Phylogenetic analysis

For the phylogenetic analysis the SRS/SHI/STY genes previously reported for Arabidopsis thaliana [23], Glycine max [16], Medicago truncatula [10], Lotus japonicus [15] and Phaseolus vulgaris [19] were included.

Gene sequences translated protein sequences and RNA-seq gene expression data of SRS TFs for each plant species were retrieved from the following databases. For A. thaliana: The Arabidopsis Information Resource TAIR (https://www.arabidopsis.org); for P. vulgaris: the Gene Expression Atlas (GEA), (Pv GEA (https://www.zhaolab.org/PvGEA/) [20]; for G. max the ePlant BAR page (http://bar.utoronto.ca/eplant_soybean/) [24], for M. truncatula (https://phytozome-next.jgi.doe.gov/) and for L. japonicus the Lotus Base (https://lotus.au.dk/).

The protein sequences from SRS genes were analyzed in InterPro (http://www.ebi.ac.uk/interpro/) to confirm the presence of two characteristic domains from this gene family: Znf_LRP1 and SHI_C [11,12]. The whole set of 60 SRS protein sequences from Arabidopsis and four legume species used for phylogenetic analysis are listed in (S1 Table). MUSCLE [25] was used for multiple sequence alignment of the given protein sequences; the alignment was used to construct the phylogenetic tree by MEGA 7 software [26] and the neighbor-joining method with the bootstrap test replicated 1,000 times. Finally, Interactive Life Tree (iTOL, https://itol.embl.de/index.shtml/) was used for the phylogenetic tree visualization.

Plant material, growth conditions and bacterial strains

The common bean (P. vulgaris) Mesoamerican cv BAT93 was used in this work [27]. Seeds were surface sterilized and germinated as previously reported [22]. Germinated seedlings were planted in pots with wet sterile perlite and were grown in growth chambers under controlled environmental conditions (25–28°C, 16 h photoperiod, 60% humidity). For SNF conditions, plantlets were inoculated with 1 ml saturated liquid culture of R. etli CE3 per plant and were watered every 3 days with N-free B&D nutrient solution [28]. For non-inoculated conditions, a full nutrient B&D solution (5 mM N-content) was used to water the plants. Common bean composite plants with transgenic roots were generated through Agrobacterium rhizogenes K599 genetic transformation, as described below. The growth conditions of composite plants were like those described for wild-type plants.

Nicotiana benthamiana L. plants, used for PvSRS10 promoter expression analysis, were grown in pots with peat moss: vermiculite (1:3), under greenhouse conditions at 16h photoperiod and watered with B & D nutrient solution [28]. Agrobacterium tumefaciens strain GV3101 was used for co-infiltration of N. benthamiana leaves.

RNA isolation and quantitative RT-PCR analysis

Total RNA was isolated from frozen tissues collected directly into liquid nitrogen and stored at −80°C using the Plant/Fungi Total RNA Purification Kit according to the manufacturer’s instructions (Norgen Biotek Corp., Thorold, ON, Canada). Total RNA was quantified using the Nanodrop spectrophotometer (Thermo Fischer Scientific, Inc., Waltham, MA, USA). For quantification of transcripts, total RNA (1 µg) was treated with DNaseI RNase-free (Thermo Fischer Scientific, Inc., Waltham, MA, USA) to remove genomic DNA. First, strand cDNA was synthesized using Revert Aid H Minus First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA). The resulting cDNAs were then diluted (1:40) and used to perform qRT-PCR assays using SYBR Green PCR Master Mix (2X) (Thermo Fischer Scientific, Inc., Waltham, MA, USA), following the manufacturer’s instructions. The sequences of oligonucleotide primers used for qRT-PCR of each gene and for the three housekeeping genes HSP, MDH and UBQ9 [29] are provided at (S2 Table). Assays were run in 96-well plates using the 7300 Real-Time PCR System and 7300 System Software (Applied Biosystems, Foster City, CA, USA) with settings of 50^°C for 2 min, 95°C for 10 min, and 40 cycles of 95°C for 15 s and 57°C for 60 s. The efficiency of the RT-qPCRs was confirmed using a standard curve for each primer evaluated. Finally, the relative expression was calculated by the “comparative Ct method”. Student’s t-test was performed to evaluate the significance of the differential expression using the mean values from three biological replicates and three technical replicates for each condition, using the GraphPad Prismv8.0 for Windows (GraphPad Software, San Diego, CA, USA).

