BnLPAT2 gene regulates oil accumulation in Brassica napus by modulating linoleic and linolenic acid levels in seeds

Luyao Huang; Zhiqiang Liao; Yujing Zou; Yong Liu; Huihui Wang; Leping Zou; Sun Liang; Shan Tong; Yu Kang; Tuo Chen; Xinghua Xiong; Man Xing

doi:10.1371/journal.pone.0321548

Abstract

Lysophosphatidate acyltransferase (LPAT) catalyzes the conversion of lysophosphatidic acid to phosphatidic acid, a key step in lipid biosynthesis. This study cloned four LPAT2 genes from Brassica napus: BnLPAT2-A04, A07, A09, and C08. Functional analysis using bioinformatics, qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction), CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated protein 9), overexpression, and transcriptome sequencing revealed that these genes encode proteins containing the conserved PLN02380 domain. BnLPAT2-A07/A09/C08 showed strong conservation with Arabidopsis AtLPAT2. Promoter analysis revealed multiple cis-elements related to stress, light, and phytohormone responses, with the BnLPAT2-A09/C08 promoters containing the most diverse cis-elements. Expression analysis showed that BnLPAT2-A07/C08 was highly expressed in various tissues, with BnLPAT2-A07 peaking during seed development. Overexpression of these genes increased seed oil content and the proportion of C18:2/C18:3 fatty acids, with BnLPAT2-A07 achieving an increase in oil content ranging from 4.46% to 6.44%. Gene knockout reduced oil content by 7.5% and affected fatty acid accumulation. Transcriptome sequencing analysis suggested that the BnLPAT2 genes promote the production of long-chain fatty acids, such as Linoleic acid (C18:2) and Linolenic acid (C18:3), through biological processes, including fatty acid biosynthesis, very long-chain fatty acid biosynthesis, and very long-chain fatty acid metabolism, thereby improving seed oil content. This study provides valuable insights into lipid metabolism and offers a theoretical foundation for improving oil content and fatty acid composition in B. napus.

Citation: Huang L, Liao Z, Zou Y, Liu Y, Wang H, Zou L, et al. (2025) BnLPAT2 gene regulates oil accumulation in Brassica napus by modulating linoleic and linolenic acid levels in seeds. PLoS ONE 20(4): e0321548. https://doi.org/10.1371/journal.pone.0321548

Editor: Bahram Heidari,, Shiraz University, IRAN, ISLAMIC REPUBLIC OF

Received: December 23, 2024; Accepted: March 9, 2025; Published: April 16, 2025

Copyright: © 2025 Huang et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the manuscript and its Supporting Information files.

Funding: This work was supported by the Natural Science Foundation of China (32401904), the Natural Science Foundation of Chongqing (CSTB2024NSCQ-MSX0906), Special fund for guiding city and county science and technology development of Jiangxi Province, and the National Key Research and Development Program of China (2017YFD0101700).

Competing interests: The authors have declared that no competing interests exist.

Introduction

Increasing the oil content of oil crop seeds is crucial for enhancing plant oil production. In the Kennedy pathway of plant oil biosynthesis, glycerol-3-phosphate acyltransferase (GPAT) [1–4], lysophosphatidic acid acyltransferase (LPAT) [5,6], and diacylglycerol acyltransferase (DGAT) [7,8] are key enzymes involved in triacylglycerol (TAG) formation in plant seeds. GPAT catalyzes the acylation of the sn-1 position of glycerol by acyl-CoA, forming lysophosphatidic acid (LPA) [9]. LPAT catalyzes the acylation of the sn-2 position of glycerol, producing phosphatidic acid (PA) [10]. DGAT regulates the final step of triacylglycerol (TAG) synthesis by catalyzing the formation of triacylglycerol from diacylglycerol [11,12]. LPAT uses lysophosphatidic acid as a substrate to produce phosphatidic acid and is a key enzyme in lipid synthesis in living organisms.

In Arabidopsis thaliana, LPAT is encoded by five genes: AtLPAT1, AtLPAT2, AtLPAT3, AtLPAT4, and AtLPAT5. AtLPAT1 is associated with embryonic development [13], AtLPAT2 is localized to the endoplasmic reticulum and affects female gametophyte development [14], while AtLPAT3 is related to another development [15]. Research on AtLPAT4 and AtLPAT5 is relatively scarce. Based on subcellular localization, the LPAT family is classified into two main types: plastid-type and endoplasmic reticulum-type. The ER-type LPATs are further divided into two categories: type A and type B [16]. Type A LPATs are expressed in all plant tissues and exhibit a preference for C18:1-CoA [17]. In contrast, type B LPATs are primarily expressed in tissues that accumulate oils and show a preference for saturated or unsaturated acyl substrates [18]. In castor (Ricinus communis), three LPAT-A genes (RcLPAT2, RcLPAT3, RcLPAT4) have been reported. Their gene expression varies during different stages of seed development, with RcLPAT2 showing the highest relative expression [19] and a stronger preference for C18:1-CoA [20]. This indicates that although LPATs from different species exhibit varying preferences for fatty acids, they all influence fatty acid and TAG synthesis. This highlights the importance of LPAT as a key gene in lipid metabolism, with significant research value in regulating seed oil content.

Research on the LPAT2 gene has made significant progress in Arabidopsis thaliana [21,22], Cuphea [16], Ricinus communis [5], Camelina sativa [23,24], Consolida ajacis [25], Perilla frutescens [26], and rapeseed [27,28]. Woodfield overexpressed the BnLPAT2 gene in rapeseed and found a significant increase in triacylglycerol content in the seeds [28]. Zhang [27] used CRISPR/Cas9 gene-editing technology to perform targeted editing of multiple homologous copies of BnLPAT2 and BnLPAT5 in rapeseed. The results showed that oil content decreased by 32% and 29% in BnLPAT2 and BnLPAT5 edited lines, respectively, confirming a close relationship between these genes and silique development and oil accumulation in rapeseed. Introducing yeast ScLPAT into rapeseed increased both seed oil content and crop yield [29]. Similarly, Chen [30] introduced the peanut AhLPAT2 gene into Arabidopsis, resulting in increased seed weight, oil content, total fatty acids, and unsaturated fatty acids. Castor RcLPAT2 enhanced oleic acid content in Lesquerella seeds [31]. Overexpression of Camelina sativa CsaLPAT2 significantly increased the long-chain fatty acid content in triacylglycerol, slightly enlarged seed size, significantly increased total phospholipid content, and raised the proportion of phosphatidic acid molecules containing long-chain fatty acids to 45%, which was 2.8 times higher than in the wild type [23].

These studies demonstrate a strong association between LPAT2 expression seed oil content and fatty acid composition. Recent research findings indicate that introducing the rapeseed BnLPAT2 gene into Arabidopsis can increase seed oil content and significantly enhance linolenic acid content [27]. Although numerous studies have reported that heterologous expression of the LPAT2 gene can increase the linolenic acid content and long-chain fatty acid content in oils [23,27,30,31], the underlying mechanism has not yet been elucidated. Consequently, LPAT2 has become a focal point for research on improving oil composition and increasing oil content. In this study, four LPAT2 genes from B. napus were cloned and named BnLPAT2-A04 (BnaA04G0028300ZS), BnLPAT2-A07 (BnaA07G0200200ZS), BnLPAT2-A09 (BnaA09G0530700ZS), and BnLPAT2-C08 (BnaC08G0376200ZS). Using Arabidopsis and rapeseed lines with LPAT2 overexpression and CRISPR/Cas9 knockouts, lipidomic and transcriptome analyses of seeds were conducted to elucidate further the molecular mechanisms by which BnLPAT2 regulates seed oil content and fatty acid accumulation. Thus, in-depth research on BnLPAT2 will enhance our understanding of fatty acid biosynthesis mechanisms in rapeseed seeds, providing valuable insights for improving oil accumulation and modifying fatty acid composition in oilseed crops.

Materials and methods

Materials

The B. napus ZS6 used in this study was provided by the rapeseed team at Southwest University, while the B. napus XY15 was obtained from the Oil Crops Research Institute of Hunan Agricultural University. ZS6 and XY15 were planted in the experimental fields at Southwest University. Seeds from T₂ homozygous transgenic lines were collected for oil content and fatty acid analysis. The T₂ generation transgenic rapeseed and its controls were cultivated in an isolated greenhouse under conditions consistent with field planting, except for the isolation. We measured the expression levels of the BnLPAT2 gene in different tissue parts of ZS6 and XY15. During the flowering stage, roots, stems, leaves, flower buds, and flowers were collected, immediately flash-frozen in liquid nitrogen, and stored at −80°C for later use. Siliques at 7, 14, 21, 28, 35, and 42 days after pollination were sampled, and seeds were carefully separated from the silique walls with forceps. The seeds were then flash-frozen in liquid nitrogen and stored at -80°C. The Arabidopsis thaliana used in this study was the Columbia wild type, which was preserved in our laboratory.

Cloning and bioinformatics analysis of four BnLPAT2 genes in B. napus

Retrieve the ID of AtLPAT2 (AT3G57650) from the TAIR database (https://www.arabidopsis.org/) and copy the Arabidopsis gene ID to the BnTIR database (https://yanglab.hzau.edu.cn/BnTIR) to identify the four homologous copies of the BnLPAT2 gene in B. napus. Download the mRNA sequences. The primer design for the BnLPAT2 gene is shown in S1 Table. Use the NCBI database (https://www.ncbi.nlm.nih.gov/) with the ORF Finder and CD-search tools to analyze the open reading frame and protein domains of BnGPAT9 in B. napus. Predict the secondary structure using the SOPMA software (http://npsa-pbil.ibcp.fr/cgi-bin/). Analyze the protein’s molecular weight, isoelectric point, and other basic physicochemical properties using the ExPASy tool (https://web.expasy.org/protparam/). Analyze cis-regulatory elements using the PlantCARE database (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) and TBtools software. Use the MEME program (http://meme-suite.org/tools/meme) to analyze conserved motifs in the protein sequence. Using the BnLPAT2 amino acid sequence as the reference, perform a Blastp search to identify homologous amino acid sequences in other species and construct a phylogenetic tree using MEGA6.06 software.

