW, Bolton EE, Brister JR, Canese K, Chan J, Comeau DC, et al. Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 2022;50(D1):D20–6. pmid:34850941
- View Article
- PubMed/NCBI
- Google Scholar
46. Corthals A, Desalle R. An application of tissue and DNA banking for genomics and conservation: the Ambrose Monell Cryo-Collection (AMCC). Syst Biol. 2005;54(5):819–23. pmid:16243765
- View Article
- PubMed/NCBI
- Google Scholar
47. Kelly R, Albert M, de Ladurantaye M, Moore M, Dokun O, Bartlett JMS. RNA and DNA integrity remain stable in frozen tissue after long-term storage at cryogenic temperatures: a report from the Ontario Tumour Bank. Biopreserv Biobank. 2019;17(4):282–7. pmid:30762427
- View Article
- PubMed/NCBI
- Google Scholar
48. Soniat TJ, Sihaloho HF, Stevens RD, Little TD, Phillips CD, Bradley RD. Temporal-dependent effects of DNA degradation on frozen tissues archived at −80°C. J Mammalogy. 2021;102(2):375–83.
- View Article
- Google Scholar

[ref1] 1. Blom MPK. Opportunities and challenges for high-quality biodiversity tissue archives in the age of long-read sequencing. Mol Ecol. 2021;30(23):5935–48. pmid:33786900
View Article
PubMed/NCBI
Google Scholar

[2] View Article

[3] PubMed/NCBI

[4] Google Scholar

[ref2] 2. Card D, Shapiro B, Giribet G, Moritz C, Edwards S. Museum genomics. Annu Rev Genet. 2021;55:633–59.
View Article
Google Scholar

[6] View Article

[7] Google Scholar

[ref3] 3. Minich JJ, Moore ML, Allsing NA, Aylward A, Murray ER, Tran L, et al. Generating high-quality plant and fish reference genomes from field-collected specimens by optimizing preservation. Commun Biol. 2023;6(1):1246. pmid:38071270
View Article
PubMed/NCBI
Google Scholar

[9] View Article

[10] PubMed/NCBI

[11] Google Scholar

[ref4] 4. Phillips CD, Dunnum JL, Dowler RC, Bradley LC, Garner HJ, MacDonald KA, et al. Curatorial guidelines and standards of the American Society of Mammalogists for collections of genetic resources. J Mammalogy. 2019;100(5):1690–4.
View Article
Google Scholar

[13] View Article

[14] Google Scholar

[ref5] 5. Zimkus BM, Ford LS. Best practices for genetic resources associated with natural history collections: Recommendations for practical implementation. Collection Forum. 2014;28(1–2):77–112.
View Article
Google Scholar

[16] View Article

[17] Google Scholar

[ref6] 6. Jackson JA, Laikre L, Baker CS, Kendall KC. Guidelines for collecting and maintaining archives for genetic monitoring. Conservation Genet Resour. 2011;4(2):527–36.
View Article
Google Scholar

[19] View Article

[20] Google Scholar

[ref7] 7. Zimkus BM, Ford LS, editors. Genetic resource collections associated with natural history museums: A survey and analysis to establish a benchmark of standards. DNA Banking for the 21st Century: Proceedings of the US Workshop on DNA Banking; 2014 2014-01: The William L. Bowen Center at the Missouri Botanical Garden.

[ref8] 8. Nagy ZT. A hands-on overview of tissue preservation methods for molecular genetic analyses. Org Divers Evol. 2010;10(1):91–105.
View Article
Google Scholar

[23] View Article

[24] Google Scholar

[ref9] 9. Oosting T, Hilario E, Wellenreuther M, Ritchie PA. DNA degradation in fish: Practical solutions and guidelines to improve DNA preservation for genomic research. Ecol Evol. 2020;10(16):8643–51. pmid:32884647
View Article
PubMed/NCBI
Google Scholar

[26] View Article

[27] PubMed/NCBI

[28] Google Scholar

[ref10] 10. Dahn HA, Mountcastle J, Balacco J, Winkler S, Bista I, Schmitt AD, et al. Benchmarking ultra-high molecular weight DNA preservation methods for long-read and long-range sequencing. Gigascience. 2022;11:giac068. pmid:35946988
View Article
PubMed/NCBI
Google Scholar

