Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Chemigenetic Ca2+ indicators report elevated Ca2+ levels in endothelial Weibel-Palade bodies

Abstract

Weibel-Palade bodies (WPB) are secretory organelles exclusively found in endothelial cells and among other cargo proteins, contain the hemostatic von-Willebrand factor (VWF). Stimulation of endothelial cells results in exocytosis of WPB and release of their cargo into the vascular lumen, where VWF unfurls into long strings of up to 1000 µm and recruits platelets to sites of vascular injury, thereby mediating a crucial step in the hemostatic response. The function of VWF is strongly correlated to its structure; in order to fulfill its task in the vascular lumen, VWF has to undergo a complex packing/processing after translation into the ER. ER, Golgi and WPB themselves provide a unique milieu for the maturation of VWF, which at the level of the Golgi consists of a low pH and elevated Ca2+ concentrations. WPB are also characterized by low luminal pH, but their Ca2+ content has not been addressed so far. Here, we employed a chemigenetic approach to circumvent the problems of Ca2+ imaging in an acidic environment and show that WPB indeed also harbor elevated Ca2+ concentrations. We also show that depletion of the Golgi resident Ca2+ pump ATP2C1 resulted in only a minor decrease of luminal Ca2+ in WPB suggesting additional mechanisms for Ca2+ uptake into the organelle.

Citation: Terglane J, Mertes N, Weischer S, Zobel T, Johnsson K, Gerke V (2025) Chemigenetic Ca2+ indicators report elevated Ca2+ levels in endothelial Weibel-Palade bodies. PLoS ONE 20(1): e0316854. https://doi.org/10.1371/journal.pone.0316854

Editor: Ludger Johannes, Institut Curie, FRANCE

Received: September 20, 2024; Accepted: December 17, 2024; Published: January 27, 2025

Copyright: © 2025 Terglane et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the manuscript and its Supporting Information file. The minimal data set used to reach the conclusions drawn in the manuscript is given in the Methods and Results sections of the manuscript, the different figures and the Supporting Information.

Funding: This study was supported by the German Research Council (DFG GE514/6-3; SFB 1009-A6). the funding we hereby declare that the funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Weibel-Palade bodies (WPB) are elongated secretory organelles characteristic for endothelial cells that harbor an assortment of different cargo proteins [1–14]. Stimulation of endothelial cells with Ca2+ and cAMP rising agonists triggers exocytosis of WPB and secretion of its stored cargo into the vascular lumen thereby enabling the cells to participate in a variety of physiological processes including hemostasis, inflammation and angiogenesis [15].

The main cargo of WPB is the multidomain protein von Willebrand factor (VWF) which serves important functions in preventing excessive bleeding after blood vessel injury. VWF itself drives the formation of WPB at the trans-Golgi network (TGN) and recruits additional cargo proteins to the organelle [3, 16–25]. The physiologically relevant form of VWF is the multimer; VWF multimers form long strings of concatenated polypeptide chains that are highly potent in recruiting platelets to the site of vascular injury thereby initiating the formation of a platelet plug that stops bleeding [26–29]. Hence, upon traversing the secretory pathway VWF has to undergo a complex conversion in order to be stored in a multimeric and ready-to-be-released form. For this process the ER, Golgi and the storage organelle, WPB, provide a unique environment.

VWF is co-translationally synthesized as a preproprotein into the ER where it subsequently undergoes a C-terminal dimerization by disulfide bridging [30]. VWF continues to dimerize in the Golgi stacks via noncovalent interactions and forms a structure described in the literature as dimeric bouquet [31, 32]. In the TGN, VWF dimers assemble into tubules and multimerize at the N-terminus via formation of disulfide bonds between D´D3 domains of proVWF dimers in neighbouring positions [32–35]. At this stage, the propeptide is cleaved by the Ca2+-dependent protease furin; however, it remains noncovalently associated to the tubulated mature protein [35–38]. In a final step dictated by the organization of the Golgi stacks, multiple VWF quanta are co-packed into newly budding WPB [31]. Subsequently, VWF tubules become tightly packed as the organelle matures and is transported along the microtubule network to the cell periphery [34, 39]. Here, mature WPB are anchored at the actin cytoskeleton awaiting a stimulus for secretion [39–41].

Tubulation, multimerization and tight packing of VWF tubules are crucial for the formation of proper WPB and a prequesite for the hemostatic protein to fulfill its function [24, 26, 28, 29, 34]. Correct packing of VWF in WPB strongly depends on a low organelle pH that requires activity of a WPB-associated V-ATPase [13, 28, 32, 33, 35, 42–47]. Apart from the well-documented presence of elevated proton concentrations in the lumen of WPB [48, 49], nothing is known about ion homeostasis inside WPB. However, such data are important as in vitro analyses indicate that the presence of elevated Ca2+ levels may be required for tubulation and binding of the propeptide to mature VWF [33, 35, 50]. Enrichment of protons and Ca2+ and even other ions is a key feature of many secretory organelles and LROs such as insulin granules and melanosomes, and this specific ionic milieu is required for proper processing and storage of cargo in these organelles [51–54]. In the case of Ca2+, it has also been shown that some of the secretory organelles/LROs are equipped with an appropriate machinery for Ca2+ uptake and release which enables them to participate in Ca2+ signaling [55–61].

Although Ca2+ is required for proper VWF packing/processing in vitro, it is not known whether WPB indeed contain elevated Ca2+ concentrations to fulfill this purpose in cells. To address this, we exploited the ability of the self-labeling HaloTag to be genetically targetable to a subcellular compartment and to bind covalently to synthetic dyes, which are taken up by living cells and show an altered fluorescence in response to Ca2+ binding [62, 63]. Targeting Ca2+ dye-binding HaloTag constructs to WPB revealed that these secretory organelles contain elevated Ca2+ levels most likely required for proper VWF maturation. Furthermore, we show that excessive loading of WPB with Ca2+-chelating dyes and depletion of the Ca2+-transporting ATPase ATP2C1, a Golgi resident protein also found in the WPB proximity proteome, results in the formation of slightly smaller WPB and in a minor decrease of luminal Ca2+ in WPB.

Results

Visualization of intraluminal Ca2+ in WPB

A critical feature of many secretory organelles and LROs such as lysosomes, melanosomes, synaptic vesicles and insulin granules is a low pH often accompanied by an intraluminal accumulation of Ca2+ [52–54, 64, 65]. Furthermore, work employing purified D1D2 and D´D3 domains of VWF suggests that the presence of Ca2+ is required for tubulation of the protein and it was shown that the noncovalent interaction of cleaved D1D2 propeptide homodimers with VWF multimers inside WPB depends on Ca2+ [33, 35]. Therefore, we aimed to determine whether WPB also harbor elevated concentrations of Ca2+, which could be required for proper VWF tubulation and packing. We first addressed this experimentally in live cells by targeting the genetically encoded Ca2+ indicator GCaMP6s to the organelle. GCaMP constitutes a circularly permuted EGFP fused to calmodulin (CaM) and the M13 fragment of myosin light chain kinase with EGFP protonated and only weakly fluorescent in the absence of Ca2+. Upon Ca2+ binding, CaM tightly binds M13 leading to conformational changes that shield EGFP from surrounding water and result in greatly increased fluorescence, thus permitting the use as Ca2+ indicator [66, 67]. The targeting of GCaMP6s to the lumen of WPB was achieved by fusing it in tandem to mApple and the luminal domain of P-selectin, a bona-fide WPB cargo herein referred to as P-sel-lum (S1 Fig in S1 File). Following ectopic expression in primary human endothelial cells (HUVEC) the construct was almost exclusively present in WPB as revealed by the mApple fluorescence. However, no GCaMP6s signal could be detected inside the organelle. As the fluorescence of GCaMPs is pH sensitive and WPB are characterized by a luminal pH of appr. 5.5 we analyzed whether the lack of GCaMP6s signal could be due to the rather acidic environment inside WPB. Therefore, we neutralized the low internal pH of WPB by treating cells with bafilomycin A (BafA1), an inhibitor of the V-ATPase proton pump which is also present on WPB and responsible for luminal acidification [44]. Proton pump inhibition resulted in clear GCaMP6s fluorescence signals in construct-bearing (i.e. mApple-positive) WPB, demonstrating the sensitivity of GFP-derived indicators for an acidic environment [68–71].