Plant expression vector construction and genetic transformation

Upstream primers for cloning the BnLPAT2 gene were designed to include a BamHⅠ (GGATCC) restriction enzyme site at the 5’ end, and downstream primers included a SacⅠ (GAGCTC) restriction enzyme site at the 5’ end. The primers were used to ligate the gene into the plant binary expression vector pBI121 to construct a CaMV35S promoter driven overexpression vector. The Napin promoter sequence was retrieved from the B. napus database, and primers were designed based on the sequence as follows: Napin-F: AAGCTTGTTCAAGCGAATGGCATACCG; Napin-R: GGATCCTGTTTGTATTGATGAGTTTTGG (underlined regions indicate restriction enzyme sites). The Napin promoter replaced the CaMV35S promoter in the pBI121 vector to construct a Napin promoter driven overexpression vector. The sgRNAs for BnLPAT2-A07 were designed using the CRISPR Design Tools website (https://www.synthego.com/products/bioinformatics/crispr-design-tool), yielding the sequences S1 (TGTCTGGATCGTTGACTGGTGG) and S2 (TCACCGAAGTGATATTGATTGG). The construction of the editing vector and the detection of CRISPR/Cas9 editing in rapeseed were carried out according to the experimental methods described in the CRISPR/Cas9 toolkit for plant multiplex genome editing by Xing [32]. The transformation was performed using the Agrobacterium tumefaciens GV3101 mediated floral dip method [33] for Arabidopsis thaliana and the hypocotyl transformation method [34] for B. napus. The harvested Arabidopsis seeds after transformation are spread on 1/2 MS solid medium containing kanamycin to select T₀ plants. The T₀ plants were then grown in a growth chamber, and after harvesting T₀ seeds, further screening was performed until homozygous lines were obtained. Seeds from the T₂ generation of Arabidopsis were harvested to measure oil content and fatty acid composition. The screening and identification of transgenic plants were carried out in a growth chamber with a temperature of 24°C and a photoperiod of 16 hours light and 8 hours dark. The primers for detecting transgenic positive lines of knock-out and overexpression rapeseed are shown in S2 Table.

Determination of seed oil content and fatty acid composition

The oil content and fatty acid content of Arabidopsis thaliana and rapeseed seeds were determined using a gas chromatograph. The steps for fatty acid extraction were as follows:

Weighed Seeds: 10 mg of seed samples were weighed.
Added Reagent: 2 mL of a methanol solution containing 2.5% sulfuric acid (with 0.01% BHT) was added.
Added Internal Standard: 100 μL of 16.2 μmol/mL C17:0 fatty acid was added as an internal standard.
Processed Samples: For rapeseed samples, seeds were gently crushed using a glass rod (Arabidopsis seeds did not require this step).
Heated in Water Bath: Samples were heated in an 85°C water bath for 2 hours, with the lid checked every 10–20 minutes to ensure it was secure and not leaking.
Cooled Samples: After heating, the samples were cooled to room temperature.
Performed Liquid-Liquid Extraction: 2 mL of ultrapure water (ddH₂O) and 2 mL of n-hexane were added, and the mixture was vortexed thoroughly.
Centrifuged Samples: The samples were centrifuged at 1000 rpm for 10 minutes.
Collected Supernatant: Approximately 1 mL of the supernatant was collected into sample vials.
Injected Samples: 1 μL of the sample was injected into the gas chromatograph with a split ratio of 2:1–10:1.

The seed oil content was calculated using the following formula:

Seed oil content (%) = [mass of internal standard FA (C17:0)/ proportion of internal standard FA (C17:0) - mass of internal standard FA (C17:0)]/ seed mass.

Gas chromatographic measurement method: The gas chromatograph model used was the Agilent 6850 Network GC system, equipped with an Agilent Series Auto Sampler for injections of 1μL each time. The initial temperature of the chromatography column was 180°C, gradually heated to 225°C, with a heating duration of 7 minutes. Nitrogen was used as the carrier gas for the column, with a flow rate of 1 mL/min. After injection and passage through the column, the OpenLAB analysis software provided by Agilent was used to obtain the gas chromatography measurement results of fatty acid methyl esters in each sample. This study employs the internal standard method to determine the absolute content of each fatty acid component in the samples, using heptadecanoic acid (analytical grade) as the internal standard, added in equal amounts to each sample before methylation.

RNA extraction and qRT-PCR analysis

During the flowering period, the roots, stems, leaves, flowers, flower buds, and seeds at different developmental stages (7 days, 14 days, 21 days, 28 days, 35 days, and 42 days after pollination) of rapeseed varieties ZS6 and XY11 were collected. These samples were quickly frozen in liquid nitrogen and thoroughly ground. Total RNA was extracted using a Plant Total RNA Rapid Extraction Kit (Sangon Biotech, Shanghai, China) following the manufacturer’s instructions. cDNA was synthesized using the One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). RT-PCR amplification was performed using the reverse-transcribed cDNA as a template and specific primers. The PCR reaction system included 1 μL of template, 1 μL of forward primer, 1 μL of reverse primer, 10 μL of 2×Phanta Flash Master Mix, and 7 μL of ddH₂O. The PCR conditions were as follows: 94°C for 3 min; 35 cycles of 94°C for 30 s, 60°C for 30 s, 72°C for 90 s; and a final extension at 72°C for 10 min. The target bands were detected via 1% agarose gel electrophoresis. For qRT-PCR analysis, B. napus Actin2.1 served as the reference gene, with primers listed in S3 Table. Relative expression levels were calculated using the 2^(-ΔΔCt) method as described by Livak [35].

Transcriptome sequencing analysis of transgenic rapeseed

At 30 days after pollination, siliques were collected, and seeds were removed, flash frozen in liquid nitrogen, and then stored at −80ºC for further analysis. Each treatment included three independent biological replicates. RNA was extracted from the seeds using the TRIzol method, followed by assessments of RNA purity and integrity. Libraries were constructed using the NEBNext Ultra RNA Library Prep Kit. After library construction, initial quantification was performed with a Qubit 2.0 Fluorometer, and the library was diluted to 1.5 ng µL⁻¹. The insert size of the library was then verified using an Agilent 2100 Bioanalyzer. Once the insert size met expectations, the effective concentration of the library was accurately quantified using qRT-PCR, ensuring a concentration above 2 nmol L⁻¹ for quality assurance. Sequencing was performed using the Illumina high-throughput sequencing platform (HiSeq2000). Differentially expressed genes (DEGs) were identified with the criteria |log₂(Fold Change)| ≥ 1 and q < 0.05. Functional annotation and analysis of DEGs were conducted using the GO (Gene Ontology) and KEGG (Kyoto Encyclopedia of Genes and Genomes) databases. Using the zs11_hzau (http://cbi.hzau.edu.cn/rape/download_ext/zs11.genome.fa) as the reference genome, the transcriptome data for the six homologous copies of the BnLPAT2 gene were obtained from the BnTIR database (https://yanglab.hzau.edu.cn/BnTIR).

Results

Cloning and bioinformatics analysis of the BnLPAT2

Total RNA was extracted from XY15 seeds two weeks after pollination (Fig 1A). Using reverse transcribed cDNA as a template, PCR amplification produced four target bands, as shown in Fig 1B. The target fragments were recovered, ligated into the pUCm-T vector, and transformed into DH5α (Escherichia coli). After sequencing and alignment, four full-length CDS sequences were cloned and named BnLPAT2-A04 (1155 bp), BnLPAT2-A07 (1173 bp), BnLPAT2-A09 (1173 bp), and BnLPAT2-C08 (1173 bp), encoding proteins of 384, 390, 390, and 390 amino acids, respectively. Gene structure analysis revealed that only BnLPAT2-C08 contained 5’UTR and 3’UTR regions, while the other three genes displayed similar exon-intron distribution patterns (Fig 1C). The molecular weights of the BnLPAT2 proteins ranged from 43.2 to 43.7 kDa. All were identified as unstable proteins with isoelectric points above 8, classifying them as basic proteins (S4 Table). Secondary structure predictions indicated that BnLPAT2 proteins consist of random coils, α-helices, extended strands, and β-sheets, with α-helices being the most predominant, accounting for 46.15% (BnLPAT2-C08), 47.68% (BnLPAT2-A09), 48.21% (BnLPAT2-A07), and 45.57% (BnLPAT2-A04), respectively. β-sheets were the least abundant, at approximately 5% (S5 Table).

Download:

Fig 1. Cloning of four BnLPAT2 genes and phylogenetic analysis of their encoded proteins.

(A) Total RNA from B. napus XY15. (B) PCR results of BnLPAT2 genes. M: 2K DNA Marker; 1: BnLPAT2-C08; 2: BnLPAT2-A09; 3: BnLPAT2-A07; 4: BnLPAT2-A04. (C) Chromosomal localization and gene structure of BnLPAT2 genes. (D) Conserved domains of BnLPAT2. (E) Phylogenetic tree for BnLPAT2 proteins from different plant species.

https://doi.org/10.1371/journal.pone.0321548.g001

Protein domain prediction results revealed that all four BnLPAT2 proteins contain the conserved PLN02380 domain, classifying them within the PLN02380 superfamily (Fig 1D). Phylogenetic analysis showed that BnLPAT2-A09/C08 are closely related to Hirschfeldia incana and Raphanus sativus, whereas BnLPAT2-A04/A07 are more closely related to the LPAT2 proteins of Brassica rapa (Fig 1E). The conserved motifs of BnLPAT2-A07/A09/C08 and Arabidopsis thaliana AtLPAT2 proteins are highly conserved, all containing Motifs 1–10 with identical motif arrangements. However, the conserved motifs of the BnLPAT2-A04 protein differ, lacking the Motif 9 sequence (Fig 2A). Amino acid sequence alignment revealed that the BnLPAT2-A09/C08 sequences are identical, while BnLPAT2-A04 exhibits significant differences compared to the other three BnLPAT2 proteins, sharing only 77.83% similarity with AtLPAT2. In contrast, BnLPAT2-A07/A09/C08 share 91.82% and 98.04% similarity with AtLPAT2, respectively (Fig 2B).

Download:

Fig 2. Characterization of the BnLPAT2 protein sequences.

