Figures
Abstract
Malaria caused by Plasmodium parasites remains a large health burden. One approach to combat this disease involves vaccinating individuals with whole sporozoites that have been genetically modified to arrest their development at a specific stage in the liver by targeted gene deletion, resulting in a genetically attenuated parasite (GAP). Through a comprehensive phenotyping screen, we identified the hscb gene, encoding a putative iron-sulfur protein assembly chaperone, as crucial for liver stage development, making it a suitable candidate gene for GAP generation. Parasites lacking Plasmodium berghei HscB (PbHscB) exhibited normal sporozoite production in mosquitoes, but their liver stage development was severely impaired, characterized by slow growth and delayed expression of merozoite surface protein 1 (MSP1). In vivo experiments demonstrated that PbHscB-deficient parasites exhibited a delay in prepatency of 2–4 days, emphasizing the significance of PbHscB for exo-erythrocytic development. Although knockout of PbHscB alone allowed breakthrough infections, it is a potent candidate for a dual gene deletion strategy. PlasMei2, an RNA-binding protein, was previously found to be crucial for the completion of liver stage development. We generated a PbHscB-PbMei2-double attenuated parasite line, serving as a late liver stage-arresting replication-competent (LARC) GAP, providing a solid block of liver-to-blood stage transition.
Citation: Schmid M, Beyeler R, Caldelari R, Rehmann R, Heussler V, Roques M (2024) Generation of a genetically double-attenuated Plasmodium berghei parasite that fully arrests growth during late liver stage development. PLoS ONE 19(12): e0316164. https://doi.org/10.1371/journal.pone.0316164
Editor: Shahin Tajeri, Freie Universität Berlin: Freie Universitat Berlin, GERMANY
Received: July 24, 2024; Accepted: December 6, 2024; Published: December 31, 2024
Copyright: © 2024 Schmid et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the paper and its Supporting information files.
Funding: This research was supported by the Swiss National Science Foundation (SNSF) (grant number 310030_182465) and the Multidisciplinary Center for Infectious Diseases (MCID) grant MA-09 to Volker Heussler. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Malaria continues to impose a significant health burden, caused by Plasmodium parasites. Prior to the symptomatic blood stage, the parasite undergoes extensive replication within hepatocyte. Female Anopheles mosquitoes inject approximately 500–1000 Plasmodium sporozoites into the human host’s skin [1, 2]. The sporozoites transmigrate through epidermal cells and endothelia to reach a blood vessel where they are passively transported by the bloodstream until reaching a liver sinusoid [3]. There, they attach to the endothelium and penetrate endothelial cells to enter the liver tissue [4]. After traversing several hepatocytes, the sporozoite invades its final host cell, initiating a round of asexual replication resulting in tens of thousands of daughter merozoites [5]. These merozoites exit the liver tissue encapsulated in vesicles known as merosomes [6]. Upon merosome rupture, the merozoites rapidly infect erythrocytes, initiating the asexual blood stage development.
Vaccine development against the exo-erythrocytic stage of the parasite has been a longstanding focus due to the low parasite numbers and absence of symptoms during this crucial stage. In 2021, the World Health Organization (WHO) approved the widespread use of the RTS,S/AS01 malaria vaccine, a virus-like particle (VLP) vaccine based on the circumsporozoite protein (CSP) [7]. This vaccine has shown potential to reduce severe malaria risk in young children, with an efficacy under 20% [8]. Additionally, Ghana has recently approved the use of another VLP vaccine, R21, based on CSP, with potential efficacy exceeding 75% [9, 10]. However, VLP vaccines may not provide optimal long-term protection [11]. An alternative strategy for malaria protection is immunization with attenuated whole sporozoites, which can elicit a broader immune response mediated by CD8+ T cells, essential for protective immunity [12–15]. There are three main approaches for sporozoite attenuation: irradiation, chemical attenuation, and genetic attenuation. Radiation-attenuated sporozoites (RAS) have been extensively studied but are challenging to implement due to the dose-dependent effect, where excessive radiation completely arrests sporozoites, resulting in weak protection [16–18]. Chemically attenuated sporozoites show strong protection against subsequent infections but are difficult to administer in the field without medical supervision [19–23]. Ideally, the parasite should effectively be controlled and arrested at a specific