[30] View Article

[31] PubMed/NCBI

[32] Google Scholar

[ref11] 11. Hanner R, Corthals A, Dessauer HC. Salvage of genetically valuable tissues following a freezer failure. Mol Phylogenet Evol. 2005;34(2):452–5. pmid:15619456
View Article
PubMed/NCBI
Google Scholar

[34] View Article

[35] PubMed/NCBI

[36] Google Scholar

[ref12] 12. Wang TY, Wang L, Zhang JH, Dong WH. A simplified universal genomic DNA extraction protocol suitable for PCR. Genet Mol Res. 2011;10(1):519–25. pmid:21476197
View Article
PubMed/NCBI
Google Scholar

[38] View Article

[39] PubMed/NCBI

[40] Google Scholar

[ref13] 13. Athanasio CG, Chipman JK, Viant MR, Mirbahai L. Optimisation of DNA extraction from the crustacean Daphnia. PeerJ. 2016;4:e2004. pmid:27190714
View Article
PubMed/NCBI
Google Scholar

[42] View Article

[43] PubMed/NCBI

[44] Google Scholar

[ref14] 14. Fan H, Gulley ML. DNA extraction from fresh or frozen tissues. In: Killeen AA, editor. Mol Pathol Protoc. Totowa, NJ: Humana Press; 2001. p. 5–10.

[ref15] 15. Dessauer H, Cole C, Hafner M. Collection and storage of tissues. Mol Syst. 1996:29–47.
View Article
Google Scholar

[47] View Article

[48] Google Scholar

[ref16] 16. Kilpatrick CW. Noncryogenic preservation of mammalian tissues for DNA extraction: an assessment of storage methods. Biochem Genet. 2002;40(1–2):53–62. pmid:11989787
View Article
PubMed/NCBI
Google Scholar

[50] View Article

[51] PubMed/NCBI

[52] Google Scholar

[ref17] 17. DeSanctis ML, Soranno EA, Messner E, Wang Z, Turner EM, Falco R, et al. Greater than pH 8: The pH dependence of EDTA as a preservative of high molecular weight DNA in biological samples. PLoS One. 2023;18(1):e0280807. pmid:36689492
View Article
PubMed/NCBI
Google Scholar

[54] View Article

[55] PubMed/NCBI

[56] Google Scholar

[ref18] 18. Sharpe A, Barrios S, Gayer S, Allan-Perkins E, Stein D, Appiah-Madson HJ, et al. DESS deconstructed: Is EDTA solely responsible for protection of high molecular weight DNA in this common tissue preservative? PLoS One. 2020;15(8):e0237356. pmid:32817618
View Article
PubMed/NCBI
Google Scholar

[58] View Article

[59] PubMed/NCBI

[60] Google Scholar

[ref19] 19. Seutin G, White BN, Boag PT. Preservation of avian blood and tissue samples for DNA analyses. Can J Zool. 1991;69(1):82–90.
View Article
Google Scholar

[62] View Article

[63] Google Scholar

[ref20] 20. Carvalhais LC, Dennis PG, Poudel A, Birt HWG, Bhuiyan SA, Card SD, et al. Simple solution to preserve plant samples for microbiome analyses. Mol Ecol Resour. 2022;22(3):1055–64. pmid:34695303
View Article
PubMed/NCBI
Google Scholar

[65] View Article

[66] PubMed/NCBI

[67] Google Scholar

[ref21] 21. Dawson MN, Raskoff KA, Jacobs DK. Field preservation of marine invertebrate tissue for DNA analyses. Mol Mar Biol Biotechnol. 1998;7(2):145–52. pmid:11541322
View Article
PubMed/NCBI
Google Scholar

[69] View Article

[70] PubMed/NCBI

[71] Google Scholar

[ref22] 22. Gaither MR, Szabó Z, Crepeau MW, Bird CE, Toonen RJ. Preservation of corals in salt-saturated DMSO buffer is superior to ethanol for PCR experiments. Coral Reefs. 2010;30(2):329–33.
View Article
Google Scholar