(A) The analysis of conserved motifs in BnLPAT2 and AtLPAT2 proteins. (B) The multiple sequence alignment of BnLPAT2 and AtLPAT2 proteins.

https://doi.org/10.1371/journal.pone.0321548.g002

Analysis of Cis-acting elements in the promoter of BnLPAT2 genes

To analyze the potential functions of the four BnLPAT2 genes in rapeseed, the PlantCARE software was used to analyze the promoter sequences in the 2 kb upstream region of the BnLPAT2 genes. As shown in Fig 3, a total of 51 types of functional cis-acting elements were identified in the promoter sequences of the BnLPAT2 genes in rapeseed. These elements were categorized into five functional groups: Stress responsive elements, Light responsive elements Phytohormone regulation, Metabolism regulation, and other elements. Among them, light responsive elements were the most diverse, with G-box, BOX 4, and GT1-motif being the main types. Next were stress responsive elements, including MYB, MYC, ARE, and STRE. Additional light responsive elements included BOX 4, GT1-motif, and TCT-motif. Phytohormone regulation included those related to abscisic acid (ABRE), auxin (AuxR-core), methyl jasmonate (CGTCA-motif and TGACG-motif), and salicylic acid (TCA-motif). Metabolism regulation was primarily associated with carbon metabolism (AAGAA-motif) and arginine metabolism (O2-site). Moreover, the BnLPAT2-C08 gene promoter sequence contained the most diverse types of cis-acting elements, followed by the BnLPAT2-A09 gene, indicating that BnLPAT2-C08/A09 in rapeseed have greater potential to participate in a broader range of physiological regulatory processes compared to other homologous genes.

Download:

Fig 3. Cis-elements detected in the promoter of the BnLPAT2 genes.

(A) Promoter element distribution, different colors correspond to different elements in the figure below. (B) The heat map shows the number of promoter elements, and the blue square indicates that the elements couldn’t be detected.

https://doi.org/10.1371/journal.pone.0321548.g003

Expression of BnLPAT2 genes in different tissues

Based on the transcriptome data reported in the BnTIR database, the expression levels of six homologous copies of the BnLPAT2 gene across various tissues were analyzed using heatmap analysis (Fig 4A). The results showed that BnLPAT2-C08/A09 exhibited high expression levels in roots, stems, leaves, flowers, siliques, and seeds, followed by BnLPAT2-A07, while BnLPAT2-A04/C04 displayed the lowest expression levels in all tissues. Total RNA was extracted from roots, stems, leaves, flower buds, flowers, and seeds at different developmental stages of ZS6 and XY15, and cDNA was synthesized by reverse transcription for qRT-PCR analysis. Due to the high homology between BnLPAT2-C08 and BnLPAT2-A09, only the sequence of BnLPAT2-C08 was used to design specific primers for real-time quantitative PCR amplification.

Download:

Fig 4. Expression of BnLPAT2 genes in different tissues of B. napus.

(A) Expression of BnLPAT2 Genes in ZS11. (B and C) Expression of BnLPAT2 Genes in ZS6. (D and E) Expression of BnLPAT2 Genes in XY15.

https://doi.org/10.1371/journal.pone.0321548.g004

We found that BnLPAT2-A04/A07/C08 had similar expression patterns in roots, stems, leaves, and flowers of ZS6 and XY15, with BnLPAT2-A07/C08 showing higher expression levels and BnLPAT2-A04 showing very low expression. However, in XY15 flowers, BnLPAT2-A04 exhibited a higher expression level (Fig 4B and D). Additionally, BnLPAT2-A04/A07/C08 displayed distinct expression patterns during seed development in ZS6 and XY15 (Fig 4C and E). BnLPAT2-C08 showed high expression levels in both early and late stages of seed development in ZS6, while in XY15, its expression decreased as seed development progressed. The expression of BnLPAT2-A04 differed significantly between the two varieties: in XY15, it maintained high expression levels during seed development, gradually decreasing as seed development progressed, whereas in ZS6, it exhibited relatively high expression levels only in the late stage of seed development. Notably, BnLPAT2-A07 exhibited similar expression patterns during seed development in ZS6 and XY15, with higher expression levels detected only in the mid-to-late stages of seed development.

BnLPAT2 genes transformation in Arabidopsis and rapeseed and seed oil content analysis

We constructed overexpression vectors driven by the CaMV35S promoter for four BnLPAT2 genes and genetically transformed Arabidopsis. We found that only the overexpression of BnLPAT2-A04/A07/A09 significantly increased seed oil content compared to the wild type, with BnLPAT2-A07 transgenic plants showing a 4.8% increase in seed oil content, which was statistically significant (Fig 5A). Fatty acid composition analysis revealed that overexpressing all four BnLPAT2 genes significantly increased the contents of C18:2 and C18:3 fatty acids. In particular, overexpression of BnLPAT2-A07 led to a significant increase in Stearic acid (C18:0) fatty acid content, as well as a significant decrease in the contents of Arachidic acid (C20:0) and 9-eicosenoic acid (C20:1) fatty acids (Fig 5B). Thus, BnLPAT2-A07 had the most pronounced effect on seed oil accumulation and fatty acid composition. Therefore, we selected BnLPAT2-A07 and constructed a Napin promoter driven overexpression vector to transform ZS6.

Download:

Fig 5. Detection of oil content and fatty acid content in seeds.

(A and B) Oil content and fatty acid content in BnLPAT2 gene-transferred Arabidopsis seeds. (C and D) Oil content and fatty acid content in B. napus seeds overexpressing the BnLPAT2 gene. (E and F) Oil content and fatty acid content in B. napus seeds with BnLPAT2 gene knockout. * indicates p < 0.05, ** indicates p < 0.01.

https://doi.org/10.1371/journal.pone.0321548.g005

We found that the oil content in two CaMV35S driven overexpression lines and two Napin promoter-driven overexpression lines was significantly higher than that of ZS6, specifically BnLPAT2-35S-1, BnLPAT2-35S-2, BnLPAT2-NP-1, and BnLPAT2-NP-3. Among them, the seed oil content in the BnLPAT2-35S-1 line was significantly increased by 6.4% compared to the control (Fig 5C). We analyzed the fatty acid content in the transgenic lines’ seeds (Fig 5C) and found that the C18:2 content was significantly increased in all lines except BnLPAT2-35S-2. The C18:3 content was significantly increased in BnLPAT2-35S-1 and BnLPAT2-NP-3 lines. The C16:0 content was significantly reduced in BnLPAT2-35S-1 and BnLPAT2-35S-2 lines, while the C18:0 content was significantly increased in the BnLPAT2-35S-1 line. Our results indicate that overexpression of the BnLPAT2-A07 gene in rapeseed promotes the accumulation of C18:2 and C18:3 fatty acids.

To further validate the effect of the BnLPAT2-A07 gene on oil accumulation, we used CRISPR/Cas9 technology to knock out four BnLPAT2 genes in rapeseed (the vector construction is shown in S1 Fig). We assessed the editing efficiency of the four homologous copies of the BnLPAT2 gene in the T₀ generation of CRISPR/Cas9-edited rapeseed. The detection primers for CRISPR/Cas9 editing in rapeseed and the gene editing efficiency detection are shown in S5 and S6 Tables. The proportion of rapeseed plants with edits at the homologous copies ranged from 5.56% to 22.22%, with an average editing efficiency of 16.67%; the editing efficiency at Target 1 ranged from 0% to 22.22%, with an average of 9.72%; the editing efficiency at Target 2 ranged from 5.56% to 16.67%, with an average of 12.50%. Sequencing alignment revealed that the editing types at the four homologous copies of the BnLPAT2 gene in the T₀ generation lines BnLPAT2-Cas9–1 (401-1), BnLPAT2-Cas9–2 (401–2), and BnLPAT2-Cas9–3 (401–3) were more diverse compared to other lines. Therefore, these three knockout lines were selected and grown to the T₂ generation for seed collection and oil content and fatty acid analysis. The seed oil content of the three knockout lines was lower than that of the control XY15. Among them, the oil content of BnLPAT2-Cas9–1 was significantly lower than that of the control, and BnLPAT2-Cas9–3 had a 7.5% reduction in oil content, which was statistically significant (Fig 5E). Fatty acid analysis showed that the content of C18:3 in the seeds of all three knockout lines was significantly lower than that of the control, and only the seeds of BnLPAT2-Cas9–3 showed a significant reduction in C18:2 content (Fig 5F). Knocking out the BnLPAT2 gene not only reduced oil content but also decreased the levels of C18:2 and C18:3.

Transcriptome sequencing analysis of transgenic BnLPAT2 B. napus seeds during development

To investigate the biological function of the BnLPAT2 gene in promoting seed oil accumulation, we conducted transcriptome sequencing analysis on seeds collected 30 days after flowering from B. napus overexpression and knockout lines. We found that the DEGs induced by BnLPAT2 overexpression driven by the Napin promoter were the fewest, while the CaMV35S promoter overexpression and knockout lines showed a larger number of DEGs, primarily characterized by upregulated gene expression (Fig 6A). A total of 4,222 DEGs were identified as common among the three BnLPAT2 knockout lines (Fig 6B). Further Gene Ontology (GO) enrichment analysis revealed that these common DEGs were significantly enriched in biological processes, including “seed maturation” and “fatty acid biosynthetic process” (Fig 6C). In the seeds of both Napin and CaMV35S promoter-driven overexpression lines, 1,113 DEGs were identified as common (Fig 6D). GO enrichment analysis showed that these DEGs were significantly enriched in 19 biological processes, including “fatty acid biosynthetic process,” “seed maturation,” “very long-chain fatty acid biosynthetic process,” and “very long-chain fatty acid metabolic process” (Fig 6E). We observed that the “fatty acid biosynthetic process” was significantly enriched in both overexpression and knockout lines. Additionally, the overexpression of the BnLPAT2 gene significantly impacted the “very long-chain fatty acid biosynthetic process” and “very long-chain fatty acid metabolic process,” providing a biological explanation for the increased content of C18:2 and C18:3.

Download:

Fig 6. Analysis of transcriptome data from transgenic rapeseed seeds.