Identification of putative cis-regulatory elements in promoter regions

Up to 4 Kb of the DNA sequence from the promoter region, immediately upstream of the initiation codon of each analyzed gene, was retrieved from Phytozome v12.1 (https://phytozome.jgi.doe.gov/pz/portal.html). The Clover (Cis-eLement OVERrepresentation) tool (https://bu.wenglab.org/clover/) [30], was used to identify over-represented significant motifs in each DNA sequence, using precompiled JASPAR (https://jaspar.elixir.no/) motifs. Clover analyses were conducted using default parameters.

The enrichment of AGL or NF-YA transcription factors binding sites was analyzed for the promoter region of each PvSRS gene.

The raw score represents the probability that the motif incidence score is equal to or greater than the user-defined threshold of 6. A p-value threshold of 0.05 was applied. Therefore, each motif with a raw score above 6 having a p-value below 0.05 are considered statistically overrepresented [30].

Plasmid construction and evaluation of transcriptional activation of PvSRS10 by agroinfiltration of tobacco leaves

To evaluate the transcriptional activation of the PvSRS10 (Phvul. 011G206400) promoter activity, one reporter and two effector plasmids were constructed. For the reporter plasmid, bearing the PvSRS10 gene promoter fused to the GPF/GUS fused reporter genes, a 2,001 bp DNA fragment upstream of the PvSRS10 start codon, was amplified from P. vulgaris genomic DNA using the specific primers Up-pPvSRS10 5´- CACCTTTTAAGTGAGCCAAAT and Lw-pPvSRS10 5´- TGGAACAACAACAAGGTTTT -3´. The amplified fragment was then cloned into the pENTR/D-TOPO (Thermo Fisher Scientific, Inc., Waltham, MA, USA) vector. The pENTR-pSRS10 plasmid was subsequently recombined by Gateway® LR Clonase™ II Enzyme Mix (Invitrogen, Waltham, MA, USA) into the pBGWFS7 destination vector containing the DNA fragment coding for green fluorescent protein (GFP)/b-glucuronidase (GUS) [31]. The resulting reporter plasmid (pSRS10/GFP) contained the PvSRS10 promoter upstream of the GUS-GFP gene fusion.

For the effector construct with overexpression of TF PvNF-YA1 gene (Phvul.001G196800), its coding sequence (CDS) was PCR-amplified using as template cDNA from common bean roots and the specific primers Up-PvNF-YA1 5´- CACCATGGCGATGCA-3´ and Lw-PvNF-YA1 5´- TTGATTCTTTGCTAGTCAAACTTT-3´ and the purified PCR product (993 bp) was cloned into the pENTR/D-TOPO vector. Subsequently the PvNF-YA1 CDS region was recombined by Gateway system into the pTDTO plasmid bearing the 35S cauliflower mosaic virus (35SCaMV) promoter and the tdTomato (red fluorescent protein) reporter gene [32]. The resulting effector vector, OE/NF-YA1, contained the 35S promoter upstream of the PvNF-YA1/tdTomato chimeric gene. The effector plasmid with overexpression of the TF MADS-box gene: PvFUL-like (Phvul.008G027800) from the 35S promoter (OE/FUL), was previously reported [22]. Every construct was verified by DNA sequencing.

The Nicotiana benthamiana leaves infiltration method [33], was used for the evaluation of the transcriptional regulation of PvSRS10 gene. The empty vector (EV) used for plasmids construction (pTDTO) as well as the pSRS10/GFP, RFP_OE/NF-YA; RFP_OE/FUL were introduced, by electroporation, into Agrobacterium tumefaciens strain GV3101. For co/infiltration the resulting A. tumefaciens strains were used in a 1:1 ratio in 4-week-old N. benthamiana leaves. Five days after infiltration, the transiently transformed N. benthamiana leaves were inspected by inverted confocal laser scanning microscope FV1000 (with a 40_/NA 0.75 dry objective) using the following conditions (Excitation λ= 488 nm, Emission λ= 520 nm). The images were processed using Image J analysis software (Fiji Is Just Image J1), [34].