To overcome this inherent limitation of fluorescent protein-based indicators [68, 72, 73] which in the case of WPB, led to the failure to monitor elevated Ca2+ levels at the low luminal pH of the unperturbed organelle via GCaMP6s fluorescence, we aimed to combine a genetic targeting strategy with the lower pH sensitivity, higher brightness and photostability of synthetic Ca2+ indicators [74–77]. Therefore, an organelle targeting protein was fused in tandem to the less pH-sensitive fluorescent protein mRFP1 (pKa = 4.5) [68, 78] and to the self-labeling HaloTag, which enables the binding of synthetic indicator moieties [62]. For this chemigenetic approach we utilized the Ca2+ indicator MaPCa-656 developed and characterized earlier [63]. MaPCa-656 comprises a si-rhodamine dye equipped for Ca2+ binding with BAPTA (high-affinity chelator, MaPCa-656high) or the MOBHA (low-affinity chelator, MaPCa-656low) moieties and attached to a chloralkane linker in order to enable capturing by the HaloTag. We first verified the binding of MaPCa-656 to the Halo-tag in an acidic and proteolytic environment as well as the tolerance of the synthetic indicator (fluorescence and Ca2+ binding) towards a low pH by targeting mRFP-Halo to lysosomes, the classical acidic organelle. This was achieved by fusion with the lysosome-resident protein LAMP1 as shown in immunostainings of transfected HUVEC with anti-LAMP1 and anti-Halo antibodies (S2A Fig in S1 File, Table 1). Incubation with MaPCa-656low for 2 h at 37 °C 24 h post transfection showed a labeling of lysosomal structures and reported, based on the fluorescence signal, an elevated intralysosomal concentration of Ca2+ (Fig 1B) compared to the cytosol (Fig 1A). Next, we recruited the MaPCa-656 indicator to WPB by fusing mRFP-Halo to the main cargo of WPB, the glycoprotein VWF. Correct targeting of the construct was verified by the exclusive localization of the mRFP and the anti-HaloTag signal to WPB (S2B Fig in S1 File). HUVEC expressing the VWF-mRFP-Halo construct were then incubated for 2 h at 37 °C with either the MaPCa-656low or the MaPCa-656high Ca2+ indicator. Both indicators showed bright signals in VWF-mRFP-Halo-positive WPB revealing that WPB contain elevated Ca2+ concentrations (Fig 2B and 2C). No major difference between the signals of MaPCa-656low and MaPCa-656high recruited to WPB could be observed, suggesting that the intraluminal Ca2+ concentration of WPB is sufficient to induce a MaPCa-656low response, i.e. in the micromolar range (KD of MaPCa-656low is 457 μM; [63]). Interestingly, there was no significant correlation of the WPB distance from the nucleus to the intraluminal Ca2+ content as estimated by the ratio of the MaPCa-656low to the mRFP signal (S3B Fig in S1 File). As more perinuclear localized WPB are considered less mature as compared to the mature peripheral organelles [15], this finding suggest, that already less mature WPB are characterized by elevated Ca2+ levels. It should be noted here that an impairment of this chemigenetic approach by FRET between mRFP1 and the si-rhodamine moiety of the MaPCa-656 indicators within the tightly packed WPB could be excluded because acceptor photo bleaching resulted in a FRET efficiency with an average of -17.3 (S4 Fig in S1 File).

thumbnail
Download:
Fig 1. MaPCa-656low reports elevated Ca2+ concentrations in lysosomes.

HUVEC transfected with either mRFP-Halo (A) or mRFP-Halo-LAMP1 (B) were incubated with 1 µM MaPCa-656low for 2 h at 37 °C and subjected to live cell microscopy. Note that not all mRFP-Halo-LAMP1 positive lysosomes show enhanced MaPCa-656low fluorescence. Shown are confocal microscopy images displaying maximum intensity projections of z-stacks. Note the cytosolic (A) or lysosomal recruitment (B) of the Ca2+ indicator MaPCa-656low. Scale bars: 10 μm.

https://doi.org/10.1371/journal.pone.0316854.g001

thumbnail
Download:
Fig 2. MaPCa-656 detects Ca2+ in the acidic milieu of VWF-mRFP-Halo positive WPB.

24 h after transfection with a plasmid encoding VWF-mRFP-Halo, confluent HUVEC were incubated with 0.05% DMSO (A), 1 µM of the high affinity Ca2+ indicator MaPCa-656high (B) or 1 µM of the low affinity Ca2+ indicator MaPCa-656low (C) for 2 h at 37 °C and subsequently subjected to live cell imaging. Note that expression of VWF-mRFP-Halo recruits the Ca2+ indicators successfully to WPB and reports elevated Ca2+ concentrations in the organelle. In the entire HUVEC population all WPB positive for the VWF-mRFP-Halo construct (i.e. positive for mRFP fluorescence) also show enhanced MaPCa-656low and MaPCa-656high fluorescence. Shown are confocal microscopy images displaying maximum intensity projections of z-stacks. Scale bars: 10 μm.

https://doi.org/10.1371/journal.pone.0316854.g002

thumbnail
Download:
Table 1. Antibodies used in this study.

https://doi.org/10.1371/journal.pone.0316854.t001

Effect of intra-organelle Ca2+ on the morphological appearance of WPB

The presence of elevated Ca2+ concentrations within WPB provokes questions concerning its origin and function in the context of the organelle. To examine whether Ca2+ fulfills a structural role, possibly by affecting the tubulation of VWF or compaction of VWF tubules, we determined the Feret diameter of the organelle, as it can serve as an indicator for the extent of VWF packing [28, 42, 79]. Cells were incubated for 20 h with MaPCa-656low or DMSO as control, because the MaPCa-656 indicators, targeted with high specificity to WPB, are not only able to report Ca2+ but can also, in particular upon long term treatment, act as Ca2+ chelator reducing the free Ca2+ concentration available for binding to the D1D2 and D´D3 domains of VWF. While VWF-mRFP-Halo-positive WPB in cells treated with DMSO exhibit the longest size with an average Feret diameter of 1.04 µm, cells treated with MaPCa-656low are characterized by somewhat smaller WPB with an average Feret diameter of 0.98 µm (Fig 3). This suggest that reduction of the levels of free available Ca2+ within WPB results in defects in correct VWF compaction and/or tubulation and as a consequence in somewhat shorter organelles.

thumbnail
Download:
Fig 3. Extensive loading of WPB with the synthetic MaPCa Ca2+-Indicators affects WPB size.

4 to 6 h after transfection with a plasmid encoding VWF-mRFP-Halo, HUVEC were incubated with 0.05% DMSO and 1 µM MaPCa-656low for 20 h at 37 °C and subsequently subjected to live cell imaging. The Feret diameter of WPB was determined using the mRFP signal (A). In total 4 experiments were conducted (DMSO: 9567 WPB, MaPCa-656low: 7834 WPB). Boxed area is shown enlarged on the right side (B). Bars indicate the mean. Error bars show SEM. Statistics were conducted using a Mann-Whitney test. ****p≤ 0.0001, ***p≤ 0.001, **p≤0.01, *p≤0.05.

https://doi.org/10.1371/journal.pone.0316854.g003

WPB originate at the TGN which maintains free Ca2+ in the micromolar concentration range mainly due to activity of the Ca2+ ATPase ATP2C1 [80–84]. ATP2C1 was also identified as a WPB-associated candidate protein in a previous APEX2-based proximity proteomic approach employing the WPB-bound GTPase Rab3b as bait [85]. As this suggested that ATP2C1 could be the Ca2+ pump responsible for loading WPB with Ca2+, we analyzed the intracellular distribution of the enzyme in HUVEC by employing immunofluorescence stainings with a set of commercial anti-ATP2C1 antibodies (see Table 1). No obvious costaining with VWF-positive WPB was observed although the antibodies also do not show a clear Golgi labeling either. Therefore, we also employed a HA-tagged ATP2C1 construct, which was ectopically expressed in HUVEC. However, no obvious WPB targeting of this construct was observed suggesting that if at all only a small fraction of the endothelial ATP2C1 is found on WPB (S5 Fig in S1 File). We next investigated whether ATP2C1 activity could participate in the enrichment of Ca2+ inside WPB. Therefore, we depleted the protein via siRNA-mediated knockdown to approximately 20% of the initial level (Fig 4A and 4B) and subsequently analyzed the intra-WPB Ca2+ levels using our chemigenetic approach (Fig 4C). Upon knockdown no major changes in the Golgi morphology could be observed as judged by GM130 fluorescence (S6 Fig in S1 File) and as seen in some but not all other studies using a similar approach [82, 83, 86]. However, the knockdown resulted in a very small decrease in the Feret diameter of WPB (S7 Fig in S1 File) as observed in cells expressing VWF-mRFP-Halo and which were loaded with MaPCa-656low. Next, we estimated WPB-resident Ca2+ levels in these cells by measuring MaPCa intensities in WPB normalized to the expression of VWF-mRFP-Halo. This revealed that Ca2+ is slightly but significantly decreased in siATP2C1 as compared to control siRNA treated HUVEC (Fig 4C). Thus, ATP2C1 could at least in part be responsible for generating elevated intraluminal Ca2+ concentrations in WPB, possibly at the level at the TGN or even in WPB themselves.

thumbnail
Download:
Fig 4. Knockdown of ATP2C1 results in a minor decrease of [Ca2+] in WPB.

