Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Molecular cloning and functional verification of chalcone synthase genes from cassava (Manihot esculenta Crantz) in defense against Tetranychus cinnabarinus infestation

  • Yanni Yang,

    Roles Writing – original draft, Writing – review & editing

    Affiliations Guangxi Key Laboratory of Plant Conservation and Restoration Ecology in Karst Terrain, Guangxi Institute of Botany, Guangxi Zhuang Autonomous Region and Chinese Academy of Sciences, Guilin, Guangxi, China, College of Agronomy, Guangxi University, Nanning, China

  • Kaiwen Zheng,

    Roles Data curation, Investigation, Methodology

    Affiliation Guangxi Key Laboratory of Plant Conservation and Restoration Ecology in Karst Terrain, Guangxi Institute of Botany, Guangxi Zhuang Autonomous Region and Chinese Academy of Sciences, Guilin, Guangxi, China

  • Limei Gao,

    Roles Data curation, Investigation, Software

    Affiliation Guangxi Key Laboratory of Plant Conservation and Restoration Ecology in Karst Terrain, Guangxi Institute of Botany, Guangxi Zhuang Autonomous Region and Chinese Academy of Sciences, Guilin, Guangxi, China

  • Yakang Hu,

    Roles Data curation, Resources, Software

    Affiliation Guangxi Key Laboratory of Plant Conservation and Restoration Ecology in Karst Terrain, Guangxi Institute of Botany, Guangxi Zhuang Autonomous Region and Chinese Academy of Sciences, Guilin, Guangxi, China

  • Cuixia Liu,

    Roles Data curation, Investigation, Validation

    Affiliation Guangxi Key Laboratory of Plant Conservation and Restoration Ecology in Karst Terrain, Guangxi Institute of Botany, Guangxi Zhuang Autonomous Region and Chinese Academy of Sciences, Guilin, Guangxi, China

  • Fei Li,

    Roles Data curation, Investigation, Methodology

    Affiliation Guangxi Key Laboratory of Plant Conservation and Restoration Ecology in Karst Terrain, Guangxi Institute of Botany, Guangxi Zhuang Autonomous Region and Chinese Academy of Sciences, Guilin, Guangxi, China

  • Ming Liu

    Roles Funding acquisition, Writing – review & editing

    liuming@gxib.cn

    Affiliation Guangxi Key Laboratory of Plant Conservation and Restoration Ecology in Karst Terrain, Guangxi Institute of Botany, Guangxi Zhuang Autonomous Region and Chinese Academy of Sciences, Guilin, Guangxi, China

Abstract

Secondary metabolites such as flavonoids play an important role in protecting plants from biological agents such as fungi, pathogens, bacteria and pests. Chalcone synthase (CHS) is the first enzyme in the plant flavonoid biosynthesis pathway, and is also a key enzyme and rate-limiting enzyme in the secondary metabolite production pathway, which has very important physiological significance in plants. Despite extensive characterization in various plants, the functions of CHS in cassava remain unknown. Here, MeCHS1, MeCHS3 and MeCHS5 genes from Manihot esculenta Crantz were isolated and functionally analyzed. The results showed that the over-expression of the three MeCHSs were beneficial to control the further reproduction of Tetranychus cinnabarinus. At the same time, the transfer of MeCHS1, MeCHS3 and MeCHS5 genes can promote the synthesis of more secondary metabolites in Arabidopsis thaliana. Heterologous expression in A. thaliana indicated the presence of different expression levels of the three MeCHSs in defense against T. cinnabarinus infestation. Correlation analysis showed that the expression of MeCHSs were positively correlated with the synthesis of secondary metabolites, and negatively correlated with survival rate of T. cinnabarinus. These results indicate that the different expression levels of MeCHS genes lead to the difference in the synthesis of secondary metabolites, and thus the resistance of A. thaliana to T. cinnabarinus is also different.

Introduction

Cassava (Manihot esculenta Crantz, Euphorbiaceae) is one of the most important root tuber energy crops widely cultivated in the tropical and temperate regions such as Asia, Africa and Americas [1]. It has a high carbohydrate production potential and adaptability to a variety of environments, but is susceptible to mites, especially Tetranychus cinnabarinus, which is one of the most serious worldwide pest mites affecting cassava, causing severe economic losses [2].

In our previous study, we found that secondary metabolism products such as flavonoids were increased in cassava leaves infested by T. cinnabarinus [3]. In fact, flavonoids have been shown to have a wide range of biological functions in anthocyanin deposition, resistance to ultraviolet radiation [46], plant growth and development resistance, auxin transport, pollen reproduction, and so forth [79]. In addition, as an antimicrobial metabolite, it plays an important role in protecting plants from biological stresses [10]. Flavonoids are commonly found in the epidermal cells of plant organs such as leaves, flowers, stems, roots, seeds, and fruits. Flavonoids often exist in various chemical forms such as monomers, dimers and oligomers. At present, more than 9000 kinds of flavonoid monomers have been successfully isolated [11].

Flavonoid biosynthesis represents a critical secondary metabolic pathway in plants. The main steps of this pathway have been well-characterized, and the detailed metabolic pathway was illustrated in S1 Fig of the Supplementary Figure. According to the structural differences of the products, the metabolites mainly included the following: flavones, flavonols, anthocyanins, condensed tannins, chalcones and isoflavonoids [12,13]. The metabolites of these flavonoids are derived from the phenylalanine metabolic pathway in plants. The main catalytic enzymes involved in flavonoid biosynthesis include PAL (phenylalanine ammonia-lyase), C4H (cinnamic acid 4-hydroxylase), 4CL (4-coumarate-CoA ligase), CHS (chalcone synthase), F3’H (flavonoid 3’-hydroxylase), FLS (flavonol synthase), DFR (dihydroflavonol 4-reductase), LAR (leucoanthocyanidin reductase), LDOX (leucoanthocyanidin dioxygenase), UFGT (UDP-glucose flavonoid glucosyltransferase) and ANR (anthocyanidin reductase). In higher plants, multiple genes within this pathway have been implicated in biotic defense mechanisms, particularly in response to pathogen attacks. Notably, chalcone synthase (CHS) serves as the first key enzyme and rate-limiting step in this biosynthetic process [14]. Until recently, the role of CHS genes against T. cinnabarinus had not been systematically studied in cassava. In many plant species, CHS was encoded by a small family of genes with highly conserved homology both within and between species [15]. Through the comprehensive study on the CHS family of cassava, we confirmed that some MeCHS genes belonging to the LAP (leucine aminoptidase) subfamily played a crucial role in the mite-resistant response of T. cinnabarinus [16,17].