Plant transformation and generation of composite plants

The plasmids for overexpressing (OE/FUL) or silencing (RNAi_AGL) TF PvAGL genes, as well as the EV used for these constructions, have been reported [22]. These plasmids were introduced by electroporation into Agrobacterium rhizogenes K599, which was then used for plant transformation as described [35] with minor modifications [32]. In addition, the presence of red fluorescence from the tdTomato reporter gene was routinely checked in the putative transgenic roots/nodules using a fluorescence stereomicroscope.

Protein interaction network

Protein-protein interactions (PPIs) were analyzed using STRING database (http://string-db.org/) [36]. The analysis was performed to identify and predict functional associations between proteins. The target proteins, PvSRS5 and PvSRS6, were selected based on its high expression in nodules in early stages of symbiosis, which is related to greater auxin synthesis and cell division that guarantees the development of nodules and colonization by rhizobia.

Statistical analyses

The graphs were generated using the ggplot2 library with RStudio (v1.4.1106) or GraphPad Prism 9. The specific statistical tests performed are indicated in the legend of the corresponding figures. Raw data used for statistical analysis for Figs 2 and 4 are provided in two separate sheets of S3 Table.

Evolutionary relationships of the SRS TFs in Arabidopsis and legume plants

The SRS TF family is only present in plants and the number of family members varies in different plant species. In this work we carried out a phylogenetic analysis of SRS TFs from 5 different plant species, including the model plant Arabidopsis thaliana (Arabidopsis) and 4 legume plants. The latter included the two model legumes: Lotus japonicus (Lotus) and Medicago truncatula (Medicago), Phaseolus vulgaris (common bean) which is the species analyzed in this work and the most important legume for human consumption worldwide [8,9] and Glycine max (soybean), a very important legume crop closely related to common bean [37]. The protein sequences encoded by SRS genes were previously identified, but for our analysis we verified each protein for the presence of the two characteristic domains from this gene family: the Znf_LRP1 and SHI_C domains. On this basis, we excluded from our analysis the proteins that lack the characteristic domains, encoded by AT1G32730 (AtSRS11) gene from Arabidopsis and by Medtr4g099070 gene from Medicago [13,16]. Consequently, for the maximum likelihood phylogenetic tree depicted in (Fig 1) we analyzed a set of 60 SRS protein sequences (S1 Table) that included 10 SRS proteins for Arabidopsis [23], 9 for Lotus [15], 10 for Medicago [13], 21 for soybean [16] and 10 for common bean [19].

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. The phylogenetic relationship between 60 SRS proteins from Phaseolus vulgaris (10, blue), Glycine max (21, black), Medicago truncatula (10, red), Lotus japonicus (9, green) and Arabidopsis thaliana (10, ocher).

The unrooted tree was constructed using full-length protein sequences that are reported in S1 Table. Bootstrap values greater than 80 are presented at the corresponding node. The pink box highlights clades grouping genes from Arabidopsis and legumes, that share high expression in roots or in roots and nodules.

https://doi.org/10.1371/journal.pone.0321784.g001

Clades that interested us, because of the objective of this work, are highlighted in (Fig 1). These include two Arabidopsis proteins from the SRS TF family (LPR1 and SRS6) and several legume SRS proteins. LRP1 is highly expressed in all stages of lateral root development, participating in auxin response modules to regulate lateral root development and auxin homeostasis in Arabidopsis [38]. Interestingly, legume genes grouped in these clades are known to be highly expressed during root and nodule development, mainly LjSTY4, LjSTY7, and LjSTY9 [15], GmSRS9, GmSRS14, and GmSRS21 [16], as well as Medtr3g014660 and Medtr5g089750 (https://bar.utoronto.ca/eplant_medicago/). The SRS

proteins from Medicago and Arabidopsis, lacking characteristic SRS domains, that we excluded from our phylogeny did not group in root/nodule clade highlighted in Fig 1.

Contrastingly, other Arabidopsis genes not associated with these clades have acquired different functions. For example, At3G51060/STY1 and At1G19790/SRS7, show their highest expression during flower development, regulating the development of specific tissues such as the stigma and carpels [39].