(A) Statistics of differential gene numbers. (B and C) Venn diagram of differential genes in knockout lines and GO enrichment analysis. (D and E) Venn diagram of differential genes in overexpression lines and GO enrichment analysis.

https://doi.org/10.1371/journal.pone.0321548.g006

Identification of key genes interacting with the BnLPAT2 gene to regulate lipid accumulation

Based on the transcriptome analysis results, we generated an expression heatmap for 44 genes involved in the fatty acid biosynthetic process in overexpression and knockout lines. We identified seven genes that were upregulated in the overexpression lines but downregulated in the knockout lines. These genes are BnaC07G0374200ZS (Cytochrome P450 86B1, CYP86B1), BnaA01G0399900ZS (Acyl carrier protein, ACP1), BnaA09G0139900ZS (Long chain acyl-CoA synthetase 3, LACS3), BnaA05G0181300ZS (Long chain acyl-CoA synthetase 2, LACS2), BnaC06G0093600ZS (Cytochrome P450 86B1, CYP86B1), BnaA03G0402500ZS (Cytochrome P450 86B1, CYP86B1), and BnaA02G0390300ZS (Cytochrome P450 86B1, CYP86B1) (Fig 7A). Based on the transcriptome data from both BnLPAT2 gene overexpression and knockout lines, we conducted a protein-protein interaction (PPI) network analysis for the selected gene set and constructed PPI networks. Two protein interaction network diagrams were constructed (Fig 7B and C). According to the degree of interaction of these proteins, we focused on hub proteins with more than ten connections. Fig 7B shows that several proteins in the RPS13B (ribosomal protein US15Y) family are core proteins, interacting extensively with RPL24B (ribosomal protein EL24Y), UTP18 (U3 small nucleolar rna-associated protein 18), RPL29B (ribosomal protein EL29Y), RPL35AA (ribosomal protein EL33W), MCM5 (minichromosome maintenance 5), and RPS24A (ribosomal protein ES24Z). Similarly, Fig 7C reveals that several RPS13B family proteins are core proteins, interacting extensively with RPS29A (ribosomal protein US14X), RPS24A, MCM5, RPL29B, and RPL24B. Interestingly, most of these core proteins are ribosomal proteins. The genes encoding RPS13B, RPS24A, RPL24B, and RPL35AA proteins exhibited relatively high expression levels (Fig 7D).

Download:

Fig 7. Mining transcriptome data to identify key genes regulated by BnLPAT2 in seed oil accumulation.

(A) Heatmap of DEGs expression in the fatty acid biosynthetic process. (B) Protein interaction network analysis results of the differential gene set in overexpressed transgenic rapeseed seeds. (C) Protein interaction network analysis results of the differential gene set in rapeseed knockout line seeds. Note: Nodes represent proteins, and edges represent interactions between proteins. The size of a node is proportional to its connectivity; the more edges connected to a node, the higher its degree and the larger the node. This indicates that the core proteins play a more significant role in the network. (D) The expression of genes encoding core proteins in siliques and seeds of ZS11.

https://doi.org/10.1371/journal.pone.0321548.g007

Discussion

Plant oils are primarily composed of triacylglycerols, representing the most energy-dense form of biological carbon storage [36]. Lysophosphatidic acid acyltransferase (LPAT) is the second acyltransferase in the triacylglycerol biosynthesis pathway, characterized by strong substrate selectivity and specificity, with a marked preference for unsaturated fatty acids [37]. LPAT plays a role in regulating plant oil accumulation and is closely associated with seed oil content [38,39]. In addition, it is involved in optimizing fatty acid composition, the synthesis of membrane lipids and signaling molecules [40], influencing seed embryo development [14], and contributing to plant stress resistance [41,42]. In this study, four BnLPAT2 genes were cloned from B. napus. BnLPAT2-A04 encodes 384 amino acids, while BnLPAT2-A07/A09/C08 encode 390 amino acids. The four BnLPAT2 genes share the same conserved domain and belong to the PLN02380 superfamily. The protein sequences of BnLPAT2-A07/A09/C08 contain 10 motifs, which are consistent in arrangement with those in Arabidopsis AtLPAT2. However, the BnLPAT2-A04 protein sequence lacks one motif. This motif deletion might result in functional differences between BnLPAT2-A04 and the other three homologous copies. Our study revealed that the homologous copies of the BnLPAT2 gene exhibit distinct tissue expression patterns. BnLPAT2-A04 is relatively highly expressed in reproductive organs but has extremely low expression levels in vegetative organs. BnLPAT2-C08/A09 shows high expression levels in various tissues of B. napus. Similarly, BnLPAT2-A07 is expressed at relatively high levels across tissues, with a trend of increased expression during silique and seed development. These findings suggest that the homologous copies of the BnLPAT2 gene may have organ-specific roles, with their contributions to glycerolipid biosynthesis and plant growth varying across different organs.

According to the results of oil content and fatty acid composition analysis, overexpression of BnLPAT2-A04/A07/A09/C08 in Arabidopsis thaliana increased seed oil content by 2.53%, 4.78%, 3.05%, and 1.91%, respectively. Although overexpression of all four BnLPAT2 homologs increased oil content, the increase observed for BnLPAT2-C08 did not reach statistical significance, and the extent of oil content enhancement varied among the copies. Only overexpression of BnLPAT2-A07 significantly and substantially increased seed oil content. These findings indicate functional differences among the four BnLPAT2 genes in seed oil accumulation, but they share a common feature: all significantly increased the levels of C18:2 and C18:3 fatty acids, thereby altering the fatty acid composition. This result aligns with studies on heterologous expression of LPAT. Chen [30] cloned and studied the expression characteristics of the peanut AhLPAT2 gene, finding a strong correlation between AhLPAT2 transcription levels and seed oil content. Specific overexpression of AhLPAT2 in Arabidopsis seeds significantly increased the total oil yield and seed weight of transgenic offspring. Overexpression of RcLPAT2 in castor beans increased the proportion of 18:1OH at the sn-2 position of triacylglycerols from 2% to 14–17%, which led to an increase in HFA-TAGs (hydroxy fatty acid- triacylglycerol) from 5% to 13–14% [31].

We propose that BnLPAT2-A07 is the primary functional homolog contributing to seed oil accumulation in B. napus. By generating BnLPAT2-A07 overexpressing transgenic lines, the seed oil content was increased by 4.46% to 6.44%. Specific expression of BnLPAT2-A07 in seeds elevated C18:2 levels by up to 8.4% and C18:3 levels by 1.11%. Using CRISPR-Cas9 technology, we further validated the functional role of BnLPAT2-A07 in regulating fatty acid and oil accumulation in B. napus seeds, which is consistent with the findings of Zhang [27]. Previous studies have shown that LPAT exhibits strong substrate specificity during triacylglycerol assembly, with a marked preference for unsaturated fatty acyl-CoAs such as C18. Castor bean RcLPAT2 [20] and Arabidopsis AtLPAT2 prefer 18:1-CoA [5]. Our results demonstrate that overexpression or knockout of BnLPAT2-A07 in B. napus significantly alters C18:3 levels in seeds, suggesting that BnLPAT2 has a preference for C18:3 acyl substrates. This conclusion aligns with Chen [43], who hypothesized that BnLPAT2 has a preference for linolenic acid. However, in BnLPAT2-OE Arabidopsis lines, Chen also observed an increase in long-chain fatty acids (C20 and above), suggesting that BnLPAT2 may also have a preference for long-chain fatty acids.

LPAT2 plays a crucial role in Arabidopsis thaliana, where AtLPAT2 is essential for glycerolipid biosynthesis, growth, and development, with knockout mutants exhibiting lethal phenotypes. The knockout mutants of AtLPAT2 display lethal phenotypes [14,21]. It functions in the Kennedy pathway in the endoplasmic reticulum, showing broad tissue expression across developmental stages [21]. In B. napus, transcriptome analysis of 30-day-old seeds from BnLPAT2 transgenic lines revealed numerous DEGs enriched in pathways related to fatty acid biosynthesis, including “fatty acid biosynthetic process” and “very long-chain fatty acid biosynthetic process.” Seven key genes potentially linked to oil biosynthesis were identified, including CYP86B1, ACP1, and LACS2/3. CYP86B1 is a hydroxylase for very long-chain fatty acids and has been demonstrated to be involved in the biosynthesis of ultra-long-chain fatty acids in plants [44]. Upregulated expression of ACP1 has also been associated with increased seed oil content, as evidenced by research on the overexpression of peanut AhLPAT2 in Arabidopsis [30]. Long-chain acyl-CoA synthetases (LACS) are key enzymes involved in fatty acid metabolism in plants, including phospholipid biosynthesis and TAG biosynthesis [45,46]. BnLACS2 has been confirmed to participate in oil biosynthesis in B. napus seeds, where its overexpression increases seed oil content, while BnLACS2-RNAi lines show reduced seed oil content [47]. These findings suggest that BnLPAT2 enhances oil content by promoting long-chain fatty acid synthesis, such as C18:2 and C18:3.

Through protein interaction network analysis, we identify some core proteins in the BnLPAT2 transgenic lines, most of which are ribosomal proteins. These proteins are likely to be important in fatty acid or lipid synthesis. Ribosomal proteins not only participate in protein synthesis but also play key roles in lipid metabolism. They affect lipid synthesis and degradation by regulating the expression of metabolism-related genes or interacting with signaling pathways. Ribosomal proteins regulate the expression of lipid metabolism-related genes by influencing transcription factors or signaling pathways (such as mechanistic target of rapamycin, mTOR and sterol regulatory element-binding protein, SREBP) [48,49]. For example, Ribosomal protein S6 kinase (S6K) regulates the expression of fatty acid synthase (FAS) and acetyl-CoA carboxylase (ACC) through the mTOR signaling pathway, promoting de novo lipid synthesis [50]. In plants, ribosomal proteins affect the synthesis and accumulation of fatty acids and triglycerides by regulating the expression of lipid metabolism-related genes. Studies show that mutations in ribosomal large subunit 4 (rpl4d) lead to downregulation of lipid metabolism genes, and lipid accumulation decreases in the meristem of rpl4d mutants [51]. Target of rapamycin (TOR) signaling pathway plays a central role in plant cell growth and metabolism, with Ribosomal protein S6 kinase (S6K) regulating the synthesis of galactolipids in rice through this pathway [52]. Additionally, ribosomal synthesis and post-translationally modified peptides can form hybrid lipids with fatty acids, thereby participating in fatty acid biosynthesis pathways [53,54]. As can be seen, the involvement of ribosomal proteins in lipid synthesis is a highly complex biological process.

Conclusions

This study cloned four BnLPAT2 genes (BnLPAT2-A04/A07/A09/C08) from B. napus. BnLPAT2-A07/A09/C08 share highly conserved motifs with the Arabidopsis AtLPAT2 protein. All four BnLPAT2 genes influence seed oil content, with BnLPAT2-A07 showing the most significant impact on seed oil accumulation and fatty acid content, being highly expressed during the late stages of seed development. Transcriptome analysis identified considerable enrichment in biological processes such as the “fatty acid biosynthetic process”, “very long-chain fatty acid biosynthetic process”, and “very long-chain fatty acid metabolic process”. We find some ribosomal proteins that may be involved in lipid synthesis through protein interaction network analysis. Our results suggest that BnLPAT2 genes may enhance seed oil content by promoting the production of long-chain fatty acids like C18:2 and C18:3. This finding is significance for improving the fatty acid composition and oil content of B. napus seeds. Therefore, our study provides valuable insights for genetic engineering to modify oilseed crop oil composition and increase seed oil content.