A. 24 h post transfection of HUVEC with the respective siRNA cells were lysed and subjected to Western blot analysis with anti-ATP2C1 antibodies. Probing with anti-tubulin antibodies served as loading control. One representative blot is shown on the left (see S8 Fig in S1 File for the entire blot). B. ATP2C1 band intensities of 3 blots were measured and normalized to intensities of the loading control. Mean of the normalized intensity of the siControl samples was set to 100%. Bars indicate mean and error bars show standard deviation. Statistics were conducted using an unpaired t-test with Welch´s correction. ****p≤ 0.0001, ***p≤ 0.001, **p≤0.01, *p≤0.05. C. Cells transfected with the respective siRNA were additionally transfected with VWF-mRFP-Halo and incubated with 1 µM MaPCa-656low for 2 h at 37 °C. MaPCa-656 and mRFP intensities of single WPB were measured during live cell microscopy in 3 independent experiments (siCtrl: 5943 WPB, siATP2C1: 6285 WPB). Bars indicate the mean. Error bars show SEM. Statistics were conducted using a Mann-Whitney test. ****p≤ 0.0001, ***p≤ 0.001, **p≤0.01, *p≤0.05.

https://doi.org/10.1371/journal.pone.0316854.g004

Discussion

The proper packing of the hemostatic VWF requires a decrease in pH along the secretory pathway as well as elevated Ca2+ concentrations in the Golgi and most likely, in the VWF storage organelle, the WPB, itself. While the Golgi is established as a significant intracellular Ca2+ store, Ca2+ within WPB or a WPB-associated machinery for Ca2+ uptake has not been described so far. This study introduces a chemigenetic Ca2+ indicator approach that recorded elevated Ca2+ concentrations in WPB. Furthermore, targeting of the synthetic Ca2+-buffering moiety to WPB resulted in a small decrease in the Feret diameter of the organelle and the Ca2+ content within WPB was slightly affected by siRNA-mediated depletion of the Golgi-resident Ca2+ pump ATP2C1.

Ca2+ was shown to be required for VWF tubulation and association of the propeptide with mature VWF in vitro [33, 35, 50]. However, so far it was not addressed whether WPB indeed contain elevated Ca2+ concentrations. Most likely, this lack of information arose from the difficulty of imaging Ca2+ in an acidic environment. pH-sensitivity of a Ca2+ indicator such as GCaMP6s used in this study can be caused either by the Ca2+ sensing unit or by the fluorophore itself. Fluorescent proteins like GFP, which are incorporated in genetically encoded calcium indicators (GECIs) are intrinsically pH sensitive as a low pH quenches their fluorescence for example via an shift in the absorption spectrum (chromophore protonation) and a decrease in quantum yield (thermal relaxation) [68, 72, 73, 87]. The sensitivity in an acidic environment was also observed in our study upon targeting of the GECI GCaMP6s to WPB. Mature WPB maintain a pH of appr. 5.5. [48, 49] and thus, GCaMP6s fluorescence was quenched efficiently. Accordingly, increasing the intraluminal pH by blocking the WPB associated V-ATPase increased GCaMP6s fluorescence and hinted at the presence of Ca2+ in the organelle (see S1 Fig in S1 File). Synthetic small-molecule fluorophores were the first fluorescent Ca2+ indicators developed [88]. In contrast to GECIs they display superior brightness, higher photostability and are not necessarily intrinsically pH-sensitive but also require synthesis, cellular uptake and lack spatial selectivity [74–77]. By employing a chemigenetic approach in which we successfully targeted the rhodamine-based Ca2+ indicator MaPCa-656 to VWF-mRFP-Halo-positive WPB we could overcome pH-sensitivity of GECIs and detect elevated Ca2+ concentrations within the VWF storage organelle.

The presence of elevated Ca2+ in WPB raises two questions: what is its function within the organelle and where does the Ca2+ originate from?

In vitro studies of Huang et al. [33] showed that purified VWF propeptides dimerize and interact with purified disulfide linked dimers of D´D3 domains in order to form helical tubules. These interactions and the tubule formation only occur at a low pH (pH 6.2) in combination with 10 mM Ca2+. Tubulation of VWF appears to be independent of multimerization [25, 28]; however, as multimer formation and Ca2+-dependent propeptide cleavage were shown to occur in the TGN and precede WPB biogenesis, tubulation also seems to take place in this compartment [35]. This was also suggested by electron microscopy studies [34] and is in line with the idea that VWF tubules are required for pushing the Golgi membrane during WPB formation [34, 89]. Hence, Ca2+ required for these processes could be provided in the Golgi lumen. However, a recent study showed that also nontubular VWF is added to forming WPB suggesting that tubulation partly occurs in the lumen of the storage organelle and providing a purpose for the presence of elevated Ca2+ levels in WPB [90]. In line with the data of Huang et al. [33], the noncovalent interaction between the VWF propeptide and mature VWF, as shown in vitro with purified proteins and purified WPB, also requires a low pH (pH 6.2, 6.4) in combination with the presence of Ca2+ (10mM) [35, 50]. Hence, besides being relevant for WPB biogenesis and maturation, the Ca2+- and pH-dependent interaction of mature VWF and the propeptide might also be important for proper VWF storage by not only initiating but also maintaining the tubular structure. As shown for an increase in pH, a depletion of Ca2+ from WPB might interfere with tubule assembly/compaction and thereby result in structurally altered organelles [28]. This would be in line with our observation that massive loading of WPB with the Ca2+ binding dye MaPCa-656 and thereby buffering the relevant free Ca2+ concentration in the organelle leads to somewhat shorter WPB (Fig 3).

Besides a structural role in proper VWF storage, Ca2+ could also be sequestered by WPB in order to participate in Ca2+ signaling. This would require a machinery for rapid uptake and release as it was already described for other secretory organelles and LROs [55–61]. Goretzko et al. showed that endolysosomal Ca2+ release by TPC2, an ion channel also present on melanosomes, affected CD63 loading from endolysosomes onto WPB in HUVEC. However, neither TPC2 or TPC1 could be detected on WPB and TPC2 was shown not to participate in stimulated WPB exocytosis [55, 91].

Elevated Ca2+ levels in WPB suggest that the Golgi ionic milieu is simply trapped in the lumen of WPB after budding at the TGN and/or that an uptake mechanism exists. For most Ca2+ storage organelles, Ca2+ loading is performed by their membrane bound ATP-driven Ca2+ pumps, SERCA or ATP2C1 [61]. Also described are ion exchanger systems, such as Ca2+/H+ exchangers, or a concerted activity of multiple exchangers as proposed for secretory organelles and LROs which exploit the acidic pH of these organelles for Ca2+ import [51, 53, 59, 92, 93]. Recently TMEM165 was found to be involved in Ca2+ uptake of lysosomes [94, 95]. Interestingly, the ATP2C1 Ca2+ pump was found enriched in the WPB-associated proteome [85] although we could not confirm a colocalization with VWF by conventional immunofluorescence or ectopic expression of a HA-tagged construct. However, siRNA mediated depletion of ATP2C1 in HUVEC resulted in a minor but significant reduction of Ca2+ levels in WPB. This suggests that ATP2C1 present on WPB or the TGN is in part responsible for elevated Ca2+ in WPB.