[73] View Article

[74] Google Scholar

[ref23] 23. Gordeeva NV, Kobyliansky SG, Evseenko SA. A method for fixation of fish larvae for morphological and genetic studies. J Ichthyol. 2019;59(5):818–22.
View Article
Google Scholar

[76] View Article

[77] Google Scholar

[ref24] 24. Lee KM, Adams M, Klassen JL. Evaluation of DESS as a storage medium for microbial community analysis. PeerJ. 2019;7:e6414. pmid:30740279
View Article
PubMed/NCBI
Google Scholar

[79] View Article

[80] PubMed/NCBI

[81] Google Scholar

[ref25] 25. Michaud CL, Foran DR. Simplified field preservation of tissues for subsequent DNA analyses. J Forensic Sci. 2011;56(4):846–52. pmid:21480896
View Article
PubMed/NCBI
Google Scholar

[83] View Article

[84] PubMed/NCBI

[85] Google Scholar

[ref26] 26. Mulcahy DG, Macdonald KS 3rd, Brady SG, Meyer C, Barker KB, Coddington J. Greater than X kb: a quantitative assessment of preservation conditions on genomic DNA quality, and a proposed standard for genome-quality DNA. PeerJ. 2016;4:e2528. pmid:27761327
View Article
PubMed/NCBI
Google Scholar

[87] View Article

[88] PubMed/NCBI

[89] Google Scholar

[ref27] 27. Tatangelo V, Franzetti A, Gandolfi I, Bestetti G, Ambrosini R. Effect of preservation method on the assessment of bacterial community structure in soil and water samples. FEMS Microbiol Lett. 2014;356(1):32–8. pmid:24840085
View Article
PubMed/NCBI
Google Scholar

[91] View Article

[92] PubMed/NCBI

[93] Google Scholar

[ref28] 28. Kolarevic A, Yancheva D, Kocic G, Smelcerovic A. Deoxyribonuclease inhibitors. Eur J Med Chem. 2014;88:101–11. pmid:25042005
View Article
PubMed/NCBI
Google Scholar

[95] View Article

[96] PubMed/NCBI

[97] Google Scholar

[ref29] 29. Guéroult M, Picot D, Abi-Ghanem J, Hartmann B, Baaden M. How cations can assist DNase I in DNA binding and hydrolysis. PLoS Comput Biol. 2010;6(11):e1001000. pmid:21124947
View Article
PubMed/NCBI
Google Scholar

[99] View Article

[100] PubMed/NCBI

[101] Google Scholar

[ref30] 30. Falco R, Appiah-Madson HJ, Distel DL. The Ocean Genome Legacy: a genomic resource repository for marine life. Biopreserv Biobank. 2022;20(1):104–6. pmid:35108094
View Article
PubMed/NCBI
Google Scholar

[103] View Article

[104] PubMed/NCBI

[105] Google Scholar

[ref31] 31. Cicero C, Koo MS, Braker E, Abbott J, Bloom D, Campbell M, et al. Arctos: Community-driven innovations for managing natural and cultural history collections. PLoS One. 2024;19(5):e0296478. pmid:38820381
View Article
PubMed/NCBI
Google Scholar

[107] View Article

[108] PubMed/NCBI

[109] Google Scholar

[ref32] 32. Wahltinez SJ, Stacy NI, Hadfield CA, Harms CA, Lewbart GA, Newton AL, et al. Perspective: Opportunities for advancing aquatic invertebrate welfare. Front Vet Sci. 2022;9:973376. pmid:36458054
View Article
PubMed/NCBI
Google Scholar

[111] View Article

[112] PubMed/NCBI

[113] Google Scholar

[ref33] 33. Conte F, Voslarova E, Vecerek V, Elwood R, Coluccio P, Pugliese M. Humane slaughter of edible decapod crustaceans. Animals. 2021;11(4).
View Article
Google Scholar

[115] View Article

[116] Google Scholar

[ref34] 34. RStudio Team. RStudio: Integrated development for R. Boston, MA: RStudio, PBC; 2020.

[ref35] 35. R Core Team. R: A language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing; 2021.