The product of the CHS reaction is a pivotal precursor for a large array of secondary metabolites derived from malonyl-CoA and p-coumaroyl-CoA. CHS catalyzes the condensation reaction of three molecules of malonyl-CoA and with one molecule of 4-coumaryl-CoA to produce the basic skeleton material of various flavonoid compounds: naringenin chalcone, which is tetrahydroxychalcon [17]. The other pathway is catalyzed by CHS to form Chalcones trihydroxychalcone, which gives the plant flowers a yellow color [18]. Therefore, the chemical reaction catalyzed by CHS lies at the junction of phenylalanine metabolic pathway and flavonoid metabolic pathway, which is also an important rate-limiting step of the whole flavonoid biosynthesis pathway. As a basic material for the synthesis of various flavonoids, chalcones are located in the upstream of the flavonoid biosynthesis pathway. When the substrate from the upstream synthesizes chalcones under the catalysis of CHS, it interacts with a number of downstream enzymes to produce a variety of flavonoid substances.

It is confirmed that the activity of CHS genes were highly regulated by plant development [19,20]. The involvement of CHS in responding against biotic factors as an easily recognized trait has also led to genetics studies of its expression in various organisms such as Phaseolus vulgaris [21], Ipomea purpurea [22] and the fungal [23]. These defensive biological factors included pathogens, bacteria and pests which promote the production of flavonoids [2426]. Since the isolation of complete cDNA copies of CHS mRNA in cultured Petroselinum hortense cells [27] and a genomic clone from Antirrhinum majus [28], isolating CHS genes from various plants has become a hot topic, with the aim of studying their regulation through in vitro manipulation and reintroduction to plants. Through preliminary research, we speculated that MeCHSs could respond to the sucking stress of T. cinnabarinus and play a key role in the process of resisting T. cinnabarinus. Therefore, this study will validate the function of some MeCHSs as candidate anti-mite genes based on the preliminary selecting.

Materials and methods

Plant materials and reagents

The plant material was cassava clone ‘Xinxuan 048’ (XX048), which has been proved to be resistant to T. cinnabarinus infestation in previous experiments [3]. In addition, according to further analysis of proteomics and gene families, it was found that most MeCHS genes were up-regulated in the leaves when infested by T. cinnabarinus for 48 hours (12 mites per leaf). Three-month-old cassava were harvested, frozen in liquid nitrogen after infection, and stored at −80˚C until use.

Plant overexpression vector pBI121-EGFP and Escherichia coli DH5α were purchased from Beijing TransGen Biotech Co., LTD (Beijing, China) and Agrobacterium GV3101 was purchased from Wuhan Boyuan Biotechnology Co., LTD (Wuhan, China). Enzymes and reagents from Takara Biomedical Technology Co., LTD (Dalian, China) are as follows: PrimeScript II First Strand cDNA Synthesis kit, Sal I and Spe I restriction endonucleases, PrimerSTAR Max DNA Polymerase high fidelity Enzyme, 5×In-fusion HD Enzyme Premix; From Beijing TransGen Biotech Co., LTD (Beijing, China) are as follows: EasyPure® Quick Gel Extraction kit, EasyPure® Plasmid MiniPrep Kit, EasyPure® Universal Plant Genomic DNA Kit, IPTG, X-gal, ampicillin (Amp), kanamycin (Kan), Rifampicin (Rif). And Silwet-77 was purchased from Coolaber Technology Co., Ltd., Beijing, China.

RNA extraction, synthesis of cDNA strand and construction of plasmid expression vector

Total RNA was isolated from leaf samples of XX048 by using the HUAYUEYANG RNA extraction kit (Beijing, China), PrimeScript II First Strand cDNA Synthesis kit was used to synthesize cDNA for CDS sequence PCR amplification of CHS target gene coding region in cassava. pBI121-EGFP expression vector plasmid was obtained by using Plasmid MiniPrep Kit. Then the vector plasmid was double-digested with the enzyme Sal I (upstream) and Spe I (downstream). Bases on pBI121-EGFP vector sequence and the enzyme cutting sites (upstream Sal I and downstream Spe I) were combined with the specific primers of MeCHSs CDS sequence, and the primers were designed by Primer 5.0 software for PCR amplification of CHS gene (Table 1).

thumbnail
Table 1. Primer sequence for MeCHS genes clone.

https://doi.org/10.1371/journal.pone.0321276.t001

The CDS sequence of CHS genes were cloned using the cDNA of XX048 leaves as the template, using the DNA polymerase 2×Phanta_Master_Mix (Vazyme Biotech Co., Ltd., Nanjing, China). The reaction system was shown in Table 2:

The PCR cycle conditions of cloned CHS genes were as follows: predenaturation at 95 °C for 3 min, denaturation at 95 °C for 10 s, annealing at 60 °C for 10 s, extension at 72 °C for 2 min and 30 s, 35 cycles were set from denaturation to extension, and then extension at 72 °C for 5 min, and the temperature was set at 10 °C at the end of the reaction. After completing the above setup steps, the solution is placed in the Biometra EasyCycler Gradient for reaction. The PCR products were electrophoretically detected with 1.2% agar gel, and the products containing CHS fragments were recovered with Gel recovery kit. In-Fusion HD Cloning Kit (TAKARA, Japan) was used to link the target gene to the pBI121-EGFP expression vector to obtain the PBI121-MeCHS vector.

Transformation of A. thaliana by floral dip method

After construction of the pBI121-MeCHS vector, it was transferred into A. tumefaciens strain GV3101. The wild-type (WT) A. thaliana (Columbia) plants were then transformed by the floral dip method. WT A. thaliana seedlings with healthy and consistent growth were selected as infection materials. The poded inflorescences were removed before the first infection, and the inflorescences were infected in the infection solution (1/2MS, 10% sucrose, 0.5μg/ml 2-morpholine-ethanesulfonic acid, 0.02% Silwet-77, PH=5.7) for 50s and then moved to the dark environment and continue cultivation for 48h. The function of the infective solution was to promote the attachment and transformation of A. tumefaciens into A. thaliana. After dark culture, the plants were transferred to normal light conditions. In order to improve the infection efficiency, after the first infection, the plant can be infected again every other week for a total of three times, and the plant should be watered normally during the infection. After the infected plants grew normally, the newly grown tidbits were cut off, and the T1 A. thaliana seeds were collected in time after the seeds matured, as shown in Fig 1.

thumbnail
Fig 1. Transform A. thaliana inflorescence.

(A) Infecting the inflorescence of A. thaliana; (B) Collecting seeds of A. thaliana.

https://doi.org/10.1371/journal.pone.0321276.g001

Selection and detection of transgenic A. thaliana

The T1 generation plants were seeded in 1/2 Murashige and Skoog (MS) containing 50 mg/L kanamycin for preliminary selecting. The plants with developed roots and green true leaves were identified as T1 generation plants. The T1 generation A. thaliana plants were selected and cultured for 3⁓4 weeks. The leaves were extracted for detection and positive plants were screened. A. thaliana was cultured in the same way until T3 transgenic seeds were obtained (Fig 2).

thumbnail
Fig 2. Screening transgenic A. thaliana plant.