Instead of being taken up from the cytosol, Ca2+ can also be transported directly between two organelles via membrane contact sites (MCS). Such Ca2+ exchange has been described for ER-mitochondria, ER-TGN or ER-lysosome MCS [96–100]. In a recent study, contacts between mitochondria and WPB were identified supporting the idea that other Ca2+ stores could also be involved in generating and maintaining elevated Ca2+ concentrations in WPB [101].

In summary, we introduce here an approach to visualize intra-organelle Ca2+ levels by combining specific Halo-tag targeting with the use of Ca2+ binding fluorescent dyes permeable to cells. This approach enabled us to show that endothelial WPB harbor elevated Ca2+ levels most likely required to support proper tubulation and packing of VWF tubules which is a prerequisite for optimal unfurling of VWF upon secretion into the blood vessel.

Material and methods

Cell culture and transfection

HUVEC were acquired from PromoCell as cryoconserved pools (C-12203) and cultured on Corning CellBind dishes at 37 °C and 5% CO2 in 1:1 mixed medium comprising M199 medium (PAN-Biotech) supplemented with 10% FCS, 30 µg/ml gentamycin, 0.015 µg/ml amphotericin B, and ECGMII (PromoCell) supplemented with 30 µg/ml gentamycin, 0.015 µg/ml amphotericin B. Experiments were conducted with HUVEC passage 3–5.

HUVEC were transfected using the Amaxa nucleofection system (Lonza) according to the manufacturer´s specifications. Per cuvette, cells from a confluent 20 cm2 dish together with 1–7 µg plasmid DNA and/or 400 pmol siRNA were resuspended in transfection buffer (4 mM KCl, 10 mM MgCl2, 10 mM sodium succinate, 100 mM NaH2PO4, pH 7.4 adjusted with NaOH). For depletion of proteins using siRNA, HUVEC were transfected with 400 pmol of siRNA twice. 48 h after the first transfection the cells were transfected again with the same amount of the respective siRNA. 24 h after the second transfection cells were subjected to live cell microscopy or lysed for Western blot analysis.

For live cell microscopy, transfected HUVEC were seeded on 8-chamber µ-slides (Ibidi, 80827) which were freshly coated with collagen from rat tail (Advanced Biomatrix, 5056) at a concentration of 50 µg/ml in 0.02 M acetic acid solution. Right before imaging HUVEC, the mixed medium was exchanged with Hank´s Balanced Salt Solution (Sigma, H6648), herein referred to as HBSS, supplemented with 20 mM HEPES pH 7.0–7.6 (Sigma, H0887), 1 mM MgCl2 and 0.9 mM CaCl2.

Plasmids and siRNA

For generation of P-sel-lum-GCaMP6s-mApple the soluble luminal domain of P-selectin, herein referred to as P-sel-lum, was amplified from P-sel-lum-mRFP [44] using the following primers: Pr. Fw 5´-ATGGCGAACTGCCAAATAGCCATCTTGTACC, Pr. Rev 5´-CGGCTTCCTGGATAGTCAATGGTCCT and inserted into a GCaMP6s-mApple backbone by using the NEBuilder Hifi DNA Assembly. For the amplification of the GCaMP6s-mApple backbone from TPCN2-GCaMP6s-mApple [91] the following primers were used: Pr. Fw 5´-ATTGACTATCCAGGAAGCCGGCATGACTGGTGGACAGC, Pr. Rev 5´-GCTATTTGGCAGTTCGCCATTGAATTCGAAGCTTGAGCTC.

VWF-mRFP-Halo was obtained by amplification of the HaloTag sequence from pHaloTag-EGFP (Addgene Plasmid No: 86629) and its insertion into a VWF-mRFP plasmid, which was kindly provided by Tom Carter (St. George´s University of London, UK) [102, 103] using NEBuilder Hifi DNA Assembly. The following primers were used: Pr. Fw Halo 5´-TCCACCGGCGCCCTGTACAAAGCCACCATGGCAGAAATC, Pr. Rev Halo 5´-AGGTTCAGGGGGAGGTGTGGTTAGCCGGAAATCTCGAGCGT, Pr. Fw VWF-mRFP backbone 5´-CCACACCTCCCCCTGAACCTG, Pr. Rev VWF-mRFP backbone 5´-TTGTACAGGGCGCCGGTG.

mRFP-Halo-LAMP1 was obtained by exchanging RpHLuorin2 in LAMP1-RpHLuorin2 (Addgene #171720) with mRFP-Halo amplified from VWF-mRFP-Halo using NEBuilder Hifi DNA Assembly. For the amplification of the respective fragments the following primers were used: Pr. Fw mRFP-Halo 5´-CCGGTCATGGCCTCCTCC, Pr. Rev mRFP-Halo 5´-GCCGGAAATCTCGAGCGTCG, Pr. Fw LAMP1 backbone 5´- CGACGCTCGAGATTTCCGGCGGCTCAGGCTCAGCAATGTTTATGGTG, Pr. Rev LAMP1 backbone 5´-TCGGAGGAGGCCATGACCGGGGTGGCGACCGGTGTTGC.

Halo-mRFP was obtained by digestion of pHaloTag-EGFP (Addgene Plasmid No: 86629) and the pmRFP1-N1 vector from Addgene (Plasmid No: 54635) with NheI/KpnI restriction enzymes and the subsequent insertion of the HaloTag sequence in the multiple cloning site of the plasmid.

ATP2C1-HA was kindly provided by Julia von Blume.

siRNA targeting ATP2C1 was obtained from Horizon Discovery (L-006119-00-0010). AllStars Negative Control siRNA was from Qiagen (102781).

Antibodies

For immunofluorescence and western blot analysis the primary and secondary antibodies listed in Table 1 were used.

Western blot analysis

For preparation of cell lysates, HUVEC were harvested using trypsin/EDTA. After washing once with PBS, cell pellets were resuspended in 30 µl RIPA buffer (25 mM Tris-HCl, 150 mM NaCl, 0.1% (w/v) SDS, 0.5% (w/v), 1% (v/v) Triton X-100, pH 7.5) supplemented with 1x Complete protease inhibitor cocktail (Roche, 04693116001) per 20 cm2 confluent HUVEC dish and lysed for 15 min on ice. Cellular debris was removed by centrifugation at 1250 x g for 10 min at 4°C. Protein loading buffer was added to a final concentration of 1x and the samples were incubated for 10 min at 95°C.

Samples were subjected to 10% SDS-PAGE for 30 min at 70 V and subsequently at 120 V, and blotted onto 0.2 µm nitrocellulose membrane in a wet tank system at 115 V for 1h at 4°C in Tris-Glycine buffer (25 mM Tris, 190 mM glycine, 20% (v/v) methanol). Membranes were blocked using 3% skim milk in TBST (150 mM NaCl, 20 mM Tris-HCl, 0.1% (v/v) Tween-20, pH 7.4) for at least 30 min and incubated with primary antibodies (see Table 1) over night at 4°C. For signal detection, infrared conjugated secondary antibodies (IRdye680RD or IRdye800CW, LICOR) and the Odyssey imaging system (LICOR) were used.

Experiments with HUVEC expressing P-sel-lum-GCaMP6s-mApple

Bafilomycin A1 (BafA1) was purchased from Cayman Chemical (Cay11038-1) and dissolved in DMSO. 24 h after seeding on 8-chamber μ-slides, HUVEC transfected with the P-sel-lum-GCaMP6s-mApple construct were incubated with media containing 250 nM BafA1 for 2 h or 0.1% DMSO for 3 h. Subsequently medium was exchanged with HBSS, supplemented with 20 mM HEPES pH 7.0–7.6, 1 mM MgCl2, 0.9 mM CaCl2 and 250 mM BafA1 or 0.1% DMSO, respectively, and cells were subjected to live cell imaging at 37˚C for less than 1 h.

Loading of HUVEC with MaPCa-656

MaPCa-656high and MaPCa-656low have been described before [63]. The dyes were dissolved in DMSO to a final concentration of 2 mM and aliquots were stored at -20°C. 4 h or 24 h after seeding on 8-chamber µ-slides, HUVEC transfected with one of the mRFP-Halo constructs were incubated with freshly prepared media containing 1 µM MaPCa-656high/low or 0.05% DMSO for 20 h or 2 h at 37 °C. Subsequently medium was exchanged with HBSS, supplemented with 20 mM HEPES pH 7.0–7.6, 1 mM MgCl2, 0.9 mM CaCl2 and 1 µM MaPCa-656high/low or 0.05% DMSO, respectively, and cells were subjected to live cell imaging at 37 °C for less than 1 h. Solutions containing MaPCa-656high/low were freshly prepared.

