Study design

All studies were conducted at the Wisconsin National Primate Research Center (WNPRC). Three pregnant Indian-origin rhesus macaques (Macaca mulatta) were inoculated intradermally between the scapulae with approximately 1.5 x10⁵ plaque forming units (PFU) of MPXV (hMPXV/USA/MA001/2022 (Lineage B.1, clade IIb)) in the first trimester around gestational day 30 (Table 1). For reference, a macaque pregnancy is considered full term at ~ 168 gestational days [21]. This dose was selected to mimic human skin-to-skin transmission while still ensuring infection in a rhesus macaque and was intermediate between the viral load present in a human skin lesion and a lethal intravenous dose in cynomolgus macaques [22,23]. Dams were free of Macacine herpesvirus 1 (Herpes B), simian retrovirus type D (SRV), simian T-lymphotropic virus type 1 (STLV), and simian immunodeficiency virus (SIV). Blood was collected for viral load testing and skin lesions were counted and swabbed for MPXV DNA according to the schedule in Table 1. The exact number of skin lesions was documented up to 100 lesions or indicated as > 100 if greater than 100 lesions were present. Representative lesions were photographed. Fetal heart rate was monitored by doppler ultrasound during each sedation event.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 1. Timeline of dam inoculation, blood draw, skin lesion counts, fetal heart rate measurement, and skin lesion swab schedule.

https://doi.org/10.1371/journal.pone.0320671.t001

Sex as a biological variable

Our study exclusively examined female pregnant macaques. Fetal sex was not determined prior to inoculation and was not determined at necropsy because it was not predicted to play a large role in vertical transmission in this pilot study.

MPXV stock

The mpox virus (MPXV) clade IIb stock used for this study was expanded from a vial of Monkeypox Virus, hMPXV/USA/MA001/2022 (Lineage B.1, clade IIb). The reagent was deposited by the Centers for Disease Control and Prevention and obtained from BEI Resources (item NR-58622). Briefly, Vero E6 cells (ATCC CRL-1586) were inoculated with stock virus at a multiplicity of infection (MOI) of 0.01. Before inoculation the virus stock was sonicated using a Q-Sonica cuphorn sonicator at 70% power for 30 seconds followed by a 15 second rest. This sonication was repeated for a total of 4x 45-second cycles. Following inoculation, cells were monitored daily. Approximately 80% cytopathic effect (CPE) was observed 48 hours later, at which time virus was harvested by collecting and pelleting cells. The pellet was resuspended in cold PBS and subsequently subjected to 3 freeze/thaw cycles and then sonicated for 4 cycles as described above to lyse cells and release virus. Virus was purified over a 36% sucrose cushion.

MPXV stock sequencing and variant calling

Inactivated MPXV stock gDNA was processed for sequencing using the Oxford Nanopore Technologies SQK-RAD114 rapid sequencing kit. This kit randomly fragments the gDNA and adds adapters required for sequencing to the ends of the fragments. The stock gDNA concentration was 8 ng/ul, and a total of 80 ng of gDNA was processed for sequencing. The processed library was run on an R10.4.1 flow cell for 72 hours under default run conditions. 344,233 reads with a mean length of 2,888 bp were obtained. Reads were imported into Geneious Prime® 2023.2.1 (Biomatters Ltd). The minimap2 mapping algorithm as implemented in this version of Geneious was used to map the reads to the expected MPXV reference sequence (GenBank accession: ON563414) with the following parameters: -x map-ont --frag=yes --eqx -m 60 --secondary=no. The -m override was important to avoid non-specific read mapping to the reference sequence. Within-sample variants were identified using the Geneious Find Variants/SNPs tool with the following key parameters: minimum coverage: 20; minimum variant frequency: 0.25; Maximum P-value: 10e-60.

Ethics statement

The dams were cared for by the staff at the WNPRC in accordance with the regulations outlined in the US Animal Welfare Act, the principles described in the National Research Council’s Guide for the Care and Use of Laboratory Animals [24], and the recommendations of the Weatherall report [25].