Supporting information

S1 Table. Primers required for BnLPAT2 gene cloning.

https://doi.org/10.1371/journal.pone.0321548.s001

(XLSX)

S2 Table. Overexpressed BnLPAT2 and CRISPR/ Cas9 primers were identified and detected.

https://doi.org/10.1371/journal.pone.0321548.s002

(XLSX)

S3 Table. Sequences of primers for BnLPAT2 expression.

https://doi.org/10.1371/journal.pone.0321548.s003

(XLSX)

S4 Table. Physicochemical properties analysis of four BnLPAT2 in Brassica napus.

https://doi.org/10.1371/journal.pone.0321548.s004

(XLSX)

S5 Table. Prediction protein secondary structure of BnLPAT2 in Brassica napus.

https://doi.org/10.1371/journal.pone.0321548.s005

(XLSX)

S6 Table. Detection of the efficiency of editing BnLPAT2 homologous gene and target site using CRISPR/ CAS9 of T₀ generation in rapeseed.

https://doi.org/10.1371/journal.pone.0321548.s006

(XLSX)

S7 Table. The transcriptome sequencing annotation of all genes and their TPM expression levels.

https://doi.org/10.1371/journal.pone.0321548.s007

(XLS)

S1 Fig. Construction and detection of expression vector.

https://doi.org/10.1371/journal.pone.0321548.s008

(DOCX)

S1 Raw Images. The original and uncropped images supporting all blot and gel results reported in an article’s figures and supporting information files.

https://doi.org/10.1371/journal.pone.0321548.s009

(PDF)

References

1. Zhang M, Fan J, Taylor DC, Ohlrogge JB. DGAT1 and PDAT1 acyltransferases have overlapping functions in Arabidopsis triacylglycerol biosynthesis and are essential for normal pollen and seed development. Plant Cell. 2009;21(12):3885–901. pmid:20040537
- View Article
- PubMed/NCBI
- Google Scholar
2. Yang Y, Benning C. Functions of triacylglycerols during plant development and stress. Curr Opin Biotechnol. 2018;49:191–8. pmid:28987914
- View Article
- PubMed/NCBI
- Google Scholar
3. Sun L-P, Ouyang L-L, Bao H, Liu J-G, Sun Z, Zhou Z-G. Comparison between two isoforms of glycerol-3-phosphate acyltransferase in microalga Myrmecia incisa: subcellular localization and role in triacylglycerol synthesis. Algal Res. 2021;54:102172.
- View Article
- Google Scholar
4. Li Y, Xiao L, Cao H, Cao Y, Zhang L. Phylogenomics and functional analysis of Glycerol-3-Phosphate Acyltransferase (GPAT) genes: a critical role in lipid biosynthesis. Physiol Plant. 2024;176(5):e14509. pmid:39210744
- View Article
- PubMed/NCBI
- Google Scholar
5. Arroyo-Caro JM, Chileh T, Kazachkov M, Zou J, Alonso DL, García-Maroto F. The multigene family of lysophosphatidate acyltransferase (LPAT)-related enzymes in Ricinus communis: cloning and molecular characterization of two LPAT genes that are expressed in castor seeds. Plant Sci. 2013;199–200:29–40. pmid:23265316
- View Article
- PubMed/NCBI
- Google Scholar
6. Jako C, Kumar A, Wei Y, Zou J, Barton DL, Giblin EM, et al. Seed-specific over-expression of an Arabidopsis cDNA encoding a diacylglycerol acyltransferase enhances seed oil content and seed weight. Plant Physiol. 2001;126(2):861–74. pmid:11402213
- View Article
- PubMed/NCBI
- Google Scholar
7. Gao Y, Sun Y, Gao H, Chen Y, Wang X, Xue J, et al. Ectopic overexpression of a type-II DGAT (CeDGAT2-2) derived from oil-rich tuber of Cyperus esculentus enhances accumulation of oil and oleic acid in tobacco leaves. Biotechnol Biofuels. 2021;14(1):76. pmid:33757551
- View Article
- PubMed/NCBI
- Google Scholar
8. Li R, Yu K, Hildebrand DF. DGAT1, DGAT2 and PDAT expression in seeds and other tissues of epoxy and hydroxy fatty acid accumulating plants. Lipids. 2010;45(2):145–57. pmid:20101470
- View Article
- PubMed/NCBI
- Google Scholar
9. Singer SD, Chen G, Mietkiewska E, Tomasi P, Jayawardhane K, Dyer JM, et al. Arabidopsis GPAT9 contributes to synthesis of intracellular glycerolipids but not surface lipids. J Exp Bot. 2016;67(15):4627–38. pmid:27325892
- View Article
- PubMed/NCBI
- Google Scholar
10. Vigeolas H, Waldeck P, Zank T, Geigenberger P. Increasing seed oil content in oil-seed rape (Brassica napus L.) by over-expression of a yeast glycerol-3-phosphate dehydrogenase under the control of a seed-specific promoter. Plant Biotechnol J. 2007;5(3):431–41. pmid:17430545
- View Article
- PubMed/NCBI
- Google Scholar
11. Bates PD. Understanding the control of acyl flux through the lipid metabolic network of plant oil biosynthesis. Biochim Biophys Acta. 2016;1861(9 Pt B):1214–25. pmid:27003249
- View Article
- PubMed/NCBI
- Google Scholar
12. Sah SK, Fan J, Blanford J, Shanklin J, Xu C. physiological functions of phospholipid: diacylglycerol acyltransferases. Plant Cell Physiol. 2024;65:863–71.
- View Article
- Google Scholar
13. Yu B, Wakao S, Fan J, Benning C. Loss of plastidic lysophosphatidic acid acyltransferase causes embryo-lethality in Arabidopsis. Plant Cell Physiol. 2004;45(5):503–10. pmid:15169931
- View Article
- PubMed/NCBI
- Google Scholar
14. Kim HU, Li Y, Huang AHC. Ubiquitous and endoplasmic reticulum-located lysophosphatidyl acyltransferase, LPAT2, is essential for female but not male gametophyte development in Arabidopsis. Plant Cell. 2005;17(4):1073–89. pmid:15772283
- View Article
- PubMed/NCBI
- Google Scholar
15. Wang Y, Zhang W-Z, Song L-F, Zou J-J, Su Z, Wu W-H. Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. Plant Physiol. 2008;148(3):1201–11. pmid:18775970
- View Article
- PubMed/NCBI
- Google Scholar
16. Kim HJ, Silva JE, Iskandarov U, Andersson M, Cahoon RE, Mockaitis K, et al. Structurally divergent lysophosphatidic acid acyltransferases with high selectivity for saturated medium chain fatty acids from Cuphea seeds. Plant J. 2015;84(5):1021–33. pmid:26505880
- View Article
- PubMed/NCBI
- Google Scholar
17. Misra N, Panda PK, Parida BK. Genome-wide identification and evolutionary analysis of algal LPAT genes involved in TAG biosynthesis using bioinformatic approaches. Mol Biol Rep. 2014;41(12):8319–32. pmid:25280541
- View Article
- PubMed/NCBI
- Google Scholar
18. Brown AP, Carnaby S, Brough C, Brazier M, Slabas AR. Limnanthes douglasii lysophosphatidic acid acyltransferases: immunological quantification, acyl selectivity and functional replacement of the Escherichia coli plsC gene. Biochem J. 2002;364(Pt 3):795–805. pmid:12049644
- View Article
- PubMed/NCBI
- Google Scholar
19. Cagliari A, Margis-Pinheiro M, Loss G, Mastroberti AA, de Araujo Mariath JE, Margis R. Identification and expression analysis of castor bean (Ricinus communis) genes encoding enzymes from the triacylglycerol biosynthesis pathway. Plant Sci. 2010;179(5):499–509. pmid:21802608
- View Article
- PubMed/NCBI
- Google Scholar
20. Tomosugi M, Ichihara K, Saito K. Polyamines are essential for the synthesis of 2-ricinoleoyl phosphatidic acid in developing seeds of castor. Planta. 2006;223(2):349–58. pmid:16133210
- View Article
- PubMed/NCBI
- Google Scholar
21. Barroga NAM, Nakamura Y. Lysophosphatidic acid acyltransferase 2 (LPAT2) is required for de novo glycerolipid biosynthesis, growth, and development in vegetative and reproductive tissues of Arabidopsis. Plant J. 2022;112(3):709–21. pmid:36226675
- View Article
- PubMed/NCBI
- Google Scholar
22. Angkawijaya AE, Nguyen VC, Nakamura Y. Enhanced root growth in phosphate-starved Arabidopsis by stimulating de novo phospholipid biosynthesis through the overexpression of lysophosphatidic acid acyltransferase 2 (LPAT2). Plant Cell Environ. 2017;40(9):1807–18. pmid:28548242
- View Article
- PubMed/NCBI
- Google Scholar
23. Yin Y, Raboanatahiry N, Chen K, Chen X, Tian T, Jia J, et al. Class A lysophosphatidic acid acyltransferase 2 from Camelina sativa promotes very long-chain fatty acids accumulation in phospholipid and triacylglycerol. Plant J. 2022;112(5):1141–58. pmid:36209492
- View Article
- PubMed/NCBI
- Google Scholar
24. Sørensen BM, Furukawa-Stoffer TL, Marshall KS, Page EK, Mir Z, Forster RJ, et al. Storage lipid accumulation and acyltransferase action in developing flaxseed. Lipids. 2005;40(10):1043–9. pmid:16382576
- View Article
- PubMed/NCBI
- Google Scholar
25. Sarvas C, Puttick D, Forseille L, Cram D, Smith MA. Ectopic expression of cDNAs from larkspur (Consolida ajacis) for increased synthesis of gondoic acid (cis-11 eicosenoic acid) and its positional redistribution in seed triacylglycerol of Camelina sativa. Planta. 2021;254(2):32. pmid:34287699
- View Article
- PubMed/NCBI
- Google Scholar
26. Zhou Y, Huang X, Hao Y, Cai G, Shi X, Li R, et al. Cloning and functional characterization of a lysophosphatidic acid acyltransferase gene from Perilla frutescens. Sheng Wu Gong Cheng Xue Bao. 2022;38(8):3014–28. pmid:36002428
- View Article
- PubMed/NCBI
- Google Scholar
27. Zhang K, He J, Yin Y, Chen K, Deng X, Yu P, et al. Lysophosphatidic acid acyltransferase 2 and 5 commonly, but differently, promote seed oil accumulation in Brassica napus. Biotechnol Biofuels Bioprod. 2022;15(1):83. pmid:35962411
- View Article
- PubMed/NCBI
- Google Scholar
28. Woodfield HK, Fenyk S, Wallington E, Bates RE, Brown A, Guschina IA, et al. Increase in lysophosphatidate acyltransferase activity in oilseed rape (Brassica napus) increases seed triacylglycerol content despite its low intrinsic flux control coefficient. New Phytol. 2019;224(2):700–11. pmid:31400160
- View Article
- PubMed/NCBI
- Google Scholar
29. Liu F, Xia Y, Wu L, Fu D, Hayward A, Luo J, et al. Enhanced seed oil content by overexpressing genes related to triacylglyceride synthesis. Gene. 2015;557(2):163–71. pmid:25523093
- View Article
- PubMed/NCBI
- Google Scholar
30. Chen S, Lei Y, Xu X, Huang J, Jiang H, Wang J, et al. The peanut (Arachis hypogaea L.) gene AhLPAT2 increases the lipid content of transgenic arabidopsis seeds. PLoS One. 2015;10(8):e0136170. pmid:26302041
- View Article
- PubMed/NCBI
- Google Scholar
31. Chen GQ, van Erp H, Martin-Moreno J, Johnson K, Morales E, Browse J, et al. Expression of castor LPAT2 enhances ricinoleic acid content at the sn-2 position of triacylglycerols in Lesquerella seed. Int J Mol Sci. 2016;17(4):507. pmid:27058535
- View Article
- PubMed/NCBI
- Google Scholar
32. Xing H-L, Dong L, Wang Z-P, Zhang H-Y, Han C-Y, Liu B, et al. A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014;14:327. pmid:25432517
- View Article
- PubMed/NCBI
- Google Scholar
33. Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998;16(6):735–43. pmid:10069079
- View Article
- PubMed/NCBI
- Google Scholar
34. Dai C, Li Y, Li L, Du Z, Lin S, Tian X, et al. An efficient Agrobacterium-mediated transformation method using hypocotyl as explants for Brassica napus. Mol Breeding. 2020;40(10).
- View Article
- Google Scholar
35. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8. pmid:11846609
- View Article
- PubMed/NCBI
- Google Scholar
36. Yang Y, Kong Q, Lim ARQ, Lu S, Zhao H, Guo L, et al. Transcriptional regulation of oil biosynthesis in seed plants: current understanding, applications, and perspectives. Plant Commun. 2022;3(5):100328. pmid:35605194
- View Article
- PubMed/NCBI
- Google Scholar
37. Zhang Q-Y, Niu L-X, Yu R, Zhang X-X, Bai Z-Z, Duan K, et al. Cloning, characterization, and expression analysis of a gene encoding a putative lysophosphatidic acid acyltransferase from seeds of Paeonia rockii. Appl Biochem Biotechnol. 2017;182(2):721–41. pmid:27987185
- View Article
- PubMed/NCBI
- Google Scholar
38. Maisonneuve S, Bessoule J-J, Lessire R, Delseny M, Roscoe TJ. Expression of rapeseed microsomal lysophosphatidic acid acyltransferase isozymes enhances seed oil content in Arabidopsis. Plant Physiol. 2010;152(2):670–84. pmid:19965969
- View Article
- PubMed/NCBI
- Google Scholar
39. Rao SS, Hildebrand D. Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene. Lipids. 2009;44(10):945–51. pmid:19768478
- View Article
- PubMed/NCBI
- Google Scholar
40. Chen GQ, Johnson K, Nazarenus TJ, Ponciano G, Morales E, Cahoon EB. Genetic engineering of Lesquerella with increased ricinoleic acid content in seed oil. Plants (Basel). 2021;10(6):1093. pmid:34072473
- View Article
- PubMed/NCBI
- Google Scholar
41. Tahjib-Ul-Arif M, Zahan MI, Karim MM, Imran S, Hunter CT, Islam MS, et al. Citric acid-mediated abiotic stress tolerance in plants. Int J Mol Sci. 2021;22(13):7235. pmid:34281289
- View Article
- PubMed/NCBI
- Google Scholar
42. Angkawijaya AE, Nguyen VC, Nakamura Y. Lysophosphatidic acid acyltransferases 4 and 5 are involved in glycerolipid metabolism and nitrogen starvation response in Arabidopsis. New Phytol. 2019;224(1):336–51. pmid:31211859
- View Article
- PubMed/NCBI
- Google Scholar
43. Chen X, Snyder CL, Truksa M, Shah S, Weselake RJ. sn-Glycerol-3-phosphate acyltransferases in plants. Plant Signal Behav. 2011;6(11):1695–9. pmid:22057337
- View Article
- PubMed/NCBI
- Google Scholar
44. Compagnon V, Diehl P, Benveniste I, Meyer D, Schaller H, Schreiber L, et al. CYP86B1 is required for very long chain omega-hydroxyacid and alpha, omega -dicarboxylic acid synthesis in root and seed suberin polyester. Plant Physiol. 2009;150(4):1831–43. pmid:19525321
- View Article
- PubMed/NCBI
- Google Scholar
45. Xiao Z, Li N, Wang S, Sun J, Zhang L, Zhang C, et al. Genome-wide identification and comparative expression profile analysis of the long-chain acyl-CoA synthetase (LACS) gene family in two different oil content cultivars of Brassica napus. Biochem Genet. 2019;57(6):781–800. pmid:31011871
- View Article
- PubMed/NCBI
- Google Scholar
46. Zafar S, Li Y-L, Li N-N, Zhu K-M, Tan X-L. Recent advances in enhancement of oil content in oilseed crops. J Biotechnol. 2019;301:35–44. pmid:31158409
- View Article
- PubMed/NCBI
- Google Scholar
47. Ding L-N, Gu S-L, Zhu F-G, Ma Z-Y, Li J, Li M, et al. Long-chain acyl-CoA synthetase 2 is involved in seed oil production in Brassica napus. BMC Plant Biol. 2020;20(1):21. pmid:31931712
- View Article
- PubMed/NCBI
- Google Scholar
48. Kim J, Guan K-L. mTOR as a central hub of nutrient signalling and cell growth. Nat Cell Biol. 2019;21(1):63–71. pmid:30602761
- View Article
- PubMed/NCBI
- Google Scholar
49. Düvel K, Yecies JL, Menon S, Raman P, Lipovsky AI, Souza AL, et al. Activation of a metabolic gene regulatory network downstream of mTOR complex 1. Mol Cell. 2010;39(2):171–83. pmid:20670887
- View Article
- PubMed/NCBI
- Google Scholar
50. Lee G, Zheng Y, Cho S, Jang C, England C, Dempsey JM, et al. Post-transcriptional Regulation of De Novo Lipogenesis by mTORC1-S6K1-SRPK2 Signaling. Cell. 2017;171(7):1545–1558.e18. pmid:29153836
- View Article
- PubMed/NCBI
- Google Scholar
51. Li R, Sun R, Hicks GR, Raikhel NV. Arabidopsis ribosomal proteins control vacuole trafficking and developmental programs through the regulation of lipid metabolism. Proc Natl Acad Sci U S A. 2015;112(1):E89–98. pmid:25535344
- View Article
- PubMed/NCBI
- Google Scholar
52. Sun L, Yu Y, Hu W, Min Q, Kang H, Li Y, et al. Ribosomal protein S6 kinase1 coordinates with TOR-Raptor2 to regulate thylakoid membrane biosynthesis in rice. Biochim Biophys Acta. 2016;1861(7):639–49. pmid:27102613
- View Article
- PubMed/NCBI
- Google Scholar
53. Ren H, Huang C, Pan Y, Dommaraju SR, Cui H, Li M, et al. Non-modular fatty acid synthases yield distinct N-terminal acylation in ribosomal peptides. Nat Chem. 2024;16(8):1320–9. pmid:38528101
- View Article
- PubMed/NCBI
- Google Scholar
54. Sztain T, Corpuz JC, Bartholow TG, Sanlley Hernandez JO, Jiang Z, Mellor DA, et al. Interface engineering of carrier-protein-dependent metabolic pathways. ACS Chem Biol. 2023;18(9):2014–22. pmid:37671411
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Zhang M, Fan J, Taylor DC, Ohlrogge JB. DGAT1 and PDAT1 acyltransferases have overlapping functions in Arabidopsis triacylglycerol biosynthesis and are essential for normal pollen and seed development. Plant Cell. 2009;21(12):3885–901. pmid:20040537
View Article
PubMed/NCBI
Google Scholar