(A, B) Transgenic A. thaliana screening; (C, D) Transplantation and planting of A. thaliana.

https://doi.org/10.1371/journal.pone.0321276.g002

PCR detection of transgenic A. thaliana

The pBI121-MeCHS vector plasmid was used as positive control, and wild type A. thaliana leaf DNA was used as negative control. AtActin2 gene (NM_001338359.1) was used as a reference to detect by reverse transcription PCR, and the stable genetic homozygous positive plants of T3 generation were obtained.

Tetranychus cinnabarinus rearing

Healthy T. cinnabarinus adults were collected from cassava felds at Agriculture College, Guangxi University. After identifcation, the healthy and active mites were reared on the underside of fresh cassava leaves with careful observation to make sure there were no other impurities. Leaves and mites were placed on a pasteurized, water-soaked sponge and placed in glassware about 30 cm in diameter and 10 cm in height. The leaf margin was wrapped with watersaturated paper to prevent mites from escaping. Mite-infested leaves were kept under the following conditions: temperature 28±1°C, 70±5% relative humidity (RH), and 14 L:10 D photoperiod to the experiments. Fresh leaves were replaced every 2 days. The process of artificial culture of T. cinnabarinus was shown in Fig 3.

thumbnail
Fig 3. Process of artificial culture of T. cinnabarinus.

(A) Cassava leaves on the sponge; (B) Reproduction of T. cinnabarinus; (C) Eggs of T. cinnabarinus in cassava Leaves. (D) The eggs hatch into mature T. cinnabarinus.

https://doi.org/10.1371/journal.pone.0321276.g003

Laboratory evaluation of the damage caused by T. cinnabarinus in transgenic A. thaliana

Transgenic T3 generation and wild type A. thaliana were cultured in pot for about 30⁓45 days. The plants were divided into infested group (10 mites per leaf with T. cinnabarinus) and control group (uninfested). Adult T. cinnabarinus were inoculated on the back of A. thaliana leaves in the infested group. After 24 hours, adult T. cinnabarinus were removed, A. thaliana leaves with eggs were collected. The A. thaliana leaves were continued to grow under conditions as T. cinnabarinus rearing. The following data were collected: a Number of unhatched eggs; b The number of dead mites (including juvenile mites); c Number of living mites. During the experiment, the growth and development of T. cinnabarinus were recorded every 24 hours, and the survival rate of F0 was calculated. F0 survival rate is calculated as follows:c/(a+b+c) [3].

Analysis of secondary metabolites in transgenic A. thaliana

WT and T3 generation A. thaliana for 30⁓45 days were selected for the infestation treatment of T. cinnabarinus. Ten mites per leaf with T. cinnabarinus were inoculated with each A. thaliana for 48h, the leaves were collected and treated, and the phenotype changes were observed and recorded. At the same time, A. thaliana leaves cultured under normal conditions without infection were used as control. After 48h infection, the contents of tannin, flavonoids, total phenols and anthocyanins were determined.

Tannin restores phosphomolybdic acid in an alkaline environment (such as in a sodium carbonate solution), generating a blue compound. The depth of the color was directly proportional to the tannin content, and the solution had a maximum absorption peak at 760 nm. The tannin content was determined by microdetermination, and the kit purchased from Suzhou Keming Biotechnology Co., LTD., Suzhou, China. Then follow the instructions.

The determination of flavonoids in leaves includes the preparation of standard curves and the determination of samples. The production of standard curves refers to the method of Cao et al [29]. The instruments in the standard curve experiment were UV-1800 visible spectrophotometer (Shimadzu Instruments Co., Ltd., Suzhou, China) and Meilen electronic balance (Shenzhen Meifu Electronics Co., Ltd., Shenzhen, China). The sample determination method was as follows: Weigh fresh 0.2g leaves in a 10mL volumetric bottle, add 8mL of 50% ethanol solution, and extract them in a water bath at 70°C for 2 hours. The regression equation of the standard curve was as follows: Y=11.92X-0.012, R2=0.999, (Y was the absorbance value, X was the concentration of standard solution, and R was the correlation coefficient. The formula for calculating flavonoid content was: (Check standard curve value×dilution ratio×total volume of extract)/ sample weight×1000.

Phenols can be restored by tungstate molybdic acid under alkaline conditions to produce blue compounds, and the peak value can be determined at 760nm to obtain the total phenol content of the measured sample. A micromethod was used for the determination of Total Phenols kit, which was purchased from Suzhou Keming Biotechnology Co., LTD., Suzhou China. The determination was performed according to instructions.

Anthocyanin will react with acidic hydrochloric acid ethanol solution, making the solution a red color. The peak wavelength of anthocyanin absorption is 530nm. However, anthocyanins are interfered with by chlorophyll and soluble sugars during extraction. Therefore, in the determination process, the wavelength optical density value of the sample in chlorophyll (650nm) and soluble sugar (620nm) needs to be calculated at the same time. The optical density of anthocyanins was calculated: ODλ=(OD530-OD620)-0.1(OD650-OD620), anthocyanin content (nmol/g)=(ODλ/ε)×(V/m)×10. ODλ: Optical density of anthocyanin at 530nm wavelength;ε: molar extinction coefficient of anthocyanin 4.62×106; V: total volume of extract (mL).

Analysis of MeCHS genes expression in transgenic A. thaliana

The leaves were treated in the same way as above. Total RNA was isolated from transgenic A. thaliana leaves infested and uninfested by T. cinnabarinus samples using the HUAYUEYANG RNA extraction kit (Beijing, China). The first strand of cDNA was synthesized using TransScript® One-Step cDNA Synthesis SuperMix for qPCR (+ gDNA) from TransGen Biotech kit (Beijing, China) for MeCHS genes relative expression analysis, and primers were designed for qRT-PCR using primer 5.0 (Table 3). The housekeeping gene AtActin2 of A. thaliana was used as the endogenous reference gene (AtActin-F: AGCTATGAGTTGCCTGATGG, AtActin-R: ATTGTAAGTGGTCTCGTGAATAC). qRT-PCR was performed using AceQ Universal SYBR qPCR Master Mix kit (Nanjing, China). The reaction system consisted of 2.0 μl cDNA template, 0.4 μl positive and reverse primers, 10 μl 2×ChamQ SYBR qPCR Master Mix, 3.6 μL ddH2O. The PCR reaction instrument was QuantStudioTM 6 Flex Real Time PCR System (ThermoFisher, USA), which was programmed to predenaturate at 95°C for 3min, then react at 95°C for 10s, then react at 60°C for 30s, and then cycle 45 times. Each sample was set up with three replicates, and the relative expression level of each gene was calculated using the 2 − ΔΔCT method, where ΔΔCt = (△Ct target gene - △Ct endogenous reference gene) treatment group - Ct (△Ct target gene - △Ct endogenous reference gene) control group. The data were statistically analyzed with SPSS 18.0 (SPSS Science, Chicago, IL, USA) ANOVA software. Duncan’s method was used to detect the level of significant difference, and P <0.05 was considered statistically significant.

thumbnail
Table 3. The primers of CHS genes for qRT-PCR.

https://doi.org/10.1371/journal.pone.0321276.t003

Data analysis

ANOVA was used for statistical analysis, and SPSS 18.0 (SPSS Science, Chicago, IL, USA) was used for statistical analysis to Duncan’s tests. A value of P < 0.05 was considered a statistically significant difference. SPSS was used for correlation analysis, Pearson analysis was conducted on the mean and standard deviation of the two sample data to obtain the correlation coefficient between samples.