Acceptor photobleaching

HUVEC expressing VWF-mRFP-Halo were treated with 1 µM MaPCa-656high for 2 h as described above and were subsequently subjected to acceptor photobleaching (APB) during live cell microscopy. APB was performed with an LSM 780 microscope (Carl Zeiss) equipped with a Plan-Apochromat 63×/1.4 oil immersion objective. mRFP and MaPCa-656high fluorescence of a single WPB was recorded in a single plane for 5 frames prior to bleaching of MaPCa-656high using a 633 nm laser. Thereafter acquisition was continued for 15 frames. mRFP and MaPCa-656high fluorescence was normalized to the respective intensity value before bleaching. FRET efficiency was calculated according to the following equation:

Immunofluorescence staining

Cells were cultivated on collagen coated coverslips (12 mm diameter) until they reached confluency, then fixed in 4% PFA in PBS for 10 min at RT and permeabilized using 0.1% Triton X-100 in PBS for 2 min. Unspecific binding was blocked by addition of 3% BSA in PBS for at least 30 min, followed by antibody incubation (see Table 1) over night at 4°C in 3% BSA in PBS. Secondary antibodies (see Table 1) were diluted 1:400 and incubated for 45 min at room temperature (RT). After extensive washing, samples were mounted in mounting medium.

Microscopy

Confocal microscopy of fixed cells was performed using an LSM 800 or LSM 980 microscope (Carl Zeiss) equipped with a Plan-Apochromat 63×/1.4 oil immersion objective. Live cell imaging was conducted with a LSM 780 microscope (Carl Zeiss) using a Plan-Apochromat 63×/1.4 oil immersion objective and a microscope stage maintained at 37 °C.

For live cell imaging of HUVEC expressing P-sel-lum-GCaMP6s-mApple multi-channel acquisition was achieved using 2 tracks for GCaMP6s and mApple on a spectral GaAsP-PMT [GCaMP6s (excitation laser 488, detection wavelengths: 490–540 nm), mApple (excitation laser 561, detection wavelengths: 450–700 nm)].

For live cell imaging involving MaPCa-656 indicators multi-channel acquisition was achieved using 2 tracks for mRFP and MaPCa-656 on a spectral GaAsP-PMT [mRFP (excitation laser 561, detection wavelengths: 560–615 nm), MaPCa-656 (excitation laser 633, detection wavelengths: 640–694 nm)]. Z-stacks (7 planes with 0.410 µm spacing) were acquired with 0.090 µm pixel size, 1.23 µs pixel integration time and 2x averaging at a bit depth of 8-bit.

Image analysis

Confocal images were analyzed using Fiji [104]. For measurements of Feret diameter or fluorescence intensities, WPB were identified based on the mRFP signal of maximum intensity projections. Segmentation of WPB was achieved by training a pixel classification model using Ilastik [105]. The images were analyzed using a custom macro in Fiji. Maximum intensity projections of the multicolor images were created. For WPB segmentation, the pixel classification model was applied through the Ilastik plugin for Fiji. For further segmentation, the watershed plugin of Fiji was used. Identified particles smaller than 0.11 µm2 were excluded from quantification. For each identified particle the Feret diameter and the mean gray value for mRFP and MaPCa were determined from the gray values of all its associated pixels in the segmented area. Calcium levels were assessed by normalizing MaPCa signal of WPB to the expression level of the construct, i.e. the mRFP signal.

To quantify the normalized MaPCa signal of WPB in relation to the nuclear distance, Zeiss Arivis Pro (version 4.1) was used. The analysis was conducted with maximum intensity projections of z-stacks. Nuclei were segmented manually by drawing an outline around the negative staining in the nuclear region. WPB were segmented using a machine learning classifier followed by watershed splitting. Identified particles smaller than 0.11 µm2 were excluded from quantification. All distances from WPB to the nuclear perimeter were measured and categorized in perinuclear (<7 µm distance to the nucleus perimeter) and peripheral (≥7 µm distance).

Statistics

All statistics were performed using GraphPad PRISM (10.1.0). Asterisks mark statistically significant results: ****p ≤ 0.0001, ***p ≤ 0.001, **p ≤ 0.01, *p ≤ 0.05. Normal distribution was assessed by the Shapiro-Wilk or the D´Agostino & Pearson test. Normally distributed data was analyzed employing an unpaired t-test with Welch´s correction. Non-parametric data was analyzed using a Mann-Whitney test.

Supporting information

S1 File. Supporting information file containing multiple supporting figures.

https://doi.org/10.1371/journal.pone.0316854.s001

(DOCX)

Acknowledgments

We thank Clara Milena Farr for help with the experiments shown in S1 Fig in S1 File.