[2] View Article

[3] PubMed/NCBI

[4] Google Scholar

[ref2] 2. Yang Y, Benning C. Functions of triacylglycerols during plant development and stress. Curr Opin Biotechnol. 2018;49:191–8. pmid:28987914
View Article
PubMed/NCBI
Google Scholar

[6] View Article

[7] PubMed/NCBI

[8] Google Scholar

[ref3] 3. Sun L-P, Ouyang L-L, Bao H, Liu J-G, Sun Z, Zhou Z-G. Comparison between two isoforms of glycerol-3-phosphate acyltransferase in microalga Myrmecia incisa: subcellular localization and role in triacylglycerol synthesis. Algal Res. 2021;54:102172.
View Article
Google Scholar

[10] View Article

[11] Google Scholar

[ref4] 4. Li Y, Xiao L, Cao H, Cao Y, Zhang L. Phylogenomics and functional analysis of Glycerol-3-Phosphate Acyltransferase (GPAT) genes: a critical role in lipid biosynthesis. Physiol Plant. 2024;176(5):e14509. pmid:39210744
View Article
PubMed/NCBI
Google Scholar

[13] View Article

[14] PubMed/NCBI

[15] Google Scholar

[ref5] 5. Arroyo-Caro JM, Chileh T, Kazachkov M, Zou J, Alonso DL, García-Maroto F. The multigene family of lysophosphatidate acyltransferase (LPAT)-related enzymes in Ricinus communis: cloning and molecular characterization of two LPAT genes that are expressed in castor seeds. Plant Sci. 2013;199–200:29–40. pmid:23265316
View Article
PubMed/NCBI
Google Scholar

[17] View Article

[18] PubMed/NCBI

[19] Google Scholar

[ref6] 6. Jako C, Kumar A, Wei Y, Zou J, Barton DL, Giblin EM, et al. Seed-specific over-expression of an Arabidopsis cDNA encoding a diacylglycerol acyltransferase enhances seed oil content and seed weight. Plant Physiol. 2001;126(2):861–74. pmid:11402213
View Article
PubMed/NCBI
Google Scholar