Results

Isolation MeCHSs and construction of expression vectors

RNA was extracted from the leaves of cassava genotypes XX048, and the electrophoretic detection of the extraction results was shown in Fig 4. The three rRNA electrophoresis bands of 28S, 18S and 5S in the sample were clear, and there was no obvious degradation and impurity contamination. The results showed that the total RNA concentration of the eight replicates was in the range of 460⁓900 ng/μl, and the OD260/OD230 value was in the range of 1.95⁓2.12, indicating that the integrity and purity of total RNA could meet the requirements of subsequent experimental studies.

thumbnail
Fig 4. Total RNA electrophoresis of XX048 cassava leaves.

Lane M: Marker DL 2000; Lanes 1-8: total RNA of XX048 cassava leaves.

https://doi.org/10.1371/journal.pone.0321276.g004

cDNA was synthesized by reverse transcription using RNA as template. Then using cDNA as template, PCR amplification of CDS sequence of CHS genes were performed using primers in Table 1. Agarose gel electrophoresis detection results showed that a single bright band appeared in the region of about 1200 bp, and the fragment size was consistent with the expectation, as shown in Fig 5A. The expression vector pBI121-EGFP was double digested with endonuclease Sal I (upstream) and Spe I (downstream) to linearize the vector. The results were shown in Fig 5B. In-fusion ligase was used to connect the gene fragments of MeCHS1, MeCHS3 and MeCHS5 to the linear carrier, and the resulting ligations were transferred into E.coli DH5α. Then, the PBI121-MeCHS plasmid was double-digested by enzyme and verified by bacterial liquid PCR and sequencing. The electrophoresis results were shown in Fig 5C. Sequencing results showed that the gene product sizes of MeCHS1, MeCHS3 and MeCHS5 were 1176 bp, 1170 bp and 1212 bp, respectively, which were consistent with the expected gene sizes (S1 Table in S1 File). It was concluded that MeCHS genes had been successfully connected to the expression vector pBI121-EGFP.

thumbnail
Fig 5. Construction of PBI121-MeCHS vectors.

(A) PCR results of MeCHS1, MeCHS3 and MeCHS5 gene coding regions. Lanes 1-4: PCR of MeCHS1. Lanes 5-8: PCR of MeCHS3. Lanes 9-12: PCR of MeCHS5; Lane M: Marker DL 2000. (B) Double enzyme digestion of pBI121-EGFP. Lane 1: pBI121-EGFP before digestion. Lanes 2-3: pBI121-EGFP after digestion. Lane M: Marker DL15000. (C) Double enzyme digestion of recombinant plasmids PBI121-MeCHS. Lane 1: before digestion of plasmids. Lanes 2-4: PBI121-MeCHS1, PBI121-MeCHS3 and PBI121-MeCHS5 after digestion, respectively; Lane M: Marker DL15000.

https://doi.org/10.1371/journal.pone.0321276.g005

Analysis of MeCHS gene sequence and protein characteristics

Through previous mining of cassava transcriptomic data, three highly expressed MeCHSs were identified and were designated MeCHS1, MeCHS3, MeCHS5. The open reading frames (ORFs) of the sequences were 1176 (MeCHS1), 1170 (MeCHS3) and 1212 bp (MeCHS5) in length, encoding proteins of 391 (42.892 kDa), 389 (42.419 kDa) and 403 (44.786 kDa) residues, respectively. The gene sequences shared 84.14% similarity with AtCHS5 (accession number: AT5G13930.1) and PtCHS8 (accession number: PNT46173). Amino acid sequences of MeCHS1, MeCHS3, MeCHS5, AtCHS5 and PtCHS8 were listed in S2 Table in S1 File. Using Expasy website (https://www.expasy.org/resources/protparam) to analysis the components of MeCHS amino acid sequences, the three amino acids with the highest content in MeCHS1, MeCHS3 and MeCHS5 were Glycine Gly (G), Alanine Ala (A) and Lysine Lys (K), respectively. In addition, the content of Leu (L), Glycine Gly (G) and Alanine Ala (A), Leu (L), Serine Ser (S), Isoleucine Ile (I) were also high. The amino acid sequence comparison results of MeCHSs with A. thaliana CHS5 (AT5G13930.1) and Populus trichocarpa CHS8 (PNT46173) were shown in Fig 6. Besides, we found that these CHSs contained nine highly conserved domains and the structural features of the 9 motifs were listed in S3 Table in S1 File.

thumbnail
Fig 6. Alignment of the deduced amino acid sequence of MeCHSs with other plant CHSs.

The different motifs are represented by different colors for motifs 1-9 and the structural features of the 9 motifs were listed in S3 Table in S1 File.The abbreviations for species and gene accession numbers are Arabidopsis thaliana CHS5 (AT5G13930.1) and Populus trichocarpa CHS8 (PNT46173). Catalytic residues (red), cis -peptide turn (purple), CoA binding residues (pink), and residues of the active site cavity that are structural (yellow), control polyketide size (green), or determine substrate specificity (blue) are shown in triangles.

https://doi.org/10.1371/journal.pone.0321276.g006

Further to the amino acid sequence import SWISS-MODEL software (https://swissmodel.expasy.org/) for MeCHSs protein three dimensional structure prediction and analysis, the results as shown in Fig 7. As can see from the results, the protein structures of the three genes were generally similar, but there were some subtle differences. MeCHS1 protein has 175 α-Helixes, 123 random coils, 62 extension strands and 31 β-Turns; MeCHS3 protein has 177 typical α-Helixes, 135 random coils, 56 extension strands and 21 β-Turns. The MeCHS5 protein has 170 typical α-Helixes, 144 random coils, 64 extended strands, and 25 β-Turns.

thumbnail
Fig 7. Three-dimensional structure prediction of MeCHS proteins.

https://doi.org/10.1371/journal.pone.0321276.g007

According to the above analysis results, although the three genes all belong to MeCHS family, they were different in terms of morphological structure, physical and chemical properties, which may lead to one of the reasons for their functional differences.

Expression vector transformed of Agrobacterium

The obtained recombinant PBI121-MeCHS carrier construction was shown in Fig 8A, and the recombinant plasmid were transformed into Agrobacterium GV3101. As a regulatory element, the 35S promoter from the plant pathogen Cauliflower Mosaic Virus (CaMV) has been instrumental in driving constitutive expression of these transgenes. Subsequently, PCR was performed to verify the bacterial solution, and the results were shown in Fig 8BD.

thumbnail
Fig 8. Verification of transformation of agrobacterium by expression vector PBI121-MeCHS.