References

  1. 1. Bonfanti R, Furie BC, Furie B, Wagner DD. PADGEM (GMP140) is a component of Weibel-Palade bodies of human endothelial cells. Blood. 1989 Apr;73(5):1109–12. pmid:2467701
  2. 2. Fiedler U, Scharpfenecker M, Koidl S, Hegen A, Grunow V, Schmidt JM, et al. The Tie-2 ligand angiopoietin-2 is stored in and rapidly released upon stimulation from endothelial cell Weibel-Palade bodies. Blood. 2004 Jun 1;103(11):4150–6. pmid:14976056
  3. 3. Hannah MJ, Hume AN, Arribas M, Williams R, Hewlett LJ, Seabra MC, et al. Weibel-Palade bodies recruit Rab27 by a content-driven, maturation-dependent mechanism that is independent of cell type. J Cell Sci. 2003 Oct 1;116(Pt 19):3939–48. pmid:12928333
  4. 4. Harrison-Lavoie KJ, Michaux G, Hewlett L, Kaur J, Hannah MJ, Lui-Roberts WWY, et al. P-selectin and CD63 use different mechanisms for delivery to Weibel-Palade bodies. Traffic Cph Den. 2006 Jun;7(6):647–62. pmid:16683915
  5. 5. Knop M, Aareskjold E, Bode G, Gerke V. Rab3D and annexin A2 play a role in regulated secretion of vWF, but not tPA, from endothelial cells. EMBO J. 2004 Aug 4;23(15):2982–92. pmid:15257287
  6. 6. Naß J, Terglane J, Zeuschner D, Gerke V. Evoked Weibel-Palade Body Exocytosis Modifies the Endothelial Cell Surface by Releasing a Substrate-Selective Phosphodiesterase. Adv Sci Weinh Baden-Wurtt Ger. 2024 Apr;11(16):e2306624. pmid:38359017
  7. 7. Øynebråten I, Bakke O, Brandtzaeg P, Johansen FE, Haraldsen G. Rapid chemokine secretion from endothelial cells originates from 2 distinct compartments. Blood. 2004 Jul 15;104(2):314–20. pmid:15044249
  8. 8. Sakamoto Y, Doi Y, Ohsato K, Fujimoto S. Immunoelectron microscopy on the localization of endothelin in the umbilical vein of perinatal rabbits. Anat Rec. 1993 Dec;237(4):482–8. pmid:8311261
  9. 9. Vischer UM, Wagner DD. CD63 is a component of Weibel-Palade bodies of human endothelial cells. Blood. 1993 Aug 15;82(4):1184–91. pmid:8353283
  10. 10. Wagner DD, Olmsted JB, Marder VJ. Immunolocalization of von Willebrand protein in Weibel-Palade bodies of human endothelial cells. J Cell Biol. 1982 Oct;95(1):355–60. pmid:6754744
  11. 11. Weibel ER, Palade GE. NEW CYTOPLASMIC COMPONENTS IN ARTERIAL ENDOTHELIA. J Cell Biol. 1964 Oct;23(1):101–12. pmid:14228505
  12. 12. Wolff B, Burns AR, Middleton J, Rot A. Endothelial cell “memory” of inflammatory stimulation: human venular endothelial cells store interleukin 8 in Weibel-Palade bodies. J Exp Med. 1998 Nov 2;188(9):1757–62. pmid:9802987
  13. 13. Yamazaki Y, Eura Y, Kokame K. V-ATPase V0a1 promotes Weibel-Palade body biogenesis through the regulation of membrane fission. eLife. 2021 Dec 14;10:e71526. pmid:34904569
  14. 14. Zannettino ACW, Holding CA, Diamond P, Atkins GJ, Kostakis P, Farrugia A, et al. Osteoprotegerin (OPG) is localized to the Weibel-Palade bodies of human vascular endothelial cells and is physically associated with von Willebrand factor. J Cell Physiol. 2005 Aug;204(2):714–23. pmid:15799029
  15. 15. Naß J, Terglane J, Gerke V. Weibel Palade Bodies: Unique Secretory Organelles of Endothelial Cells that Control Blood Vessel Homeostasis. Front Cell Dev Biol. 2021;9:813995. pmid:34977047
  16. 16. Denis CV, André P, Saffaripour S, Wagner DD. Defect in regulated secretion of P-selectin affects leukocyte recruitment in von Willebrand factor-deficient mice. Proc Natl Acad Sci U S A. 2001 Mar 27;98(7):4072–7. pmid:11274431
  17. 17. Haberichter SL, Fahs SA, Montgomery RR. von Willebrand factor storage and multimerization: 2 independent intracellular processes. Blood. 2000 Sep 1;96(5):1808–15. pmid:10961880
  18. 18. Haberichter SL, Merricks EP, Fahs SA, Christopherson PA, Nichols TC, Montgomery RR. Re-establishment of VWF-dependent Weibel-Palade bodies in VWD endothelial cells. Blood. 2005 Jan 1;105(1):145–52. pmid:15331450
  19. 19. Michaux G, Hewlett LJ, Messenger SL, Goodeve AC, Peake IR, Daly ME, et al. Analysis of intracellular storage and regulated secretion of 3 von Willebrand disease-causing variants of von Willebrand factor. Blood. 2003 Oct 1;102(7):2452–8. pmid:12791651
  20. 20. Mobayen G, Smith K, Ediriwickrema K, Starke RD, Solomonidis EG, Laffan MA, et al. von Willebrand factor binds to angiopoietin-2 within endothelial cells and after release from Weibel-Palade bodies. J Thromb Haemost JTH. 2023 Jul;21(7):1802–12. pmid:37011710
  21. 21. Schillemans M, Kat M, Westeneng J, Gangaev A, Hofman M, Nota B, et al. Alternative trafficking of Weibel-Palade body proteins in CRISPR/Cas9-engineered von Willebrand factor-deficient blood outgrowth endothelial cells. Res Pract Thromb Haemost. 2019 Oct;3(4):718–32. pmid:31624792
  22. 22. Shahbazi S, Lenting PJ, Fribourg C, Terraube V, Denis CV, Christophe OD. Characterization of the interaction between von Willebrand factor and osteoprotegerin. J Thromb Haemost JTH. 2007 Sep;5(9):1956–62. pmid:17723135
  23. 23. Texier A, Lenting PJ, Denis CV, Roullet S, Christophe OD. Angiopoietin-2 binds to multiple interactive sites within von Willebrand factor. Res Pract Thromb Haemost. 2023 Oct;7(7):102204.
  24. 24. Voorberg J, Fontijn R, Calafat J, Janssen H, van Mourik JA, Pannekoek H. Biogenesis of von Willebrand factor-containing organelles in heterologous transfected CV-1 cells. EMBO J. 1993 Feb;12(2):749–58. pmid:8440262
  25. 25. Wagner DD, Saffaripour S, Bonfanti R, Sadler JE, Cramer EM, Chapman B, et al. Induction of specific storage organelles by von Willebrand factor propolypeptide. Cell. 1991 Jan 25;64(2):403–13. pmid:1988154
  26. 26. Arya M, Anvari B, Romo GM, Cruz MA, Dong JF, McIntire LV, et al. Ultralarge multimers of von Willebrand factor form spontaneous high-strength bonds with the platelet glycoprotein Ib-IX complex: studies using optical tweezers. Blood. 2002 Jun 1;99(11):3971–7. pmid:12010796
  27. 27. De Ceunynck K, De Meyer SF, Vanhoorelbeke K. Unwinding the von Willebrand factor strings puzzle. Blood. 2013 Jan 10;121(2):270–7. pmid:23093621
  28. 28. Michaux G, Abbitt KB, Collinson LM, Haberichter SL, Norman KE, Cutler DF. The physiological function of von Willebrand’s factor depends on its tubular storage in endothelial Weibel-Palade bodies. Dev Cell. 2006 Feb;10(2):223–32. pmid:16459301
  29. 29. Siedlecki CA, Lestini BJ, Kottke-Marchant KK, Eppell SJ, Wilson DL, Marchant RE. Shear-dependent changes in the three-dimensional structure of human von Willebrand factor. Blood. 1996 Oct 15;88(8):2939–50. pmid:8874190
  30. 30. Voorberg J, Fontijn R, Calafat J, Janssen H, van Mourik JA, Pannekoek H. Assembly and routing of von Willebrand factor variants: the requirements for disulfide-linked dimerization reside within the carboxy-terminal 151 amino acids. J Cell Biol. 1991 Apr;113(1):195–205. pmid:2007623
  31. 31. Ferraro F, Kriston-Vizi J, Metcalf DJ, Martin-Martin B, Freeman J, Burden JJ, et al. A two-tier Golgi-based control of organelle size underpins the functional plasticity of endothelial cells. Dev Cell. 2014 May 12;29(3):292–304. pmid:24794632
  32. 32. Zhou YF, Eng ET, Nishida N, Lu C, Walz T, Springer TA. A pH-regulated dimeric bouquet in the structure of von Willebrand factor. EMBO J. 2011 Aug 19;30(19):4098–111. pmid:21857647
  33. 33. Huang RH, Wang Y, Roth R, Yu X, Purvis AR, Heuser JE, et al. Assembly of Weibel-Palade body-like tubules from N-terminal domains of von Willebrand factor. Proc Natl Acad Sci U S A. 2008 Jan 15;105(2):482–7. pmid:18182488
  34. 34. Zenner HL, Collinson LM, Michaux G, Cutler DF. High-pressure freezing provides insights into Weibel-Palade body biogenesis. J Cell Sci. 2007 Jun 15;120(Pt 12):2117–25. pmid:17535847