Care and use of macaques

Female macaques were co-housed with a compatible male and observed daily for menses and breeding. Pregnancy was detected by abdominal ultrasound at ~ GD20-24, and gestational age was estimated as previously described [26]. For physical examinations, virus inoculations, ultrasound examinations, blood or swab collections, the dams were anesthetized with an intramuscular dose of ketamine (10 mg/kg) to minimize distress and monitored regularly until fully recovered from anesthesia. Blood samples from the femoral or saphenous vein were obtained using a vacutainer system or needle and syringe. The pregnant dams were individually housed in an enclosure with required floor space and fed using a nutritional plan based on recommendations published by the National Research Council [25]. Individual housing was required because MPXV could be transmitted to another macaque that shared the enclosure. They were fed a fixed formula, extruded dry diet with adequate carbohydrate, energy, fat, fiber, mineral, protein, and vitamin content. The dry diet was supplemented with fruits, vegetables, and other edible enrichment (e.g., nuts, cereals, seed mixtures, yogurt, peanut butter, popcorn, etc.) to provide variety to the diet and to reinforce species-specific behaviors such as foraging. To further promote psychological well-being, they were provided with food enrichment, structural enrichment, and/or manipulanda. The dams were evaluated by trained animal care staff at least twice each day for signs of pain, distress, or illness by observing appetite, stool quality, activity level, and physical condition. Any abnormal presentation prompted examination by a veterinarian.

Humane endpoints

The dams were euthanized at the end of the study for collection of fetal, maternal-fetal interface, and maternal tissues. The specific criteria used to determine when the dam should be euthanized were when fetal demise (absence of fetal heart tones) was observed or imminent, based on veterinarian recommendations. Once fetal demise was observed or imminent, dam euthanasia was performed within 2 hours using phenytoin and pentobarbital; no dams died before reaching the study endpoint. The duration of the experiment varied between the three dams, with a range of 5-24 days.

Whole blood preparation

Whole blood was collected in EDTA-treated vacutainer tubes. The EDTA tubes were inverted and whole blood removed, aliquoted, and stored at -80^oC until DNA qPCR.

Viral DNA (vDNA) isolation and quantitative polymerase chain reaction (qPCR)

Viral DNA was extracted from 300 ul fluid samples (including whole blood, urine, CSF, amniotic fluid and eluates from swab samples) using the Viral Total Nucleic Acid Purification Kit for the Maxwell RSC instrument (Promega, Madison WI) with the following modifications. After the addition of the lysis solution, samples were incubated for 10 minutes at room temperature and then at 80°C for 10 minutes.

Viral DNA was quantified using the E9L_NVAR qPCR assay targeting the DNA polymerase gene of non-variola orthopox viruses [27] with the Taqman Fast Advanced Master Mix (LifeTechnologies, Carlsbad, CA). DNA quantification was accomplished by interpolation onto a standard curve consisting of ten-fold serial dilutions of the RGTM 10223 plasmid provided by National Institute of Standards and Technology that contains the target region of the assay. The qPCR reaction contains 500 nM of each forward (5’- TCAACTGAAAAGGCCATCTATGA -3’) and reverse primer (5’-GAGTATAGAGCACTATTTCTAAATCCCA-3’) and 200 nM probe (5’- CCATGCAATATACGTACAAGATAGTAGCCAAC-3’). The cycling conditions are as follows: 95°C for 5 min followed by 50 cycles of 95°C for 15 seconds, 60°C for 1 minute and 72°C for 1 second. The lower limit of detection for this assay is 700 DNA copy Eq/ml.

DNA was extracted from up to 100 mg tissue biopsies. Samples were weighed prior to homogenization in 1 ml Trizol (Invitrogen, Waltham, MA) using the Qiagen TissueLyser II. DNA was recovered from the interphase layer following phase separation using bromochloropropane and was ethanol precipitated, washed with 0.1 M sodium citrate in 10% ethanol. DNA was then pelleted and re-suspended in 8mM sodium hydroxide, buffered with HEPES to ~  pH 7.2. Viral DNA was then quantified by qPCR as described above.