(A) Construction of PBI121-MeCHS vectors. (B) PCR detection of Agrobacterium for PBI121-MeCHS1; Lane M: Marker DL2000. (C) PCR detection of Agrobacterium for PBI121-MeCHS3; Lane M: Marker DL2000. (D) PCR detection of Agrobacterium for PBI121-MeCHS5; Lane M: Marker DL2000. +: positive of Agrobacterium liquid.

https://doi.org/10.1371/journal.pone.0321276.g008

Screening and identification of transgenic A. thaliana

After insertion of the cDNA coding sequence into the pBI121 vector to generate an overexpression construct PBI121-MeCHS and transformation with Agrobacterium GV3101, lines stably overexpressing MeCHS1, MeCHS3, MeCHS5 were generated in the Columbia-0 background of A. thaliana. Transgenic A.thaliana T3 seeds were screened in the culture medium containing antibiotics, and the results were shown in Fig 9. Wild type A.thaliana (WT) had all green leaves, while transgenic A.thaliana (Tr-MeCHS1, Tr-MeCHS3 and Tr-MeCHS5) showed albino seedlings in screening media. Those with green leaves were positive A.thaliana transferred to the target gene, as shown in Fig 9A. About 40 days after transplanting and culture of these A.thaliana seedlings, DNA was extracted and then RT-PCR was performed. As shown in Fig 9BD, more than 10 strains of each transgenic line could successfully amplified specific bands consistent with the expected fragment size of MeCHSs, while the wild type did not have any bands, indicating that MeCHSs could be stably expressed at the transcriptional level of transgenic A.thaliana. These results proved that MeCHSs have been successfully transferred into A.thaliana and can be stably inherited, which can be used for further gene verification analysis.

thumbnail
Fig 9. Selection and identification of transgenic A. thaliana.

(A) Resistance Selection of T3 generation seeds from A. thaliana. (B) PCR of transgenic A. thaliana with MeCHS1. Lanes P1: positive control (pBI121-MeCHS1). Lanes 1-10: transgenic A. thaliana with MeCHS1. (C) PCR of transgenic A. thaliana with MeCHS3. Lanes P3: positive control (pBI121-MeCHS3). Lanes 1-10: transgenic A. thaliana with MeCHS3. (D) PCR of transgenic A. thaliana with MeCHS5. Lanes P5: positive control (pBI121-MeCHS5). Lanes 1-10: transgenic A. thaliana with MeCHS5. Lane M: Marker DL 2000. WT: wild type.

https://doi.org/10.1371/journal.pone.0321276.g009

Indoor identification of T. cinnabarinus resistance of transgenic A. thaliana

The experimental materials were wild type (WT) A.thaliana and transgenic A.thaliana plants (Tr-MeCHS1, Tr-MeCHS3 and Tr-MeCHS5). Wild type and transgenic A. thaliana were infected with 10 T. cinnabarinus per leaf, and the adult T. cinnabarinus were removed 24 hours later. The growth and development of the T. cinnabarinus were recorded, and the F0 survival rate was calculated. The results showed that the F0 generation experienced about 4 days from egg to adult T. cinnabarinus, and at 48h after leaf infection, the growth number of T. cinnabarinus reached the highest value both wild and transgenic A. thaliana (Fig 10A, B). At that time, the survival rate of F0 in WT, Tr-MeCHS1, Tr-MeCHS3 and Tr-MeCHS5 leaves were 45.49%, 29.03%, 30.84% and 33.33%, respectively (Fig 10C). Compared with WT, the F0 survival rate of T. cinnabarinus in transgenic A. thaliana were reduced by 36.18% in Tr-MeCHS1, 32.20% in Tr-MeCHS3 and 26.73% in Tr-MeCHS5. The results showed that the survival rate of T. cinnabarinus in transgenic lines were lower than that in wild-type lines, and the difference between them reached a significant level, indicating that the transfer of MeCHS genes were beneficial to control the further reproduction of T. cinnabarinus.

thumbnail
Fig 10. Indoor identification of T. cinnabarinus resistance of transgenic A. thaliana.

(A) Comparison of A. thaliana infested by T. cinnabarinus. (B) Leaf comparison of A. thaliana. (C) F0 generation survival rate of T. cinnabarinus in A. thaliana. WT represented wild A. thaliana, Tr-CHS1, Tr-CHS3, Tr-CHS5 represented transgenic A. thaliana with MeCHS1, MeCHS3 and MeCHS5 respectively.

https://doi.org/10.1371/journal.pone.0321276.g010

Comparison of secondary metabolite contents between wild-type and transgenic A. thaliana

The contents of tannin, flavonoids, total phenols and anthocyanins of transgenic and wild A. thaliana were determined respectively, and the results were shown in Fig 11. Compared with the WT, the tannin activity of Tr-MeCHS1, Tr-MeCHS3 and Tr-MeCHS5 A. thaliana increased 20.25 times, 13.25 times and 9.75 times, respectively. The above values were extremely significantly different (P<0.01). In transgenic A. thaliana the flavonoid content was increased by 2.61 times (Tr-MeCHS1), 2.33 times (Tr-MeCHS3) and 2.10 (Tr-MeCHS5) times respectively, and the values were extremely significantly different compared with the WT A. thaliana. The total phenol content increased by 1.69 times (Tr-MeCHS1), 1.83 times (Tr-MeCHS3) and 1.15 times (Tr-MeCHS5), respectively, and the values were significantly different (P<0.05) compared with the WT lines. The anthocyanin content was increased by 80.26% (Tr-MeCHS1, significantly different compared with WT), 46.46% (Tr-MeCHS3, no significant difference compared with WT) and 19.70% (Tr-MeCHS5, no significant difference compared with WT), respectively.

thumbnail
Fig 11. Comparison of tannins, flavonoids, total phenols and anthocyanins contents between wild-type and transgenic A. thaliana.

WT represented wild A. thaliana, CHS_1, CHS_3, CHS_5 represented transgenic A. thaliana with MeCHS1, MeCHS3 and MeCHS5 respectively. The raw data were listed in S4 Table in S1 File. These values are presented as the mean±standard deviation (SD) based on three biologically independent values. Letters above the histogram indicate the statistical signifcance (p<0.05) and bars with the same letter are not significantly different from each other. The same below.

https://doi.org/10.1371/journal.pone.0321276.g011

Analysis of MeCHS gene relative expression in A. thaliana

Wild type and transgenic A. thaliana were infected with 10 T. cinnabarinus per leaf, and the uninfected group was used as the control. After 48 hours of infection, the CHS genes expressions were measured. As shown in Fig 12, compared with uninfected lines, MeCHSs expression levels of A. thaliana were increased under the sucking stress of T. cinnabarinus. These results indicated that T. cinnabarinus could induce the increase of CHS genes expression. Among the A. thaliana plants (10 experimental replicates) the average gene expression of Tr-MeCHS1 before infection was 3.71 and after infection was 17.31, in which the gene expression of L7 and L1 strains of Tr-MeCHS1 was 12.38 times and 12.14 times compared with non-transgenic A. thaliana, respectively. The average gene expression of Tr-MeCHS3 was 2.93 before infection and 10.31 after infection. The expression of L2 and L10 of Tr-MeCHS3 were 7.67 times and 6.88 times compared with non-transgenic A. thaliana, respectively. The average gene expression of Tr-MeCHS5 was 2.61 before infection and 9.80 after infection. The L9 and L4 of Tr-MeCHS5 had high levels of gene expression, which were 9.45 times and 9.31 times compared with WT lines, respectively.

thumbnail
Fig 12. Analysis of MeCHS genes relative expression in A. thaliana.