Expression analysis of PvSRS genes in root and nodules of SNF plants

Transcriptomic data from P. vulgaris cv. Negro jamapa inoculated with Rhizobium tropici [20] revealed that all PvSRS genes are expressed in inoculated roots and nodules, though at varying levels. In this study, we carried out a qRT-PCR analysis to evaluate the expression level of each PvSRS gene in roots and nodules of common bean BAT93 plants inoculated with R. etli CE3 at different stages of symbiosis as compared to uninoculated or N-fertilized roots. We followed the PvSRS gene nomenclature previously reported [19].

As shown in (Fig 2), all PvSRS genes are expressed in inoculated roots and nodules, albeit at different levels. Notably PvSRS4, PvSRS5, PvSRS6 and PvSRS10 exhibited higher

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. Expression analysis of common bean PvSRS genes in roots and nodules.

Expression levels were determined in uninoculated (UN) roots (black) collected 3 days after germination and in inoculated roots (brown), or nodules (red) harvested at the indicated time points, corresponding to days post-inoculation of P. vulgaris BAT93 plants inoculated with R. etli. Expression levels refer to gene expression, based on the Ct value, normalized with the expression of housekeeping genes. (HSP, MDH and UBQ9). The name assigned to each P. vulgaris SRS gene corresponded to those from [19]. The gene IDs are shown in Supplementary S1 Table. Values from each timepoint for each gene were statistically analyzed by Student’s t-test. In each case, different lowercase letters indicate significantly different values from roots vs. nodules (p-value < 0.05).

https://doi.org/10.1371/journal.pone.0321784.g002

expression levels in inoculated roots and nodules compared to the extremely low level in uninoculated roots (Fig 2). PvSRS1, PvSRS2, PvSRS3 and PvSRS8 showed lower expression levels in inoculated roots and nodules, ranging from 2-fold to 26-fold lower as compared to the highly expressed genes. PvSRS7 and PvSRS9 showed much higher expression level in uninoculated roots, thus suggesting their relevant participation in root development rather than in SNF (Fig 2). PvSRS4 expression was highest in inoculated roots at early symbiotic stages (10–15 dpi) (Fig 2). PvRSR6 was highly expressed in immature (10–15 dpi) nodules (Fig 2). PvSRS2 and PvSRS3 showed high expression in both mature and immature nodules, PvSRS8 and PvSRS10 showed higher expression in mature nodules (22 dpi) and PvSRS5 showed its highest expression in mature and senescent nodules (22–35 dpi) (Fig 2). These results suggest potentially important regulatory roles of PvRSR5 and PvSRS6 during early nodule development and PvSRS5 also in mature nodules (Fig 2). PvSRS10 reaches the highest expression level in inoculate roots and nodules as compared to every other PvSRS gene, thus pointing to its relevant participation in the symbiotic process (Fig 2). These results point to the participation of all the members of PvSRS TF family in different stages of the common bean N-fixing symbiosis, perhaps except for PvSRS7 and PvSRS9.

Our qRT-PCR expression level data (Fig 2) are consistent with those previously reported [19] obtained from RNA-seq analysis (S1 Fig). The slight differences observed between two sets of data (S1 Fig) may be due to a different common bean genotype used in each study and the developmental state of nodules (days post inoculation), something that was not informed in the previous work [19].

Transcriptional activation of PvSRS10 gene by NF-Y TF

As previously shown for nodule development of Lotus [15,21], the regulation of STY TF is associated with an NF-Y-dependent regulatory cascade. In this cascade, STY genes are direct targets of NF-Y TF and, in turn, activate the transcription of YUCCA1 and YUCCA11, that are responsible for local auxin biosynthesis during the cell division phase. In this work we investigated if, similarly, the common bean PvSRS genes transcription is activated by NF-Y TF.

First, we looked for NF-Y TF binding sites, the so-called CCAAT box [40], in the promoter region of every PvSRS gene. Using the Clover tool [30] we identified significantly over-represented motifs for NF-Y TF binding distributed across every PvSRS gene promoter, appearing from 1 to 6 times in each gene (S4 Table). The PvSRS3, PvSRS5 and PvSRS10 gene promoters showed a higher frequency of NF-Y TF binding motifs (S4 Table). These PvSRS genes showed a similar expression profile with the highest expression in mature nodules, though the expression level of PvSRS3 was lower (Fig 2).