[ref36] 36. Wickham H, Averick M, Bryan J, Chang W, McGowan L, François R, et al. Welcome to the tidyverse. JOSS. 2019;4(43):1686.
View Article
Google Scholar

[120] View Article

[121] Google Scholar

[ref37] 37. Dinno A. conover.test: conover-iman test of multiple comparisons using rank sums. 2024.

[ref38] 38. Graves S, Piepho H-P, Selzer L, Dorai-Raj S. multcompview: visualizations of paired comparisons. 2024.

[ref39] 39. Wilke CO. cowplot: Streamlined plot theme and plot annotations for ‘ggplot2’. 2024.

[ref40] 40. Wickham H. stringr: Simple, consistent wrappers for common string operations. 2023.

[ref41] 41. Kassambara A. rstatix: Pipe-friendly framework for basic statistical tests. 2023.

[ref42] 42. Hebert PDN, Ratnasingham S, deWaard JR. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc Biol Sci. 2003;270 Suppl 1(Suppl 1):S96-9. pmid:12952648
View Article
PubMed/NCBI
Google Scholar

[128] View Article

[129] PubMed/NCBI

[130] Google Scholar

[ref43] 43. Handy SM, Deeds JR, Ivanova NV, Hebert PDN, Hanner RH, Ormos A, et al. A single-laboratory validated method for the generation of DNA barcodes for the identification of fish for regulatory compliance. J AOAC Int. 2011;94(1):201–10. pmid:21391497
View Article
PubMed/NCBI
Google Scholar

[132] View Article

[133] PubMed/NCBI

[134] Google Scholar

[ref44] 44. Foottit RG, Maw HEL, Havill NP, Ahern RG, Montgomery ME. DNA barcodes to identify species and explore diversity in the Adelgidae (Insecta: Hemiptera: Aphidoidea). Mol Ecol Resour. 2009;9 Suppl s1:188–95. pmid:21564978
View Article
PubMed/NCBI
Google Scholar

[136] View Article

[137] PubMed/NCBI

[138] Google Scholar

[ref45] 45. Sayers EW, Bolton EE, Brister JR, Canese K, Chan J, Comeau DC, et al. Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 2022;50(D1):D20–6. pmid:34850941
View Article
PubMed/NCBI
Google Scholar

[140] View Article

[141] PubMed/NCBI

[142] Google Scholar

[ref46] 46. Corthals A, Desalle R. An application of tissue and DNA banking for genomics and conservation: the Ambrose Monell Cryo-Collection (AMCC). Syst Biol. 2005;54(5):819–23. pmid:16243765
View Article
PubMed/NCBI
Google Scholar

[144] View Article

[145] PubMed/NCBI

[146] Google Scholar

[ref47] 47. Kelly R, Albert M, de Ladurantaye M, Moore M, Dokun O, Bartlett JMS. RNA and DNA integrity remain stable in frozen tissue after long-term storage at cryogenic temperatures: a report from the Ontario Tumour Bank. Biopreserv Biobank. 2019;17(4):282–7. pmid:30762427
View Article
PubMed/NCBI
Google Scholar

[148] View Article

[149] PubMed/NCBI

[150] Google Scholar

[ref48] 48. Soniat TJ, Sihaloho HF, Stevens RD, Little TD, Phillips CD, Bradley RD. Temporal-dependent effects of DNA degradation on frozen tissues archived at −80°C. J Mammalogy. 2021;102(2):375–83.
View Article
Google Scholar

[152] View Article

[153] Google Scholar

Figures

Abstract

Introduction

Materials and methods

Ethics statement

Specimen selection, storage, and sampling

Tissue handling and DNA extraction

DNA analysis

PCR amplification and DNA sequencing

Results

Effect of treatments on %HMW

Effect of treatments on nY

Qualitative DNA analyses

PCR amplification and DNA sequencing

Discussion

Supporting information

S1 Fig. Visualization of DNA extracts by gel electrophoresis for 10 marine species.

S2 Fig. Qualitative visualization of DNA extracts from six additional fish species by gel electrophoresis.

S3 Fig. Raw gel images for S1 Fig.

S4 Fig. Raw gel images for S2 Fig.

S1 Table. Specimen information.

S2 Table. Supporting data.

Acknowledgments

References