WT represented wild A. thaliana, Tr represented transgenic A. thaliana, BI represented before infection, AI represented after infection. The raw data were listed in S5 Table in S1 File.

https://doi.org/10.1371/journal.pone.0321276.g012

The correlation analysis of MeCHSs expression level with secondary metabolites and survival rate of T. cinnabarinus

The correlation analysis of MeCHS genes expression with secondary metabolites and survival rate of T. cinnabarinus were shown in Table 4. According to the data, the expression level of MeCHSs were extremely significant positive correlation with the content tannin and flavonoid, significant positive correlation with total phenol and anthocyanin content, and negative correlation with F0 survival rate of T. cinnabarinus. The F0 survival rate of T. cinnabarinus were extremely significantly negatively correlated with flavonoid and total phenol content, significantly negatively correlated with tannin and anthocyanin content. According to the above analysis, the genes expression of MeCHS were positively correlated with the synthesis of secondary metabolites, and negatively correlated with the F0 survival rate of T. cinnabarinus. These results indicated that the different expression levels of MeCHS genes lead to different content of secondary metabolites, and finally the A. thaliana had different resistance to T. cinnabarinus.

thumbnail
Table 4. The correlation analysis of MeCHSs expression levels with secondary metabolites and survival rate of T. cinnabarinus.

https://doi.org/10.1371/journal.pone.0321276.t004

Discussion

MeCHSs affected the synthesis and accumulation of secondary metabolites

As the first key enzyme and rate-limiting enzyme in the biosynthesis of secondary metabolites, CHS is located in the upstream of flavonoid biosynthesis pathway and can synthesize the basic skeleton of flavonoid chalcone [30]. Chalcone not only provides the basic carbon skeleton structure for flavonoid substances, but also provides the basic guarantee for the synthesis of secondary metabolites such as isoflavones, flavonoids, tannins and anthocyanins. More importantly, CHS can regulate the synthesis and accumulation of secondary metabolites on other phenylalanine branches through substrate competition.

In this study, the A. thaliana with heterogeneously expressing MeCHS1, MeCHS3 and MeCHS5 genes were infected by T. cinnabarinus, and it was found that the expression level of MeCHSs in all transgenic lines were significantly increased, and the content of secondary metabolites were also increased. Pang found a significant positive correlation between CHS gene and flavonoid content in Ginkgo biloba [31]. Wang cloned CitCHS1, CitCHS2 and CitCHS3 genes of citrus and transferred them into tobacco or citrus, and found that the production of total flavonoids was regulated by the overall expression of CHS family genes [32]. The results of this study were similar to those of the above experiments, indicating that the synthesis process of secondary metabolites was positively regulated by MeCHSs expression.

MeCHSs can improve the resistance of plants to biotic stress

Since 1983, with the first complete cDNA copy of CHS gene mRNA isolated from cultured Petroselinum hortens cells, nearly 20 functionally distinct CHS superfamilies have been found and further identified [27,33]. In recent years, there have been a large number of reports related to CHS, indicating that CHS exists widely in plants and plays an important role in many physiological and biochemical activities. CHS not only has a variety of biological functions in pigment synthesis, resistance to ultraviolet radiation [4,5,34], resistance to stress, regulation of auxin transport and pollen fertility during growth and development [8,3537], but also plays an important role in preventing plants from being harmed by various pathogens and insect resistance [38]. Several studies have shown that CHS has strong tissue-specific expression when regulated by different factors, such as in response to biological factors such as fungi, pathogens, bacteria, and pest defense. CHS is also significantly associated with the synthesis of flavonoid compounds, and these biological factors promote the production of flavonoids [25,39,40]. Lawton showed that the expression level of CHS in bean cells was significantly increased after being treated with anthrax extract for 20min, and reached the highest value after being treated for 2.5 h, indicating that some activators in anthrax extract induced the expression of CHS gene in beans [41]. Ran found that the emergence of CHSV and CHSVII was significant for the pathogenicity development of pathogenic fungi [23]. The CHS mutant was severely damaged by herbivorous insects and seriously infected by Rhizoctonia solani [24]. Studies have shown that CHS genes were closely related to plant resistance and secondary metabolite synthesis. Different inducible factors increased the expression of CHS, and then promoted the production of flavonoids and other related secondary metabolites. These substances played a vital role in plant resistance as antibiotics or ingestion inhibitors. Although some CHS genes have been reported in plants such as A. thaliana, citrus and beans, less research has been done on the CHS genes in cassava, only its drought resistance has been studied.

In this study, the genes MeCHS1, MeCHS3 and MeCHS5 were transferred into A. thaliana, and then were infected by T. cinnabarinus. The results showed that compared with non-transgenic A. thaliana, the F0 survival rate of T. cinnabarinus in Tr-MeCHS1 decreased by 36.18%, Tr-MeCHS3 by 32.20% and Tr-MeCHS5 by 26.73%. The expression of genes also affects the morphology of leaves. As shown in Fig 10B, the leaves exhibited yellowing after infection. In our experiment, Arabidopsis plants transferred to MeCHS not only inhibited T. cinnabarinus reproduction but also had larger leaves compared with non-transgenic controls. We hypothesize that this enhanced growth was attributable to reduced T. cinnabarinus infestation, which in turn promotes healthier plant development. These results showed that heterologous transformation of MeCHS1, MeCHS3 and MeCHS5 genes from Manihot esculenta Crantz lead to the synthesis of secondary metabolites in A. thaliana which may protect against T. cinnabarinus.

The expression activity of MeCHSs family members were different

Spatiotemporal differences in the expression of CHS gene family led to their different contributions to flavonoid biosynthesis. CHS gene expression in transgenic A. thaliana plants increased under piercing-sucking stress, and the difference between transgenic lines and non-transgenic lines reached an extremely significant level. However, from the experimental results, the expression levels of the three transgenic plants were also inconsistent. Obviously, the expression level of Tr-MeCHS1 gene was higher than the other two CHS gene family members.

Except in blank control plants, the content of secondary metabolites increased significantly in A. thaliana plants with CHS gene. By the biosynthesis determination of the tannins, flavonoids, total phenols and anthocyanins, it was found that A. thaliana plants transferred to MeCHS1 gene had higher expression and higher secondary metabolites. Further study showed that the F0 survival rate of T. cinnabarinus in A. thaliana was reduced to different extent by different MeCHS genes. Correlation analysis showed that the expression of MeCHS genes was positively correlated with the synthesis of secondary metabolites, and negatively correlated with F0 survival rate of T. cinnabarinus. These results indicated that the different expression levels of MeCHSs lead to the difference of secondary metabolites, and thus the resistance of A. thaliana plants to T. cinnabarinus was also different.