The significant over-representation of motifs recognized by NF-Y TF in every PvRSR gene promoter (S4 Table), prompted us to experimentally demonstrate in planta transcriptional activation of PvSRS by PvNF-Y TF. For this, we selected the PvSRS10 gene, that showed the highest expression in roots and nodules (Fig 2) and the system of agroinfiltration of Nicotiana benthamiana leaves to evaluate transient gene expression [33]. This system has been widely used for the in planta transient expression of heterologous genes and gene product detection. As a higher plant N. benthamiana shares common cellular compartmentalization, cofactors and coenzymes with other plants, thereby easily enabling heterologous plant gene expression and protein function [41].

To promote transcriptional activation/repression the plant NF-Y TF act as heterotrimers (NF-YA/B/C) [42,43]. The NF-YA subunits from different plant species have high primary sequence homology [44]. The NF-YA subunit is localized to nucleus, and it has a domain with two important regions: one for interaction with the other NF-Y subunits and another for DNA-binding that recognizes CCAAT-box from promoters of target genes [44]. Whereas in animals each NF-Y subunit is encoded by a single gene, structural and functional diversification has occurred in plants, leading to the emergence of gene families comprising between eight and 39 members for each subunit [44]. In Medicago, the NF-YA1/2, NF-YB16/18 and NY-YC1/2 subunits are highly expressed in nodule tissues and regulate the expression of relevant symbiotic genes [45]. Boudin et al., (2015) clearly demonstrated the interaction of NF-YA, B and C symbiotic subunits by co-expressing their coding genes in N. benthamiana leaves and using co-immunoprecipitation and bimolecular fluorescence complementation approaches to identify the transiently expressed proteins and their interaction. In addition, the formation of stable NF-Y trimer with common bean PvNF/Y subunits, encoded by PvNF-YA1, PvNF-YB7 and PvNF-YC1 that are orthologs of Medicago symbiotic NF-Ys and participate in SNF [46], was demonstrated [45]. Previous work has shown that the interaction specificity between NF-YA, B and C subunits is weak both in Arabidopsis [43,45,47,48] and in Medicago where, with the exception of two subunits, all the MtNF-YB subunits can interact with MtNF-YC1 and MtNF-YC2 in planta, something that is independent of their sequence similarity or their expression in different paly tissues [45].

The current model for assembling of the heterotrimeric NF-Y complex proposes that the other two subunits (NF-YB and NF-YC) interact in the cytoplasm and subsequently the heterodimer is translocated into the nucleus where it couples with the NF-YA subunit to form the heterotrimeric protein [49]. The subcellular localization of Medicago NF-Y subunits expressed in N. benthamiana revealed the strict localization of MtNF-YA1/2 to the nucleus while MtNF-YB16 and MtNF-YC1/2 was localized to both the nucleus and the cytoplasm [45].

On this basis, to test the proposed transcriptional activation of PvSRS10 by PvNF-Y TF we co-infiltrated N. benthamiana leaves with an effector vector overexpressing the PvNF-YA1 together with a reporter vector bearing a chimeric gene with the PvSRS10 promoter fused to the GFP reporter gene, as well as appropriate controls. N. benthamiana leaves were examined by confocal microscopy for the observation of synthesized reporter fluorescent proteins, product of transient expression of the reporter gene.

The efficiency of the technique used was confirmed by visualizing the red fluorescence in N. benthamiana leaves agroinfiltrated with only the pTDTO empty vector S2A Fig or each one of the effector plasmids S2B and S2C Fig. In each case the red fluorescence, derived from the constitutive expression of the tDTomato gene present in the plasmid backbone, was clearly observed. Similarly, only the red fluorescence was visible in leaves co-infiltrated with each of the effector plasmids plus the empty vector pBGWFS7, bearing the GFP without any cloned promoter S2D and S2E Fig. In addition, leaves infiltrated with only the empty vector pBGWFS7 S2F Fig or only the reporter plasmid S2G Fig, showed no fluorescence, thus indicating that the PvSRS10 gene promoter was not expressed by endogenous TF. Leaves co-infiltrated with the empty vector pTDTO plus the reporter plasmid only showed red fluorescence and no green fluorescence was visible (Fig 3A).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. Transcriptional activation of PvSRS10 gene promoter by PvNF-YA1 and PvFUL (AGL) TFs.