[21] View Article

[22] PubMed/NCBI

[23] Google Scholar

[ref7] 7. Gao Y, Sun Y, Gao H, Chen Y, Wang X, Xue J, et al. Ectopic overexpression of a type-II DGAT (CeDGAT2-2) derived from oil-rich tuber of Cyperus esculentus enhances accumulation of oil and oleic acid in tobacco leaves. Biotechnol Biofuels. 2021;14(1):76. pmid:33757551
View Article
PubMed/NCBI
Google Scholar

[25] View Article

[26] PubMed/NCBI

[27] Google Scholar

[ref8] 8. Li R, Yu K, Hildebrand DF. DGAT1, DGAT2 and PDAT expression in seeds and other tissues of epoxy and hydroxy fatty acid accumulating plants. Lipids. 2010;45(2):145–57. pmid:20101470
View Article
PubMed/NCBI
Google Scholar

[29] View Article

[30] PubMed/NCBI

[31] Google Scholar

[ref9] 9. Singer SD, Chen G, Mietkiewska E, Tomasi P, Jayawardhane K, Dyer JM, et al. Arabidopsis GPAT9 contributes to synthesis of intracellular glycerolipids but not surface lipids. J Exp Bot. 2016;67(15):4627–38. pmid:27325892
View Article
PubMed/NCBI
Google Scholar

[33] View Article

[34] PubMed/NCBI

[35] Google Scholar

[ref10] 10. Vigeolas H, Waldeck P, Zank T, Geigenberger P. Increasing seed oil content in oil-seed rape (Brassica napus L.) by over-expression of a yeast glycerol-3-phosphate dehydrogenase under the control of a seed-specific promoter. Plant Biotechnol J. 2007;5(3):431–41. pmid:17430545
View Article
PubMed/NCBI
Google Scholar

[37] View Article

[38] PubMed/NCBI

[39] Google Scholar

[ref11] 11. Bates PD. Understanding the control of acyl flux through the lipid metabolic network of plant oil biosynthesis. Biochim Biophys Acta. 2016;1861(9 Pt B):1214–25. pmid:27003249
View Article
PubMed/NCBI
Google Scholar

[41] View Article

[42] PubMed/NCBI

[43] Google Scholar

[ref12] 12. Sah SK, Fan J, Blanford J, Shanklin J, Xu C. physiological functions of phospholipid: diacylglycerol acyltransferases. Plant Cell Physiol. 2024;65:863–71.
View Article
Google Scholar

[45] View Article

[46] Google Scholar

[ref13] 13. Yu B, Wakao S, Fan J, Benning C. Loss of plastidic lysophosphatidic acid acyltransferase causes embryo-lethality in Arabidopsis. Plant Cell Physiol. 2004;45(5):503–10. pmid:15169931
View Article
PubMed/NCBI
Google Scholar

[48] View Article

[49] PubMed/NCBI

[50] Google Scholar

[ref14] 14. Kim HU, Li Y, Huang AHC. Ubiquitous and endoplasmic reticulum-located lysophosphatidyl acyltransferase, LPAT2, is essential for female but not male gametophyte development in Arabidopsis. Plant Cell. 2005;17(4):1073–89. pmid:15772283
View Article
PubMed/NCBI
Google Scholar

[52] View Article

[53] PubMed/NCBI

[54] Google Scholar

[ref15] 15. Wang Y, Zhang W-Z, Song L-F, Zou J-J, Su Z, Wu W-H. Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. Plant Physiol. 2008;148(3):1201–11. pmid:18775970
View Article
PubMed/NCBI
Google Scholar

[56] View Article

[57] PubMed/NCBI

[58] Google Scholar

[ref16] 16. Kim HJ, Silva JE, Iskandarov U, Andersson M, Cahoon RE, Mockaitis K, et al. Structurally divergent lysophosphatidic acid acyltransferases with high selectivity for saturated medium chain fatty acids from Cuphea seeds. Plant J. 2015;84(5):1021–33. pmid:26505880
View Article
PubMed/NCBI
Google Scholar

[60] View Article

[61] PubMed/NCBI

[62] Google Scholar

[ref17] 17. Misra N, Panda PK, Parida BK. Genome-wide identification and evolutionary analysis of algal LPAT genes involved in TAG biosynthesis using bioinformatic approaches. Mol Biol Rep. 2014;41(12):8319–32. pmid:25280541
View Article
PubMed/NCBI
Google Scholar

[64] View Article

[65] PubMed/NCBI

[66] Google Scholar

[ref18] 18. Brown AP, Carnaby S, Brough C, Brazier M, Slabas AR. Limnanthes douglasii lysophosphatidic acid acyltransferases: immunological quantification, acyl selectivity and functional replacement of the Escherichia coli plsC gene. Biochem J. 2002;364(Pt 3):795–805. pmid:12049644
View Article
PubMed/NCBI
Google Scholar

[68] View Article

[69] PubMed/NCBI

[70] Google Scholar

[ref19] 19. Cagliari A, Margis-Pinheiro M, Loss G, Mastroberti AA, de Araujo Mariath JE, Margis R. Identification and expression analysis of castor bean (Ricinus communis) genes encoding enzymes from the triacylglycerol biosynthesis pathway. Plant Sci. 2010;179(5):499–509. pmid:21802608
View Article
PubMed/NCBI
Google Scholar

[72] View Article

[73] PubMed/NCBI

[74] Google Scholar

[ref20] 20. Tomosugi M, Ichihara K, Saito K. Polyamines are essential for the synthesis of 2-ricinoleoyl phosphatidic acid in developing seeds of castor. Planta. 2006;223(2):349–58. pmid:16133210
View Article
PubMed/NCBI
Google Scholar

[76] View Article

[77] PubMed/NCBI

[78] Google Scholar

[ref21] 21. Barroga NAM, Nakamura Y. Lysophosphatidic acid acyltransferase 2 (LPAT2) is required for de novo glycerolipid biosynthesis, growth, and development in vegetative and reproductive tissues of Arabidopsis. Plant J. 2022;112(3):709–21. pmid:36226675
View Article
PubMed/NCBI
Google Scholar

[80] View Article

[81] PubMed/NCBI

[82] Google Scholar

[ref22] 22. Angkawijaya AE, Nguyen VC, Nakamura Y. Enhanced root growth in phosphate-starved Arabidopsis by stimulating de novo phospholipid biosynthesis through the overexpression of lysophosphatidic acid acyltransferase 2 (LPAT2). Plant Cell Environ. 2017;40(9):1807–18. pmid:28548242
View Article
PubMed/NCBI
Google Scholar

[84] View Article

[85] PubMed/NCBI

[86] Google Scholar

[ref23] 23. Yin Y, Raboanatahiry N, Chen K, Chen X, Tian T, Jia J, et al. Class A lysophosphatidic acid acyltransferase 2 from Camelina sativa promotes very long-chain fatty acids accumulation in phospholipid and triacylglycerol. Plant J. 2022;112(5):1141–58. pmid:36209492
View Article
PubMed/NCBI
Google Scholar

[88] View Article

[89] PubMed/NCBI

[90] Google Scholar

[ref24] 24. Sørensen BM, Furukawa-Stoffer TL, Marshall KS, Page EK, Mir Z, Forster RJ, et al. Storage lipid accumulation and acyltransferase action in developing flaxseed. Lipids. 2005;40(10):1043–9. pmid:16382576
View Article
PubMed/NCBI
Google Scholar

[92] View Article

[93] PubMed/NCBI

[94] Google Scholar

[ref25] 25. Sarvas C, Puttick D, Forseille L, Cram D, Smith MA. Ectopic expression of cDNAs from larkspur (Consolida ajacis) for increased synthesis of gondoic acid (cis-11 eicosenoic acid) and its positional redistribution in seed triacylglycerol of Camelina sativa. Planta. 2021;254(2):32. pmid:34287699
View Article
PubMed/NCBI
Google Scholar

[96] View Article

[97] PubMed/NCBI

[98] Google Scholar

[ref26] 26. Zhou Y, Huang X, Hao Y, Cai G, Shi X, Li R, et al. Cloning and functional characterization of a lysophosphatidic acid acyltransferase gene from Perilla frutescens. Sheng Wu Gong Cheng Xue Bao. 2022;38(8):3014–28. pmid:36002428
View Article
PubMed/NCBI
Google Scholar

[100] View Article

[101] PubMed/NCBI

[102] Google Scholar

[ref27] 27. Zhang K, He J, Yin Y, Chen K, Deng X, Yu P, et al. Lysophosphatidic acid acyltransferase 2 and 5 commonly, but differently, promote seed oil accumulation in Brassica napus. Biotechnol Biofuels Bioprod. 2022;15(1):83. pmid:35962411
View Article
PubMed/NCBI
Google Scholar

[104] View Article

[105] PubMed/NCBI

[106] Google Scholar

[ref28] 28. Woodfield HK, Fenyk S, Wallington E, Bates RE, Brown A, Guschina IA, et al. Increase in lysophosphatidate acyltransferase activity in oilseed rape (Brassica napus) increases seed triacylglycerol content despite its low intrinsic flux control coefficient. New Phytol. 2019;224(2):700–11. pmid:31400160
View Article
PubMed/NCBI
Google Scholar

[108] View Article

[109] PubMed/NCBI

[110] Google Scholar

[ref29] 29. Liu F, Xia Y, Wu L, Fu D, Hayward A, Luo J, et al. Enhanced seed oil content by overexpressing genes related to triacylglyceride synthesis. Gene. 2015;557(2):163–71. pmid:25523093
View Article
PubMed/NCBI
Google Scholar

[112] View Article

[113] PubMed/NCBI

[114] Google Scholar

[ref30] 30. Chen S, Lei Y, Xu X, Huang J, Jiang H, Wang J, et al. The peanut (Arachis hypogaea L.) gene AhLPAT2 increases the lipid content of transgenic arabidopsis seeds. PLoS One. 2015;10(8):e0136170. pmid:26302041
View Article
PubMed/NCBI
Google Scholar

[116] View Article

[117] PubMed/NCBI

[118] Google Scholar

[ref31] 31. Chen GQ, van Erp H, Martin-Moreno J, Johnson K, Morales E, Browse J, et al. Expression of castor LPAT2 enhances ricinoleic acid content at the sn-2 position of triacylglycerols in Lesquerella seed. Int J Mol Sci. 2016;17(4):507. pmid:27058535
View Article
PubMed/NCBI
Google Scholar