Viral quantification by plaque assay

Assays for replication competent MPXV quantification were performed via plaque assay on confluent monolayers of Vero E6 cells (ATCC CRL-1586). The presence of replication competent virus was assessed in eluates from skin lesion swabs, amniotic fluid collected at necropsy, and homogenates of placental tissues collected at necropsy. Prior to beginning plaque assays, fluid samples (skin lesion swab eluates and amniotic fluid) were either subjected to 3 rounds of sonication using a Fisherbrand Model 505 sonicator with a cup-horn attachment at 70% power for 30 seconds with a 15 second rest in between each round (ID 101) or were not sonicated (ID 102). We assessed the impact of sonication on viral titer in a lesion swab sample from ID 101 and determined sonication had a negligible impact on viral titer (S3C Fig). Prior to plaque assay, placental tissues were weighed, placed in 1mL of infection media (1X DMEM (Gibco)-2% fetal bovine serum) and homogenized using a Dounce tissue grinder to generate a tissue slurry. This tissue slurry was then sonicated using the same parameters described above and clarified by centrifugation at 400xg for 10 seconds. Each 0.1mL aliquot of fluid or tissue slurry supernatant was serially diluted 10-fold in infection media and inoculated on to Vero E6 cells in duplicate in 12-well culture plates. The plates were incubated for 1 hour at 37^oC 5% CO₂ with gentle rocking every 15 minutes to allow for virus adsorption and to ensure even distribution of sample across the monolayer. Following incubation, the monolayers were overlaid with 1mL of overlay media containing a 1:1 mixture of 2.4% microcrystalline cellulose (Beantown Chemical, Hudson, NH, USA) and 2X DMEM (Gibco) with 0.5% bovine serum albumin (v/v), 5% 1M HEPES, 2% GlutaMax (Gibco), and 1% penicillin/streptomycin/amphotericin B solution (Gibco). The plates were incubated for 72 hours at 37^oC 5% CO₂ to allow for plaque formation. After 72 hours, the overlay media was discarded, and the cells were fixed with ice-cold ethanol for 20 minutes at room temperature. The monolayers were stained with 0.5% crystal violet for 10 minutes at room temperature and the number of plaques was counted.

RNA in-situ hybridization (ISH)

To detect Mpox messenger RNA (mRNA) in formalin-fixed paraffin-embedded (FFPE) tissues, ISH was performed as described previously using the RNAscope® 2.5 HD Detection Kit (RED) for FFPE Tissues (Advanced Cell Diagnostics, Newark, CA, USA) [28]. Briefly, an ISH probe targeting fragment 2-1292 of MPXV-specific gene D1L, which aligns to 188309-189622 of KJ642618.1, was designed and synthesized by Advanced Cell Diagnostics (Cat#534671). Tissue sections were deparaffinized with xylene, underwent a series of ethanol washes and peroxidase blocking, and were then heated in kit-provided antigen retrieval buffer and digested by kit-provided proteinase. Sections were exposed to ISH probes and incubated at 40°C in a hybridization oven for 2 hours. After rinsing, ISH signal was amplified using kit-provided Pre-amplifiers and Amplifier conjugated to alkaline phosphatase, and then incubated with a Fast Red substrate solution for 10 minutes at room temperature. Sections were then counterstained with hematoxylin, air-dried, and coverslipped. Photomicrographs were taken on a Nikon Eclipse microscope.

Immunohistochemistry (IHC)

Formalin-fixed, paraffin-embedded sections were subjected to a heat-induced epitope retrieval protocol in Tris-EDTA pH 9 buffer (Abcam, Waltham, MA, USA) at 110^oC for 15 minutes. Slides were blocked with 3% H₂O₂ for 10 minutes and with Background Punisher (Biocare Medical, Concord, CA, USA) for 30 minutes. Sections were immunohistochemically stained using an anti-vaccinia virus primary antibody at 1:1000 (Genetex, Irvine, CA, USA) (S1 Table) diluted in a 5% normal goat serum in Tris buffered saline with 1% Tween-20 and incubated for 30 minutes. An anti-rabbit polymer-horseradish peroxidase conjugated secondary antibody (Biocare Medical, Concord, CA, USA) was used undiluted and incubated 25 minutes at room temperature to detect bound antibody. Signal was visualized with Betazoid DAB Chromagen Kit (Biocare Medical, Concord, CA, USA) and counterstained with hematoxylin. All washes and reagent dilutions were in Tris-buffered saline pH 8.4 with 0.01% Tween-20 (Fisher BioReagents, Waltham, MA, USA). All incubations and washes were conducted at room temperature.