Nicotiana benthamiana leaves were infiltrated with Agrobacterium tumefaciens carrying different constructs and, after five days, these were analyzed by confocal microscopy using the green fluorescence channel (upper panels), the red fluorescent channel (middle panels) or the bright field (lower panels). A: Co-infiltration of pTDTO (empty vector) plus the reporter plasmid: pSRS10/GFP. B: Co-infiltration of the effector plasmid: RFP_OE/NF-YA1 plus the reporter plasmid: pSRS10/GFP. C: Co-infiltration of the effector plasmid RFP_OE/FUL plus the reporter plasmid: pSRS10/GFP.

https://doi.org/10.1371/journal.pone.0321784.g003

Contrastingly, the leaves co-infiltrated with the reporter plus the effector plasmid overexpressing PvNF-YA1 showed clear green fluorescence (Fig 3B). Our interpretation of this result is that, in co-infiltrated leaves, the heterologous NF-YB and NF-YC subunits from N. benthamiana interacted and functioned effectively with the PvNF-YA subunit. Recent transcriptomic data from different tissues of N. benthamiana plants [50] show the high level of gene expression of 3 NbNF-YB genes and 3 NbNF-YC genes in mature leaves (S5 Table), something that supports our interpretation.

Does PvFUL-like TF, from the MADS-Domain/AGL family, activate transcription of the PvSRS10 gene?

Previous work from our group [22] showed the relevant participation of common bean MADS/AGL TF in the regulation of the N-fixing symbiosis with rhizobia. This is a large TF family that controls the development of almost every plant organ in a variety of plant species. The common bean genome encodes for 93 PvAGL genes, 16 of these are expressed in roots and nodules, being the PvFUL-like gene – orthologous to the AGL8 or FUL gene from Arabidopsis [51] - the one with highest expression during symbiosis. Phylogenetic analysis revealed clades that grouped the AGL proteins highly expressed in Arabidopsis roots and in legume roots and nodules [22]. Using reverse genetic approach: symbiosis phenotypic analysis of common bean plants with transgenic root/nodules modulated -silencing or over-expression- in PvFUL-like expression level, we demonstrated the participation of this TF in root architecture, rhizobial symbiotic infection, the expression of known early symbiotic genes, nodulation, nitrogenase activity in nodules and the AON (Autoregulation Of Nodulation) process [22]. Since in our previous work [22] we did not identify transcriptional target symbiotic genes for PvAGL TF, our current research includes projects aiming to identify such targets and their participation in symbiotic regulatory cascades. On this basis, one of the objectives of the present work was to investigate if the PvSRS genes that are expressed during the SNF (Fig 2), are transcriptionally regulated by PvAGL TF, besides their regulation by NF/Y TFs.

On this basis, using the Clover tool [30], we searched for significantly over-represented motifs for AGL TF binding, the so-called CArG box [52,53], in the promoter region of each PvSRS gene. Notably, we did find over-represented motifs for AGL TF distributed across every PvSRS gene, appearing from 4 to 14 times in each gene promoter (S4 Table). The PvSRS4, PvSRS8 and PvSRS10 gene promoters showed a higher frequency of AGL TF recognized motifs. As previously shown (Fig 2) PvRSR10 showed the highest expression level in mature nodules, similar as PvSRS8, while PvSRS4 showed the highest expression in inoculated roots and high expression in young, mature and senescent nodules.

These results prompted us to experimentally analyze if the PvFUL-like TF, which showed the highest expression in inoculated roots/nodules [22] as transcriptional activator of PvSRS10. For this we used a similar system as for the PvNF/Y TF analysis based on the co-infiltration of N. benthamiana leaves with an effector vector overexpressing PvFUL-like and a reporter vector bearing the chimeric gene with the PvFUL-like promoter fused to the GFP reporter gene, as well as appropriate controls. The N. benthamiana leaves co-infiltrated with the effector vector over-expressing PvFUL-like plus the reporter plasmid clearly showed green fluorescence (Fig 3C). This result proposes the PvFUL-like (AGL) TF as a novel transcriptional activator of PvSRS10.