[120] View Article

[121] PubMed/NCBI

[122] Google Scholar

[ref32] 32. Xing H-L, Dong L, Wang Z-P, Zhang H-Y, Han C-Y, Liu B, et al. A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014;14:327. pmid:25432517
View Article
PubMed/NCBI
Google Scholar

[124] View Article

[125] PubMed/NCBI

[126] Google Scholar

[ref33] 33. Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998;16(6):735–43. pmid:10069079
View Article
PubMed/NCBI
Google Scholar

[128] View Article

[129] PubMed/NCBI

[130] Google Scholar

[ref34] 34. Dai C, Li Y, Li L, Du Z, Lin S, Tian X, et al. An efficient Agrobacterium-mediated transformation method using hypocotyl as explants for Brassica napus. Mol Breeding. 2020;40(10).
View Article
Google Scholar

[132] View Article

[133] Google Scholar

[ref35] 35. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8. pmid:11846609
View Article
PubMed/NCBI
Google Scholar

[135] View Article

[136] PubMed/NCBI

[137] Google Scholar

[ref36] 36. Yang Y, Kong Q, Lim ARQ, Lu S, Zhao H, Guo L, et al. Transcriptional regulation of oil biosynthesis in seed plants: current understanding, applications, and perspectives. Plant Commun. 2022;3(5):100328. pmid:35605194
View Article
PubMed/NCBI
Google Scholar

[139] View Article

[140] PubMed/NCBI

[141] Google Scholar

[ref37] 37. Zhang Q-Y, Niu L-X, Yu R, Zhang X-X, Bai Z-Z, Duan K, et al. Cloning, characterization, and expression analysis of a gene encoding a putative lysophosphatidic acid acyltransferase from seeds of Paeonia rockii. Appl Biochem Biotechnol. 2017;182(2):721–41. pmid:27987185
View Article
PubMed/NCBI
Google Scholar

[143] View Article

[144] PubMed/NCBI

[145] Google Scholar

[ref38] 38. Maisonneuve S, Bessoule J-J, Lessire R, Delseny M, Roscoe TJ. Expression of rapeseed microsomal lysophosphatidic acid acyltransferase isozymes enhances seed oil content in Arabidopsis. Plant Physiol. 2010;152(2):670–84. pmid:19965969
View Article
PubMed/NCBI
Google Scholar

[147] View Article

[148] PubMed/NCBI

[149] Google Scholar

[ref39] 39. Rao SS, Hildebrand D. Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene. Lipids. 2009;44(10):945–51. pmid:19768478
View Article
PubMed/NCBI
Google Scholar

[151] View Article

[152] PubMed/NCBI

[153] Google Scholar

[ref40] 40. Chen GQ, Johnson K, Nazarenus TJ, Ponciano G, Morales E, Cahoon EB. Genetic engineering of Lesquerella with increased ricinoleic acid content in seed oil. Plants (Basel). 2021;10(6):1093. pmid:34072473
View Article
PubMed/NCBI
Google Scholar

[155] View Article

[156] PubMed/NCBI

[157] Google Scholar

[ref41] 41. Tahjib-Ul-Arif M, Zahan MI, Karim MM, Imran S, Hunter CT, Islam MS, et al. Citric acid-mediated abiotic stress tolerance in plants. Int J Mol Sci. 2021;22(13):7235. pmid:34281289
View Article
PubMed/NCBI
Google Scholar

[159] View Article

[160] PubMed/NCBI

[161] Google Scholar

[ref42] 42. Angkawijaya AE, Nguyen VC, Nakamura Y. Lysophosphatidic acid acyltransferases 4 and 5 are involved in glycerolipid metabolism and nitrogen starvation response in Arabidopsis. New Phytol. 2019;224(1):336–51. pmid:31211859
View Article
PubMed/NCBI
Google Scholar

[163] View Article

[164] PubMed/NCBI

[165] Google Scholar

[ref43] 43. Chen X, Snyder CL, Truksa M, Shah S, Weselake RJ. sn-Glycerol-3-phosphate acyltransferases in plants. Plant Signal Behav. 2011;6(11):1695–9. pmid:22057337
View Article
PubMed/NCBI
Google Scholar

[167] View Article

[168] PubMed/NCBI

[169] Google Scholar

[ref44] 44. Compagnon V, Diehl P, Benveniste I, Meyer D, Schaller H, Schreiber L, et al. CYP86B1 is required for very long chain omega-hydroxyacid and alpha, omega -dicarboxylic acid synthesis in root and seed suberin polyester. Plant Physiol. 2009;150(4):1831–43. pmid:19525321
View Article
PubMed/NCBI
Google Scholar

[171] View Article

[172] PubMed/NCBI

[173] Google Scholar

[ref45] 45. Xiao Z, Li N, Wang S, Sun J, Zhang L, Zhang C, et al. Genome-wide identification and comparative expression profile analysis of the long-chain acyl-CoA synthetase (LACS) gene family in two different oil content cultivars of Brassica napus. Biochem Genet. 2019;57(6):781–800. pmid:31011871
View Article
PubMed/NCBI
Google Scholar

[175] View Article

[176] PubMed/NCBI

[177] Google Scholar

[ref46] 46. Zafar S, Li Y-L, Li N-N, Zhu K-M, Tan X-L. Recent advances in enhancement of oil content in oilseed crops. J Biotechnol. 2019;301:35–44. pmid:31158409
View Article
PubMed/NCBI
Google Scholar

[179] View Article

[180] PubMed/NCBI

[181] Google Scholar

[ref47] 47. Ding L-N, Gu S-L, Zhu F-G, Ma Z-Y, Li J, Li M, et al. Long-chain acyl-CoA synthetase 2 is involved in seed oil production in Brassica napus. BMC Plant Biol. 2020;20(1):21. pmid:31931712
View Article
PubMed/NCBI
Google Scholar

[183] View Article

[184] PubMed/NCBI

[185] Google Scholar

[ref48] 48. Kim J, Guan K-L. mTOR as a central hub of nutrient signalling and cell growth. Nat Cell Biol. 2019;21(1):63–71. pmid:30602761
View Article
PubMed/NCBI
Google Scholar

[187] View Article

[188] PubMed/NCBI

[189] Google Scholar

[ref49] 49. Düvel K, Yecies JL, Menon S, Raman P, Lipovsky AI, Souza AL, et al. Activation of a metabolic gene regulatory network downstream of mTOR complex 1. Mol Cell. 2010;39(2):171–83. pmid:20670887
View Article
PubMed/NCBI
Google Scholar

[191] View Article

[192] PubMed/NCBI

[193] Google Scholar

[ref50] 50. Lee G, Zheng Y, Cho S, Jang C, England C, Dempsey JM, et al. Post-transcriptional Regulation of De Novo Lipogenesis by mTORC1-S6K1-SRPK2 Signaling. Cell. 2017;171(7):1545–1558.e18. pmid:29153836
View Article
PubMed/NCBI
Google Scholar

[195] View Article

[196] PubMed/NCBI

[197] Google Scholar

[ref51] 51. Li R, Sun R, Hicks GR, Raikhel NV. Arabidopsis ribosomal proteins control vacuole trafficking and developmental programs through the regulation of lipid metabolism. Proc Natl Acad Sci U S A. 2015;112(1):E89–98. pmid:25535344
View Article
PubMed/NCBI
Google Scholar

[199] View Article

[200] PubMed/NCBI

[201] Google Scholar

[ref52] 52. Sun L, Yu Y, Hu W, Min Q, Kang H, Li Y, et al. Ribosomal protein S6 kinase1 coordinates with TOR-Raptor2 to regulate thylakoid membrane biosynthesis in rice. Biochim Biophys Acta. 2016;1861(7):639–49. pmid:27102613
View Article
PubMed/NCBI
Google Scholar

[203] View Article

[204] PubMed/NCBI

[205] Google Scholar

[ref53] 53. Ren H, Huang C, Pan Y, Dommaraju SR, Cui H, Li M, et al. Non-modular fatty acid synthases yield distinct N-terminal acylation in ribosomal peptides. Nat Chem. 2024;16(8):1320–9. pmid:38528101
View Article
PubMed/NCBI
Google Scholar

[207] View Article

[208] PubMed/NCBI

[209] Google Scholar

[ref54] 54. Sztain T, Corpuz JC, Bartholow TG, Sanlley Hernandez JO, Jiang Z, Mellor DA, et al. Interface engineering of carrier-protein-dependent metabolic pathways. ACS Chem Biol. 2023;18(9):2014–22. pmid:37671411
View Article
PubMed/NCBI
Google Scholar

[211] View Article

[212] PubMed/NCBI

[213] Google Scholar

Figures

Abstract

Introduction

Materials and methods

Materials

Cloning and bioinformatics analysis of four BnLPAT2 genes in B. napus

Plant expression vector construction and genetic transformation

Determination of seed oil content and fatty acid composition

RNA extraction and qRT-PCR analysis

Transcriptome sequencing analysis of transgenic rapeseed

Results

Cloning and bioinformatics analysis of the BnLPAT2

Analysis of Cis-acting elements in the promoter of BnLPAT2 genes

Expression of BnLPAT2 genes in different tissues

BnLPAT2 genes transformation in Arabidopsis and rapeseed and seed oil content analysis

Transcriptome sequencing analysis of transgenic BnLPAT2 B. napus seeds during development

Identification of key genes interacting with the BnLPAT2 gene to regulate lipid accumulation

Discussion

Conclusions

Supporting information

S1 Table. Primers required for BnLPAT2 gene cloning.

S2 Table. Overexpressed BnLPAT2 and CRISPR/ Cas9 primers were identified and detected.

S3 Table. Sequences of primers for BnLPAT2 expression.

S4 Table. Physicochemical properties analysis of four BnLPAT2 in Brassica napus.

S5 Table. Prediction protein secondary structure of BnLPAT2 in Brassica napus.

S6 Table. Detection of the efficiency of editing BnLPAT2 homologous gene and target site using CRISPR/ CAS9 of T0 generation in rapeseed.

S7 Table. The transcriptome sequencing annotation of all genes and their TPM expression levels.

S1 Fig. Construction and detection of expression vector.

S1 Raw Images. The original and uncropped images supporting all blot and gel results reported in an article’s figures and supporting information files.

References

S6 Table. Detection of the efficiency of editing BnLPAT2 homologous gene and target site using CRISPR/ CAS9 of T₀ generation in rapeseed.