Periyasamy reported that CHS genes have different expression patterns, and the study found that the expression activity of two different CHS genes is very different [42]. In recent years, Wang [32] found that the accumulation and total expression levels of three CHS genes and flavonoids in citrus were different, and the correlation coefficients between CitCHS1, CitCHS2 and CitCHS3 and flavonoids were 0.90, 0.43 and 0.80, respectively. Further studies showed that the biosynthesis and reduction of flavonoids could be achieved by controlling the up-regulated or down-regulated expression of the CHS genes. The above results were similar to our experiment.

The study on CHS family genes showed that these genes have some commonalities, such as structural similarity and sequence conservation. The transferred MeCHSs showed similar functions, improving the biosynthesis of flavonoids, and thus inhibiting the reproduction of T. cinnabarinus. However, the expression difference between different members and the internal regulatory mechanism of flavonoid interaction between MeCHS genes still need to be further explored and analyzed.

Conclusion

To verify the gene function of MeCHS1, MeCHS3 and MeCHS5, we constructed plant expression vectors and then heterogeneously expressing them in A. thaliana. Results displayed that the T. cinnabarinus F0 survival rate of A. thaliana reached the highest value after inoculation in their leaves for 48h. However, it decreased in transgenic A. thaliana, and the difference between the transgenic and wild type reached a significant level, indicating that overexpression of CHS genes were conducive to controlling the further reproduction of T. cinnabarinus. Meanwhile, MeCHS1, MeCHS3 and MeCHS5 genes could promote A. thaliana to synthesize more secondary metabolites such as tannins, flavonoids, total phenols and anthocyanins. The results of gene expression analysis showed that Tr-MeCHS1 had the highest expression level among the three genes, indicating that the expression levels of different MeCHSs family members were different. Correlation analysis showed that the expression of MeCHSs were positively correlated with the synthesis of secondary metabolites, and negatively correlated with F0 survival rate of T. cinnabarinus. In conclusion, the different expression levels of MeCHS genes led to the difference in the synthesis of secondary metabolites, and further affected the resistance of A. thaliana to T. cinnabarinus. This study is of great significance for saving the serious economic loss caused by T. cinnabarinus infestation on cassava. These data will further deepen our understanding both the molecular mechanisms and role of MeCHS genes. In addition, the results will help to further elucidate the effects on T. cinnabarinus and provide a theoretical basis for the potential functions of the specific CHS gene in resistance to mites and other biotic stress.

Supporting information

S1 File.

S1 Table. cDNA sequences of MeCHS1, MeCHS3 and MeCHS5 in cassava. S2 Table. Amino acid sequences of MeCHS1, MeCHS3, MeCHS5, AtCHS5 and PtCHS8. S3 Table. Conserved motifs of MeCHSs. S4 Table. Comparison of tannins, flavonoids, total phenols and anthocyanins contents between wild-type and transgenic Arabidopsis thaliana. S5 Table. Analysis of MeCHS gene relative expression in Arabidopsis thaliana.

https://doi.org/10.1371/journal.pone.0321276.s001

(XLSX)

S1 Fig. Flavonoid biosynthesis pathway.

https://doi.org/10.1371/journal.pone.0321276.s002

(DOCX)