To reinforce this conclusion, we analyzed the expression level of PvSRS genes in transgenic nodules of R. etli-inoculated composite bean plants, with modulated expression of PvFUL-like overexpression. As compared to nodules transformed with the EV, the nodules expressing the RNAi/FUL construct showed 80% of gene silencing and those expressing the OE/FUL construct showed 8-fold PvFUL expression level. The expression level of each PvSRS gene was determined in transgenic nodules at 22 dpi, modulated in PvFUL-like expression; results are shown in Fig 4. Nodules over-expressing PvFUL-like gene showed increased expression level of every PvSRS gene, these were 1.8 to 4-fold higher than control (EV) nodules. In silenced (RNAi/FUL) nodules, a significantly decreased expression level was observed for PvSRS1, PvSRS2, PvSRS4, PvSRS5 and PvSRS10 genes, that showed 28% to 57% expression level as compared to the value form each gene in EV nodules. Our results (Fig 4) agree with those from (Fig 3) evidencing PvFUL-like as a transcriptional activator of PvSRS genes.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. Expression level of PvSRS genes in transgenic nodules expressing the RNAi/AGL or OE/FUL constructs as compared with EV.

The PvSRS genes expression was evaluated at 22 dpi. Expression level refers to genes expression, based on Ct value, normalized with the expression of three housekeeping genes (HSP, MDH and UBQ9). Asterisks indicate significant difference between silenced or overexpressing transgenic nodules with respect to EV at each time point analyzed by Student´s t- test (p value < 0.01). Data showed were obtained from three biological replicates, and one technical replicate each from common bean plants.

https://doi.org/10.1371/journal.pone.0321784.g004

Predicted protein-protein interaction network for PvSRS5, PvSRS6

The functional relationships of the PvSRS5 and PvSRS6 proteins, which are highly expressed during the early stages of nodule development (Fig 2), were predicted using the STRING protein interaction database [36].

Results from the functional protein association network of PvSRS5 revealed the number of 10 edges, an average local clustering coefficient of 0.597, and a protein-protein interaction (PPI) enrichment p-value of 9.34e-05. The predicted interacting proteins were linked with three significantly enriched biological processes GO (Gene Onthology) terms: auxin-activated signaling pathway (GO:0009734), regulation of transcription, DNA-templated (GO:0006355), and regulation of cellular processes (GO:0050794) and to two significantly enriched molecular function GO terms: DNA-binding transcription factor activity (GO:0003700) and DNA binding (GO:0003677).

In the PvSRS6 network, the number of edges was also 10, with an average local clustering coefficient of 0.6 and a PPI enrichment p-value of 4.03e-06. Three of the predicted interacting proteins were linked to the biological processes GO terms: regulation of transcription, DNA -template (GO:0006355) although this was not significantly enriched.

Overall, the PPI diagrams Fig 5A and 5B proposed that both PvSRS5 and PvSRS6 TF can interact with NAC proteins, which are key regulators of plant growth, development, and response to abiotic stress [54] and with auxin response factors (ARFs) and auxin-induced proteins Fig 5A and 5B. ARFs are plant-specific TF that regulate early auxin-responsive genes and play essential roles in plant growth, development, and phytohormone signaling [55]. In Lotus, the NF-Y/ STY signaling cascade regulates the expression of LjYUCCA1 and LjYUCCA11, that encode for flavin monooxygenase-like enzymes that mediate the limiting step in tryptophan-dependent auxin biosynthesis [15]. Our results proposing interaction between PvSRS and auxing/related proteins (Fig 5) may be related to the importance of auxin signaling in the SNF, both during rhizobia infection and nodule formation [56,57].

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. Protein-protein interactions network diagram for PvSRS5 (A) and PvSRS6 (B) predicted using the STRING database.

Each colored circle represents a protein that potentially interacts with PvSRS5 (A) or PvSRS6 (B) and with other proteins from the diagram. For proteins with non-characterized function, their gene ID is shown.

https://doi.org/10.1371/journal.pone.0321784.g005