Immunofluorescence (IF) microscopy

Tissue section slides were prepared from paraformaldehyde-fixed, paraffin-embedded blocks. Slides were deparaffinized in xylene and hydrated through an ethanol series. Antigen retrieval was performed in a Tris EDTA pH 9 buffer (Abcam, Waltham, MA, USA) via microwave for 8 min at ~ 95°C. Slides were then blocked in a blocking buffer (2% goat serum, 1% bovine serum albumin, 0.1% Triton X-100 and 0.05% Tween-20 in Tris buffered saline) at room temperature for one hour. Primary antibodies (S1 Table) were diluted in blocking buffer and incubated on the slides overnight at 4°C. CD163 was used as a marker for Hofbauer cells, CD31 for endothelial cells and the apical surface of the syncytiotrophoblast [29], and vimentin for mesenchymal stromal cells. The following day, slides were incubated with secondary antibodies (S1 Table) for 1 hour at room temperature. Slides were coverslipped with a DAPI inclusive mounting media (Prolong Anti Fade, Thermofisher, Waltham MA, USA). Stained tissue sections were imaged using an EVOS AutoFL microscope system (Life Technologies, Grand Island, NY, USA). The light cubes used for fluorescent imaging were Texas Red, Cy5, and DAPI (Life Technologies, Grand Island, NY, USA) for detecting ALEXA 594, ALEXA 647, and DAPI, respectively. Control immunostaining was done with isotype controls (S1 Table) and imaged (S6 Fig).

Statistics

Due to the small sample size described in this study, statistical comparisons between dams were not performed.

Study approval

The University of Wisconsin - Madison approved this work under Institutional Biosafety Committee protocols B00000432, B00000764 and B00000182, and the Institutional Animal Care and Use Committee protocol G006670.

Intradermal inoculation results in systemic MPXV infection

We inoculated three pregnant Indian-origin rhesus macaques (Macaca mulatta) intradermally around gestational day (GD) 30 with clade IIb MPXV derived from a human isolate (Table 1). To ensure that the challenge stock accurately reflected the virus obtained from BEI Resources, the stock was sequenced using long-read Oxford Nanopore sequencing for accurate reconstruction of repetitive sequences in the MPXV genome. After read mapping to the expected MPXV reference sequence (GenBank accession: ON563414.3), a mean of 281x coverage (163x standard deviation) was obtained, with no regions of sequence coverage < 20x. When considering variants detected at ≥ 25% frequency, there were only three single-nucleotide polymorphisms (SNPs) located within the coding sequences for MPXVgp041, MPXV059, and MPXVgp121, relative to the reference sequence (S1 Table). Three insertions of 128 bp, 128 bp, and 342 bp were found along with several small deletions. Most of these insertions and deletions were located within non-coding sequences, including the inverted terminal repeats or between coding sequences (S1 Table). Taken together, the sequence of the challenge stock retained high fidelity to the parental virus.

All dams developed MPXV viremia by 2-5 days post-inoculation (Fig 1A) and skin lesions by 4-7 days post-inoculation (Fig 1B). Skin lesion swabs had high viral loads, with one animal demonstrating increasing skin lesion viral loads following inoculation (ID 101), and the other with consistently high skin lesion viral loads (ID 102) (Fig 1C). Skin lesions first appeared as erythematous macules which progressed to papules, pustules, and ulcerations with multiple skin lesion stages present simultaneously in each dam in the two fetal demise cases (S1 Fig). The dam with an impending miscarriage had multiple intraepidermal pustules near the injection sites but did not have skin lesions sampled prior to euthanasia, so no viral loads were available. Eluates of skin lesion swabs taken at 7 days post-inoculation had replication-competent virus present (except for one lesion from ID 101), with an average titer of 2.5x10⁵ plaque forming units (PFU)/mL between both dams (Fig 1D). This average titer was similar to our intradermal inoculation dose of 1.5 x10⁵ PFU. Skin lesions consisted of intraepidermal pustules, ballooning degeneration of keratinocytes, and neutrophilic dermatitis and vasculitis with multifocal ulceration as well as viral DNA and proteins identified by ISH and IHC (S1 Fig). All of the dams were noted to have decreased appetite at some point after inoculation and received supplementation with oral gavage feeds while sedated for other procedures upon recommendation by veterinary services. Overall, the dams stayed within 1% of their starting weight throughout the study (Fig 1E). No fever was detected from inoculation at any time (Fig 1F).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. Maternal systemic MPXV infection.

(A) Whole blood MPXV DNA viral loads. (B) Skin lesion counts. (C) MPXV DNA viral loads in eluates from swabbed skin lesions. (D) Infectious virus titers in eluates from swabbed skin lesions measured by plaque assay at 7 days post-inoculation. (E) Maternal weight change compared to starting weight, with days where oral gavage feeds were administered noted as white-filled circles. (F) Maternal temperature, with the normal temperature range shown between the dashed lines.

https://doi.org/10.1371/journal.pone.0320671.g001

MPXV is vertically transmitted

Fetal demise was identified in two pregnancies and an impending miscarriage was identified in a third pregnancy. One fetal demise was identified at 14 days post-inoculation (ID 101), another demise at 25 days post-inoculation (ID 102), and an impending miscarriage at 5 days post-inoculation (ID 103). Each demise was identified by the lack of fetal heartbeat present on ultrasound. The impending miscarriage was characterized by significant vaginal bleeding which worsened with abdominal palpation and was verified by the visualization of a large amount of intrauterine fluid between the internal cervical os and amniotic sac on ultrasound. Because active intrauterine hemorrhage, abruption, and imminent fetal loss were suspected, euthanasia was recommended by a veterinarian. All dams were euthanized the day of fetal demise or impending fetal demise with subsequent necropsy examination.