  35. 35. Vischer UM, Wagner DD. von Willebrand factor proteolytic processing and multimerization precede the formation of Weibel-Palade bodies. Blood. 1994 Jun 15;83(12):3536–44. pmid:8204880
  36. 36. Anderson ED, VanSlyke JK, Thulin CD, Jean F, Thomas G. Activation of the furin endoprotease is a multiple-step process: requirements for acidification and internal propeptide cleavage. EMBO J. 1997 Apr 1;16(7):1508–18. pmid:9130696
  37. 37. Molloy SS, Bresnahan PA, Leppla SH, Klimpel KR, Thomas G. Human furin is a calcium-dependent serine endoprotease that recognizes the sequence Arg-X-X-Arg and efficiently cleaves anthrax toxin protective antigen. J Biol Chem. 1992 Aug 15;267(23):16396–402. pmid:1644824
  38. 38. Rehemtulla A, Kaufman RJ. Preferred sequence requirements for cleavage of pro-von Willebrand factor by propeptide-processing enzymes. Blood. 1992 May 1;79(9):2349–55. pmid:1571548
  39. 39. Berriman JA, Li S, Hewlett LJ, Wasilewski S, Kiskin FN, Carter T, et al. Structural organization of Weibel-Palade bodies revealed by cryo-EM of vitrified endothelial cells. Proc Natl Acad Sci U S A. 2009 Oct 13;106(41):17407–12. pmid:19805028
  40. 40. Manneville JB, Etienne-Manneville S, Skehel P, Carter T, Ogden D, Ferenczi M. Interaction of the actin cytoskeleton with microtubules regulates secretory organelle movement near the plasma membrane in human endothelial cells. J Cell Sci. 2003 Oct 1;116(Pt 19):3927–38. pmid:12928328
  41. 41. Rojo Pulido I, Nightingale TD, Darchen F, Seabra MC, Cutler DF, Gerke V. Myosin Va acts in concert with Rab27a and MyRIP to regulate acute von-Willebrand factor release from endothelial cells. Traffic Cph Den. 2011 Oct;12(10):1371–82. pmid:21740491
  42. 42. Lu J, Ma J, Hao Z, Li W. HPS6 Regulates the Biogenesis of Weibel-Palade Body in Endothelial Cells Through Trafficking v-ATPase to Its Limiting Membrane. Front Cell Dev Biol. 2021;9:743124. pmid:35252216
  43. 43. Mayadas TN, Wagner DD. In vitro multimerization of von Willebrand factor is triggered by low pH. Importance of the propolypeptide and free sulfhydryls. J Biol Chem. 1989 Aug 15;264(23):13497–503. pmid:2788160
  44. 44. Terglane J, Menche D, Gerke V. Acidification of endothelial Weibel-Palade bodies is mediated by the vacuolar-type H+-ATPase. PloS One. 2022;17(6):e0270299. pmid:35767558
  45. 45. Wagner DD, Mayadas T, Marder VJ. Initial glycosylation and acidic pH in the Golgi apparatus are required for multimerization of von Willebrand factor. J Cell Biol. 1986 Apr;102(4):1320–4. pmid:3082891
  46. 46. Gruber S, Löf A, Hausch A, Kutzki F, Jöhr R, Obser T, et al. A conformational transition of the D’D3 domain primes von Willebrand factor for multimerization. Blood Adv. 2022 Sep 13;6(17):5198–209. pmid:36069828
  47. 47. Zeng J, Shu Z, Liang Q, Zhang J, Wu W, Wang X, et al. Structural basis of von Willebrand factor multimerization and tubular storage. Blood. 2022 Jun 2;139(22):3314–24. pmid:35148377
  48. 48. Erent M, Meli A, Moisoi N, Babich V, Hannah MJ, Skehel P, et al. Rate, extent and concentration dependence of histamine-evoked Weibel-Palade body exocytosis determined from individual fusion events in human endothelial cells. J Physiol. 2007 Aug 15;583(Pt 1):195–212. pmid:17540703
  49. 49. Meli A, McCormack A, Conte I, Chen Q, Streetley J, Rose ML, et al. Altered Storage and Function of von Willebrand Factor in Human Cardiac Microvascular Endothelial Cells Isolated from Recipient Transplant Hearts. Int J Mol Sci. 2023 Feb 25;24(5):4553. pmid:36901985
  50. 50. Madabhushi SR, Shang C, Dayananda KM, Rittenhouse-Olson K, Murphy M, Ryan TE, et al. von Willebrand factor (VWF) propeptide binding to VWF D’D3 domain attenuates platelet activation and adhesion. Blood. 2012 May 17;119(20):4769–78. pmid:22452980
  51. 51. Morgan AJ, Platt FM, Lloyd-Evans E, Galione A. Molecular mechanisms of endolysosomal Ca2+ signalling in health and disease. Biochem J. 2011 Nov 1;439(3):349–74. pmid:21992097
  52. 52. Omar-Hmeadi M, Idevall-Hagren O. Insulin granule biogenesis and exocytosis. Cell Mol Life Sci CMLS. 2021 Mar;78(5):1957–70. pmid:33146746
  53. 53. Patel S, Docampo R. Acidic calcium stores open for business: expanding the potential for intracellular Ca2+ signaling. Trends Cell Biol. 2010 May;20(5):277–86. pmid:20303271
  54. 54. Wiriyasermkul P, Moriyama S, Nagamori S. Membrane transport proteins in melanosomes: Regulation of ions for pigmentation. Biochim Biophys Acta Biomembr. 2020 Dec 1;1862(12):183318. pmid:32333855
  55. 55. Ambrosio AL, Boyle JA, Aradi AE, Christian KA, Di Pietro SM. TPC2 controls pigmentation by regulating melanosome pH and size. Proc Natl Acad Sci U S A. 2016 May 17;113(20):5622–7. pmid:27140606
  56. 56. Galione A, Morgan AJ, Arredouani A, Davis LC, Rietdorf K, Ruas M, et al. NAADP as an intracellular messenger regulating lysosomal calcium-release channels. Biochem Soc Trans. 2010 Dec;38(6):1424–31. pmid:21118101
  57. 57. Mitchell KJ, Pinton P, Varadi A, Tacchetti C, Ainscow EK, Pozzan T, et al. Dense core secretory vesicles revealed as a dynamic Ca(2+) store in neuroendocrine cells with a vesicle-associated membrane protein aequorin chimaera. J Cell Biol. 2001 Oct 1;155(1):41–51. pmid:11571310
  58. 58. Mitchell KJ, Lai FA, Rutter GA. Ryanodine receptor type I and nicotinic acid adenine dinucleotide phosphate receptors mediate Ca2+ release from insulin-containing vesicles in living pancreatic beta-cells (MIN6). J Biol Chem. 2003 Mar 28;278(13):11057–64. pmid:12538591
  59. 59. Salceda R, Sánchez-Chávez G. Calcium uptake, release and ryanodine binding in melanosomes from retinal pigment epithelium. Cell Calcium. 2000 Apr;27(4):223–9. pmid:10858668
  60. 60. Santodomingo J, Vay L, Camacho M, Hernández-Sanmiguel E, Fonteriz RI, Lobatón CD, et al. Calcium dynamics in bovine adrenal medulla chromaffin cell secretory granules. Eur J Neurosci. 2008 Oct;28(7):1265–74. pmid:18973554
  61. 61. Zampese E, Pizzo P. Intracellular organelles in the saga of Ca2+ homeostasis: different molecules for different purposes? Cell Mol Life Sci CMLS. 2012 Apr;69(7):1077–104. pmid:21968921
  62. 62. Los GV, Encell LP, McDougall MG, Hartzell DD, Karassina N, Zimprich C, et al. HaloTag: a novel protein labeling technology for cell imaging and protein analysis. ACS Chem Biol. 2008 Jun 20;3(6):373–82. pmid:18533659
  63. 63. Mertes N, Busch M, Huppertz MC, Hacker CN, Wilhelm J, Gürth CM, et al. Fluorescent and Bioluminescent Calcium Indicators with Tuneable Colors and Affinities. J Am Chem Soc. 2022 Apr 20;144(15):6928–35. pmid:35380808
  64. 64. Christensen KA, Myers JT, Swanson JA. pH-dependent regulation of lysosomal calcium in macrophages. J Cell Sci. 2002 Feb 1;115(Pt 3):599–607. pmid:11861766
  65. 65. Nicaise G, Maggio K, Thirion S, Horoyan M, Keicher E. The calcium loading of secretory granules. A possible key event in stimulus-secretion coupling. Biol Cell. 1992;75(2):89–99. pmid:1393151
  66. 66. Nakai J, Ohkura M, Imoto K. A high signal-to-noise Ca(2+) probe composed of a single green fluorescent protein. Nat Biotechnol. 2001 Feb;19(2):137–41. pmid:11175727
  67. 67. Barnett LM, Hughes TE, Drobizhev M. Deciphering the molecular mechanism responsible for GCaMP6m’s Ca2+-dependent change in fluorescence. PloS One. 2017;12(2):e0170934. pmid:28182677
  68. 68. Cranfill PJ, Sell BR, Baird MA, Allen JR, Lavagnino Z, de Gruiter HM, et al. Quantitative assessment of fluorescent proteins. Nat Methods. 2016 Jul;13(7):557–62. pmid:27240257