References

  1. 1. Prochnik S, Marri P, Desany B, Rabinowicz P, Kodira C, Mohiuddin M. The cassava genome: current progress, future directions. Tropical Plant Biology. 2012;5(1):88–94.
  2. 2. Ouyang J, Tian Y, Jiang C, et al. Laboratory assays on the effects of a novel acaricide, SYP-9625 on Tetranychus cinnabarinus (Boisduval) and its natural enemy, Neoseiulus californicus (McGregor). PLoS One. 2018;13(5):e0197060.
  3. 3. Yang Y, Luo X, Wei W, Fan Z, Huang T, Pan X. Analysis of leaf morphology, secondary metabolites and proteins related to the resistance to Tetranychus cinnabarinus in cassava (Manihot esculenta Crantz). Sci Rep. 2020;10(1):14197. pmid:32848172
  4. 4. Buer CS, Imin N, Djordjevic MA. Flavonoids: new roles for old molecules. J Integr Plant Biol. 2010;52(1):98–111. pmid:20074144
  5. 5. Falcone Ferreyra ML, Rius SP, Casati P. Flavonoids: biosynthesis, biological functions, and biotechnological applications. Front Plant Sci. 2012;3:222. pmid:23060891
  6. 6. Winkel-Shirley B. Biosynthesis of flavonoids and effects of stress. Curr Opin Plant Biol. 2002;5(3):218–23. pmid:11960739
  7. 7. Lv L, Feng X, Li W, Ke L. High temperature reduces peel color in eggplant (Solanum melongena) as revealed by RNA-seq analysis. Genome. 2019.
  8. 8. Dela G, Or E, Ovadia R, Nissim-Levi A, Weiss D, Oren-Shamir M. Changes in anthocyanin concentration and composition in ‘Jaguar’ rose flowers due to transient high-temperature conditions. Plant Science. 2003;164(3):333–40.
  9. 9. Correia B, Rodriguez JL, Valledor L, Almeida T, Santos C, Cañal MJ, et al. Analysis of the expression of putative heat-stress related genes in relation to thermotolerance of cork oak. J Plant Physiol. 2014;171(6):399–406. pmid:24594391
  10. 10. Schijlen EGWM, de Vos CHR, Martens S, Jonker HH, Rosin FM, Molthoff JW, et al. RNA interference silencing of chalcone synthase, the first step in the flavonoid biosynthesis pathway, leads to parthenocarpic tomato fruits. Plant Physiol. 2007;144(3):1520–30. pmid:17478633
  11. 11. Dixon RA, Xie D-Y, Sharma SB. Proanthocyanidins--a final frontier in flavonoid research? New Phytol. 2005;165(1):9–28. pmid:15720617
  12. 12. Cos P, De Bruyne T, Hermans N, Apers S, Berghe DV, Vlietinck AJ. Proanthocyanidins in health care: current and new trends. Curr Med Chem. 2004;11(10):1345–59. pmid:15134524
  13. 13. Kim C-K, Cho M-A, Choi Y-H, Kim J-A, Kim Y-H, Kim Y-K, et al. Identification and characterization of seed-specific transcription factors regulating anthocyanin biosynthesis in black rice. J Appl Genet. 2011;52(2):161–9. pmid:21286901
  14. 14. Awasthi P, Mahajan V, Jamwal VL, Kapoor N, Rasool S, Bedi YS, et al. Cloning and expression analysis of chalcone synthase gene from Coleus forskohlii. J Genet. 2016;95(3):647–57. pmid:27659336
  15. 15. Meer IMVD, Stuitje AR, Mol JNM, Verma DPS. Regulation of general phenylpropanoid and flavonoid gene expression. 1993.
  16. 16. Yang Y, Liu M, Huang Z. Genomic and Expression Analysis of Cassava (Manihot esculenta Crantz) Chalcone Synthase Genes in Defense against Tetranychus cinnabarinus Infestation. Genes (Basel). 2024;15(3):336. pmid:38540395
  17. 17. Moriguchi T, Kita M, Tomono Y, EndoInagaki T, Omura M. One type of chalcone synthase gene expressed during embryogenesis regulates the flavonoid accumulation in citrus cell cultures. Plant Cell Physiol. 1999;40(6):651–5. pmid:10483126
  18. 18. Nakayama T, Yonekura-Sakakibara K, Sato K, Kikuchi , et al. Aureusidin synthase: A polyphenol oxidase homolog responsible for flower coloration. Science. 2000.
  19. 19. Joseph R, Tanner G, Larkin P. Proanthocyanidin synthesis in the forage legume Onobrychis viciifolia. A study of chalcone synthase, dihydroflavonol 4-reductase and leucoanthocyanidin 4-reductase in developing leaves. Functional Plant Biol. 1998;25(3):271.
  20. 20. Reif HJ, Niesbach U, Deumling B, Saedler H. Cloning and analysis of two genes for chalcone synthase from Petunia hybrida. Molec Gen Genet. 1985;199(2):208–15.
  21. 21. Lawton MA, Dixon RA, Hahlbrock K, Lamb CJ. Elicitor induction of mRNA activity. Rapid effects of elicitor on phenylalanine ammonia-lyase and chalcone synthase mRNA activities in bean cells. Eur J Biochem. 2010;130(1):131–9.
  22. 22. Huttley GA, Durbin ML, Glover DE, Clegg MT. Nucleotide polymorphism in the chalcone synthase‐A locus and evolution of the chalcone synthase multigene family of common morning glory Ipomoea purpurea. Molecular Ecology. 1997;6(6):549–58.
  23. 23. Liu R, Xu C, Zhang Q, Wang S, Fang W. Evolution of the chitin synthase gene family correlates with fungal morphogenesis and adaption to ecological niches. Sci Rep. 2017;7:44527. pmid:28300148
  24. 24. Dao TTH, Linthorst HJM, Verpoorte R. Chalcone synthase and its functions in plant resistance. Phytochem Rev. 2011;10(3):397–412. pmid:21909286
  25. 25. Gabriele M, Frassinetti S, Caltavuturo L, Montero L, Dinelli G, Longo V, et al. Citrus bergamia powder: Antioxidant, antimicrobial and anti-inflammatory properties. Journal of Functional Foods. 2017;31:255–65.
  26. 26. Yazaki K, Sugiyama A, Morita M, Shitan N. Secondary transport as an efficient membrane transport mechanism for plant secondary metabolites. Phytochem Rev. 2007;7(3):513–24.
  27. 27. Reimold U, Kröger M, Kreuzaler F, Hahlbrock K. Coding and 3’ non-coding nucleotide sequence of chalcone synthase mRNA and assignment of amino acid sequence of the enzyme. EMBO J. 1983;2(10):1801–5. pmid:16453477
  28. 28. Wienand U, Sommer H, Schwarz Zs, Shepherd N, Saedler H, Kreuzaler F, et al. A general method to identify plant structural genes among genomic DNA clones using transposable element induced mutations. Molec Gen Genet. 1982;187(2):195–201.
  29. 29. Cao J, Zhao Z, Li Q, Zu Y. The seasonal dynamics of the content of syringin and total flavonoid in different parts of Acanthopanax senticosus. Chinese Bulletin of Botany. 2006;23(3):269–74.
  30. 30. Awasthi P, Gupta AP, Bedi YS, Vishwakarma RA, Gandhi SG. Mannitol Stress Directs Flavonoid Metabolism toward Synthesis of Flavones via Differential Regulation of Two Cytochrome P450 Monooxygenases in Coleus forskohlii. Front Plant Sci. 2016;7:985. pmid:27458469
  31. 31. Pang Y, Shen G, Wu W, Liu X, Lin J, Tan F, et al. Characterization and expression of chalcone synthase gene from Ginkgo biloba. Plant Science. 2005;168(6):1525–31.
  32. 32. Wang Z, Yu Q, Shen W, El Mohtar CA, Zhao X, Gmitter FG Jr. Functional study of CHS gene family members in citrus revealed a novel CHS gene affecting the production of flavonoids. BMC Plant Biol. 2018;18(1):189. pmid:30208944
  33. 33. Pandith S, Ramazan S, Khan M, Reshi Z, Shah M. Chalcone synthases (CHSs): the symbolic type III polyketide synthases. Planta. 2020;251(1).
  34. 34. Winkel-Shirley B. Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol. 2001;126(2):485–93. pmid:11402179
  35. 35. Chennupati P, Seguin P, Chamoun R, Jabaji S. Effects of high-temperature stress on soybean isoflavone concentration and expression of key genes involved in isoflavone synthesis. J Agric Food Chem. 2012;60(51):12421–7. pmid:23199070
  36. 36. Lin-Wang K, Micheletti D, Palmer J, Volz R, Lozano L, Espley R, et al. High temperature reduces apple fruit colour via modulation of the anthocyanin regulatory complex. Plant Cell Environ. 2011;34(7):1176–90. pmid:21410713
  37. 37. Lv LL, Feng XF, Li W, Li K. High temperature reduces peel color in eggplant (Solanum melongena) as revealed by RNA-seq analysis. Genome. 2019;62(7):503–12. pmid:31132325
  38. 38. Schijlen EGWM, de Vos CHR, Martens S, Jonker HH, Rosin FM, Molthoff JW, et al. RNA interference silencing of chalcone synthase, the first step in the flavonoid biosynthesis pathway, leads to parthenocarpic tomato fruits. Plant Physiol. 2007;144(3):1520–30. pmid:17478633
  39. 39. Dao TTH, Linthorst HJM, Verpoorte R. Chalcone synthase and its functions in plant resistance. Phytochem Rev. 2011;10(3):397–412. pmid:21909286
  40. 40. Goławska S, Sprawka I, Lukasik I, Goławski A. Are naringenin and quercetin useful chemicals in pest-management strategies? J Pest Sci (2004). 2014;87(1):173–80. pmid:24563648
  41. 41. Lawton MA, Dixon RA, Hahlbrock K, Lamb CJ. Elicitor induction of mRNA activity. Rapid effects of elicitor on phenylalanine ammonia-lyase and chalcone synthase mRNA activities in bean cells. European Journal of Biochemistry. 1983;130(1):131–9.
  42. 42. Periyasamy K, Baskaran K, Ilakkia A, Vanitha K, Selvaraj S, Sakthisekaran D. Antitumor efficacy of tangeretin by targeting the oxidative stress mediated on 7,12-dimethylbenz(a) anthracene-induced proliferative breast cancer in Sprague-Dawley rats. Cancer Chemother Pharmacol. 2015;75(2):263–72. pmid:25431347