There were high MPXV DNA viral loads in multiple fetal samples in both fetal demise cases, including the brain, eye, heart, kidney, liver, lung, skin (represented by an arm biopsy because of the small size of the fetus), umbilical cord, and cerebrospinal fluid (Fig 2). In contrast, there was no MPXV DNA isolated in the fetal tissues from the impending miscarriage case, at 5 days post-inoculation, likely because vertical transmission had not occurred. The two fetal demise cases had higher viral DNA loads in fetal cerebrospinal fluid than in the maternal-fetal interface (MFI) fluids (amniotic fluid, chorionic fluid), or maternal fluids (cerebrospinal fluid, urine, vaginal secretions) (Fig 2). MPXV DNA was identified within MFI tissues in both cases in which infection progressed beyond 5 days post-inoculation. These MFI tissues included the placenta, decidua, and fetal membranes, and in the one animal where they were assayed, in the amniotic and chorionic membranes (Fig 2). MPXV DNA was more widely disseminated within maternal tissues in the dams where infection progressed to 14 and 25 days post-inoculation, respectively, compared to the pregnancy where infection only progressed to 5 days post-inoculation (Fig 2). The highest maternal tissue viral DNA load occurred in a biopsy of a skin lesion (Fig 2). Placental tissues had infectious MPXV particles identified by plaque assay, with 2-9 x 10⁶ PFU/g of tissue identified from both pregnancies with fetal demise, but no infectious particles were detected in the amniotic fluid (S3A–3B Fig). No fetal tissues were available for plaque assay due to very small fetal sizes. These data suggest that MPXV disseminates in maternal tissues by 5 days post-inoculation and reaches the MFI and fetus by 14-25 days post-inoculation.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. MPXV tissue and body fluid viral loads.

MPXV viral loads were measured at the time of necropsy in fetal, maternal, and maternal-fetal interface (MFI) tissues (A) and body fluids (B). Cerebrospinal fluid (CSF), lymph node (LN), frontal lobe (FL), hippocampus (HC). The average viral load with standard deviation is shown for placental discs and skin because multiple biopsies were obtained for those tissues. For ID 103, bars are below 100 to indicate viral DNA was below the limit of detection.

https://doi.org/10.1371/journal.pone.0320671.g002

MPXV localizes to the placenta, fetal membranes, and chorionic plate

We identified locations where MPXV mRNA and antigens localize within the maternal-fetal interface by ISH and IHC, respectively. MPXV protein and mRNA were identified in the maternal-fetal interface (Fig 3). While MPXV was not visually detectable in the fetal membranes from ID 101, there was intense focal localization in the fused fetal membranes from ID 102 (Fig 3A-D). Likewise, there was no localization of MPXV in the chorionic plate with ID 101 but there was scattered IHC localization of MPXV in ID 102 (Fig 3E-3H). In ID 101, there was one distinct region of intense localization of MPXV mRNA and protein in the decidua basalis, but only a few scattered positive cells within the decidua otherwise (Fig 3I and 3K). With ID 102, there was some localization of MPXV protein by IHC, however there was no detectable ISH signal in near sections of that specimen (Fig 3J and 3L). Finally, within the placental villi, there was intense localization of MPXV in the villous stroma but no apparent localization in the syncytiotrophoblasts or villous cytotrophoblasts in IDs 101 and 102 (Fig 3M-3P and S4 and S5 Figs). We did not evaluate for MPXV antigen or RNA localization in the MFI of ID 103 because DNA viral loads were negative.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. MPXV mRNA and antigen localization within maternal-fetal interface tissues by ISH and IHC.