  69. 69. Kneen M, Farinas J, Li Y, Verkman AS. Green fluorescent protein as a noninvasive intracellular pH indicator. Biophys J. 1998 Mar;74(3):1591–9. pmid:9512054
  70. 70. Patterson GH, Knobel SM, Sharif WD, Kain SR, Piston DW. Use of the green fluorescent protein and its mutants in quantitative fluorescence microscopy. Biophys J. 1997 Nov;73(5):2782–90. pmid:9370472
  71. 71. Remington SJ. Green fluorescent protein: a perspective. Protein Sci Publ Protein Soc. 2011 Sep;20(9):1509–19. pmid:21714025
  72. 72. Shinoda H, Shannon M, Nagai T. Fluorescent Proteins for Investigating Biological Events in Acidic Environments. Int J Mol Sci. 2018 May 23;19(6):1548. pmid:29789517
  73. 73. Suzuki J, Kanemaru K, Iino M. Genetically Encoded Fluorescent Indicators for Organellar Calcium Imaging. Biophys J. 2016 Sep 20;111(6):1119–31. pmid:27477268
  74. 74. Cook A, Walterspiel F, Deo C. HaloTag-Based Reporters for Fluorescence Imaging and Biosensing. Chembiochem Eur J Chem Biol. 2023 Jun 15;24(12):e202300022. pmid:36815462
  75. 75. Deo C, Lavis LD. Synthetic and genetically encoded fluorescent neural activity indicators. Curr Opin Neurobiol. 2018 Jun;50:101–8. pmid:29454295
  76. 76. Oheim M, van ‘t Hoff M, Feltz A, Zamaleeva A, Mallet JM, Collot M. New red-fluorescent calcium indicators for optogenetics, photoactivation and multi-color imaging. Biochim Biophys Acta. 2014 Oct;1843(10):2284–306. pmid:24681159
  77. 77. Paredes RM, Etzler JC, Watts LT, Zheng W, Lechleiter JD. Chemical calcium indicators. Methods San Diego Calif. 2008 Nov;46(3):143–51. pmid:18929663
  78. 78. Campbell RE, Tour O, Palmer AE, Steinbach PA, Baird GS, Zacharias DA, et al. A monomeric red fluorescent protein. Proc Natl Acad Sci U S A. 2002 Jun 11;99(12):7877–82. pmid:12060735
  79. 79. Ma J, Zhang Z, Yang L, Kriston-Vizi J, Cutler DF, Li W. BLOC-2 subunit HPS6 deficiency affects the tubulation and secretion of von Willebrand factor from mouse endothelial cells. J Genet Genomics Yi Chuan Xue Bao. 2016 Dec 20;43(12):686–93. pmid:27889498
  80. 80. Aulestia FJ, Alonso MT, García-Sancho J. Differential calcium handling by the cis and trans regions of the Golgi apparatus. Biochem J. 2015 Mar 15;466(3):455–65. pmid:25511127
  81. 81. Behne MJ, Tu CL, Aronchik I, Epstein E, Bench G, Bikle DD, et al. Human keratinocyte ATP2C1 localizes to the Golgi and controls Golgi Ca2+ stores. J Invest Dermatol. 2003 Oct;121(4):688–94. pmid:14632183
  82. 82. Lissandron V, Podini P, Pizzo P, Pozzan T. Unique characteristics of Ca2+ homeostasis of the trans-Golgi compartment. Proc Natl Acad Sci U S A. 2010 May 18;107(20):9198–203. pmid:20439740
  83. 83. Micaroni M, Perinetti G, Berrie CP, Mironov AA. The SPCA1 Ca2+ pump and intracellular membrane trafficking. Traffic Cph Den. 2010 Oct;11(10):1315–33. pmid:20604898
  84. 84. Rodríguez-Prados M, Rojo-Ruiz J, Aulestia FJ, García-Sancho J, Alonso MT. A new low-Ca2+ affinity GAP indicator to monitor high Ca2+ in organelles by luminescence. Cell Calcium. 2015 Dec;58(6):558–64.
  85. 85. Holthenrich A, Drexler HCA, Chehab T, Naß J, Gerke V. Proximity proteomics of endothelial Weibel-Palade bodies identifies novel regulator of von Willebrand factor secretion. Blood. 2019 Sep 19;134(12):979–82. pmid:31262780
  86. 86. von Blume J, Alleaume AM, Kienzle C, Carreras-Sureda A, Valverde M, Malhotra V. Cab45 is required for Ca(2+)-dependent secretory cargo sorting at the trans-Golgi network. J Cell Biol. 2012 Dec 24;199(7):1057–66. pmid:23266954
  87. 87. Morgan AJ, Davis LC, Galione A. Imaging approaches to measuring lysosomal calcium. Methods Cell Biol. 2015;126:159–95. pmid:25665446
  88. 88. Tsien RY. New calcium indicators and buffers with high selectivity against magnesium and protons: design, synthesis, and properties of prototype structures. Biochemistry. 1980 May 27;19(11):2396–404. pmid:6770893
  89. 89. van Mourik JA, Romani de Wit T, Voorberg J. Biogenesis and exocytosis of Weibel-Palade bodies. Histochem Cell Biol. 2002 Feb;117(2):113–22. pmid:11935287
  90. 90. Mourik MJ, Faas FGA, Zimmermann H, Voorberg J, Koster AJ, Eikenboom J. Content delivery to newly forming Weibel-Palade bodies is facilitated by multiple connections with the Golgi apparatus. Blood. 2015 May 28;125(22):3509–16. pmid:25716207
  91. 91. Goretzko J, Pauels I, Heitzig N, Thomas K, Kardell M, Naß J, et al. P-selectin-dependent leukocyte adhesion is governed by endolysosomal two-pore channel 2. Cell Rep. 2023 Dec 26;42(12):113501. pmid:38039128
  92. 92. Lamason RL, Mohideen MAPK, Mest JR, Wong AC, Norton HL, Aros MC, et al. SLC24A5, a putative cation exchanger, affects pigmentation in zebrafish and humans. Science. 2005 Dec 16;310(5755):1782–6. pmid:16357253
  93. 93. Mahapatra NR, Mahata M, Hazra PP, McDonough PM, O’Connor DT, Mahata SK. A dynamic pool of calcium in catecholamine storage vesicles. Exploration in living cells by a novel vesicle-targeted chromogranin A-aequorin chimeric photoprotein. J Biol Chem. 2004 Dec 3;279(49):51107–21. pmid:15358782
  94. 94. Chen R, Liu B, Jaślan D, Kucej L, Kudrina V, Warnke B, et al. TMEM165 replenishes lysosomal Ca2+ stores, protects cells against Ca2+ overload, and mediates Ca2+-induced lysosomal H+ leakage [Internet]. bioRxiv; 2024 [cited 2024 Sep 20]. p. 2024.05.09.593345. Available from: https://www.biorxiv.org/content/10.1101/2024.05.09.593345v2
  95. 95. Zajac M, Mukherjee S, Anees P, Oettinger D, Henn K, Srikumar J, et al. A mechanism of lysosomal calcium entry. Sci Adv. 2024 Feb 14;10(7):eadk2317. pmid:38354239
  96. 96. Cai W, Li P, Gu M, Xu H. Lysosomal Ion Channels and Lysosome-Organelle Interactions. Handb Exp Pharmacol. 2023;278:93–108. pmid:36882602
  97. 97. Kilpatrick BS, Eden ER, Schapira AH, Futter CE, Patel S. Direct mobilisation of lysosomal Ca2+ triggers complex Ca2+ signals. J Cell Sci. 2013 Jan 1;126(Pt 1):60–6. pmid:23108667
  98. 98. Penny CJ, Kilpatrick BS, Eden ER, Patel S. Coupling acidic organelles with the ER through Ca2+ microdomains at membrane contact sites. Cell Calcium. 2015 Oct;58(4):387–96.
  99. 99. Ramazanov BR, Parchure A, Di Martino R, Kumar A, Chung M, Kim Y, et al. Calcium flow at ER-TGN contact sites facilitates secretory cargo export. Mol Biol Cell. 2024 Apr 1;35(4):ar50. pmid:38294859
  100. 100. Sassano ML, Felipe-Abrio B, Agostinis P. ER-mitochondria contact sites; a multifaceted factory for Ca2+ signaling and lipid transport. Front Cell Dev Biol. 2022;10:988014. pmid:36158205
  101. 101. Ma J, Hao Z, Zhang Y, Li L, Huang X, Wang Y, et al. Physical Contacts Between Mitochondria and WPBs Participate in WPB Maturation. Arterioscler Thromb Vasc Biol. 2024 Jan;44(1):108–23. pmid:37942609
  102. 102. Babich V, Meli A, Knipe L, Dempster JE, Skehel P, Hannah MJ, et al. Selective release of molecules from Weibel-Palade bodies during a lingering kiss. Blood. 2008 Jun 1;111(11):5282–90. pmid:18252862
  103. 103. Hannah MJ, Skehel P, Erent M, Knipe L, Ogden D, Carter T. Differential kinetics of cell surface loss of von Willebrand factor and its propolypeptide after secretion from Weibel-Palade bodies in living human endothelial cells. J Biol Chem. 2005 Jun 17;280(24):22827–30. pmid:15831502
  104. 104. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al. Fiji: an open-source platform for biological-image analysis. Nat Methods. 2012 Jun 28;9(7):676–82. pmid:22743772
  105. 105. Berg S, Kutra D, Kroeger T, Straehle CN, Kausler BX, Haubold C, et al. ilastik: interactive machine learning for (bio)image analysis. Nat Methods. 2019 Dec;16(12):1226–32. pmid:31570887