Representative images from ID 101 and 102 are presented. Fetal membranes (A-D), chorionic plate (E-H), decidua basalis (I-L), and placental villi (M-P) are shown. Images of the full tissue sections from which each of these photomicrographs were derived are shown in S4 and S5 Figs.

https://doi.org/10.1371/journal.pone.0320671.g003

The intense localization of MPXV mRNA and protein in the stroma of the placental villi prompted further IHC to provide insight into the specific infected cells. Immunofluorescent staining for the Hofbauer cell (HBC) marker CD163 demonstrated the abundant presence of HBCs in the villous stroma, however only a minor subset of HBCs appeared to co-immunostain for MPXV proteins (Fig 4A). Co-staining with anti-vimentin, which will stain both HBCs and villous mesenchymal fibroblasts, revealed more widespread co-staining, including of cells with distinctly fibroblastic morphology, suggesting that villous fibroblasts were also infected by MPXV (Fig 4B). Finally, the villous mesenchyme includes placental blood vessels which are part of the fetal circulation. Co-staining with anti-CD31 identified a subset of endothelial cells that were also positive for MPXV protein (Fig 4C). In rhesus macaques, the apical surface of the syncytiotrophoblasts also expresses CD31 [29]. CD31 staining was seen on the apical surface of the villous syncytiotrophoblasts, however there was no co-localization of MPXV in the syncytium. There was also CD31 immunostaining in some places in the intervillous space, which likely reflects platelet-derived CD31 in intervillous fibrin.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. MPXV co-localizes with cell-specific markers in the placental villi.

(A) MPXV co-localizes with CD163, a Hofbauer cell marker. MPXV is seen in few Hofbauer cells (CD163 staining) within the villi (not the majority of Hofbauer cells). (B) MPXV co-localization with vimentin, a marker for villous stromal cells. (C) MPXV co-localization with CD31, an endothelial cell marker which is also expressed on the apical surface of rhesus syncytiotrophoblasts. Representative placental images from ID 101 are shown.

https://doi.org/10.1371/journal.pone.0320671.g004

The placentas of IDs 101 and 102 demonstrated few signs of tissue damage or histiocytic accumulation outside the areas where MPXV antigens were present. Notably, decidual spiral artery vasculitis was mild to absent with MPXV infection (Fig 5A). Chorioamnionitis and chronic villitis were absent, but an increase in villous stromal macrophages were evident (Fig 5B). Endovascular extravillous trophoblasts were negative for MPXV (Fig 5C). There were no placental infarctions, but ID 101 did have a single focus of MPXV infection associated with decidual necrosis (Fig 5D-5E). In summary, the amount of MPXV infection at the maternal-fetal interface was significant but does not appear to cause decidual vasculitis or lead to placental infarctions at this gestational age.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. MPXV does not cause villitis or decidual vasculitis.

(A) The placentas of IDs 101 and 102 demonstrated areas of villous stromal histiocytic accumulation associated with MPXV detection by ISH (red chromogen, arrow heads). The placental epithelium and endovascular extravillous trophoblasts invading the decidual spiral arteries (square) are negative for virus (arrow). There is no acute or chronic villitis (B) and the decidual spiral arteries are negative for leukocytoclastic vasculitis (arrow) (C). One of the animals (101) showed focal decidual necrosis (D) that co-labeled for MPXV virus (arrows outlining brown chromogen, E). *  is a landmark in the upper right corner of panel A to compare image in A (2.5x objective) with image B (10x obj). Images C-E were all photographed with 10x objective.

https://doi.org/10.1371/journal.pone.0320671.g005

MPXV localizes to fetal tissues

We evaluated tissue localization of MPXV mRNA in fetal tissues by ISH to complement the determination of viral burden by qPCR. We identified positive ISH staining in multiple tissues from both cases of fetal demise (Fig 6) with ISH staining in the neural tissue and skin of the head. Both fetuses had ISH staining in the lungs, liver, intercostal muscles, thoracic pleura, diaphragm, and the meninges and dura of the spinal cord. No significant histologic lesions were identified in any fetal tissues by qualitative histopathological analysis (S3 Table).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6. Fetal tissue MPXV ISH.

Multiple regions within the head from the fetus of ID 101 (A) show ISH signal. The dotted line shows the head shape. Note: an area of neuropil was removed for viral load measurements. ISH signal was noted in the skin (B), in the subventricular zone of the anterior horn (C) and the posterior horn (D) of the lateral ventricle, and in the medial neuropil (E). Multiple regions within the torso from the fetus of ID 102 (F) show ISH signal. The dotted line shows the torso shape. ISH signal was found in the lung (G), intercostal muscles (H), liver (I), and in the meninges and dura surrounding the spinal cord (J).

https://doi.org/10.1371/journal.pone.0320671.g006