time point during the liver stage [18, 24, 25]. Genetically attenuated parasites (GAPs) have been used to achieve this controlled arrest of development. Initially, first-generation GAPs relied on gene deletions that halted the parasite’s progression at an early stage after invading hepatocytes. It has been demonstrated that Upregulated in Infective Sporozoites (UIS) 3 and 4 are essential for early liver stage development in P. berghei, but homologues of these genes have not been identified in P. falciparum yet [26, 27]. Other potential candidates for early arrest are two Plasmodium-specific 6-Cys proteins known as P36 and P52, whose deletion leads to early arrest after sporozoite transformation [28, 29]. Despite promising results in mice, a phase I/IIa clinical trial using P. falciparum GAPs resulted in breakthrough infections [30] underscoring the importance of developing a safe and fully arresting GAP. Nevertheless, the shortcoming of early liver stage-arresting replication-deficient (EARD) parasites results in a limited immune response against Plasmodium, and to circumvent this, nowadays research tends to target late parasite development and asexual blood stage. A promising candidate for a late liver stage-arresting replication-competent (LARC) GAP was discovered through a screening of RNA-binding proteins in P. yoelii [31]. This candidate, a Mei2-like RNA-binding protein named PlasMei2, exhibited transcription during the liver stage in P. yoelii, P. berghei and P. falciparum [31–33] and during asexual blood stage in P. berghei and P. falciparum GAP [32, 33]. Deletion of PlasMei2 led to a complete arrest at a very late stage, just prior to merozoite formation. Immunization of BALB/c mice with PlasMei2-KO P. yoelli parasites resulted in significant protection without breakthrough infections [31]. In a humanized mouse model of P. falciparum, PlasMei2 was also found to be crucial for liver stage completion, further emphasizing its potential as an excellent candidate for a LARC GAP [32, 33].
However, the P. yoelli-BALB/c and P. falciparum-humanized mouse models have limitations for vaccination studies [34, 35], in that they might obscure the risk of breakthrough infections. To mitigate this risk, recent studies have reported the dual deletion of PlasMei2 and linup genes in P. falciparum and P. yoelii, referred to as PfLARC2 and PyLARC2 respectively [36]. These studies have shown no breakthrough blood stage infection for PfLARC2 in humanized mice and in the PyLARC2 in rodent malaria model, demonstrating the promising generation of live double-attenuated parasites for further vaccination efforts [36]. Since it is not known whether PlasMei2 and LINUP have a redundant function that could facilitate breakthrough infections, it is crucial to identify other proteins having different functions.
In our approach we identified a suitable gene for a second deletion to complement the PlasMei2-KO aiming to engineer a safe and effective parasite vaccine strain.
Previously, we conducted a high-throughput phenotyping screen to identify novel genes that play a crucial role in liver stage development [37]. Using barcode technology, we examined over 1’300 genes in the rodent malaria parasite Plasmodium berghei. Our investigation led to the identification of 185 genes that are significantly involved in liver stage development, many of which are associated with key metabolic pathways such as fatty acid synthesis (FASII) and heme synthesis [37], as well as genes involved in gene regulation and protein modification. Among the genes we discovered, several molecular chaperones stood out, particularly the putative mitochondrial iron-sulfur (Fe-S) protein assembly chaperone HscB (PBANKA_0821000). Within this study, parasites lacking the hscb gene exhibited a 19-fold reduction in barcode abundance at the salivary gland sporozoite (SG) to the blood of sporozoite-injected mouse (B2) transition demonstrating a strong growth delay phenotype during parasite liver stage development [37]. HscB belongs to the Hsp40 protein family, known as heat shock cognate B chaperones, and it operates in conjunction with an Hsp70 family member, HscA, for the assembly of Fe-S proteins [38, 39]. Fe-S proteins possess an iron sulfur cluster (ISC) as a cofactor, enabling efficient electron transport and involvement in various cellular redox reactions. Examples of Fe-S proteins include aconitase of the tricarboxylic acid (TCA) cycle and succinate dehydrogenase of the respiratory chain [40, 41]. In most eukaryotic cells, the biogenesis of ISCs and Fe-S proteins occurs within the mitochondria via the ISC pathway [41, 42]. Plasmodium parasites, however, possess an additional ISC biogenesis pathway in the apicoplast, a vestigial plastid resembling the chloroplast [43, 44]. This pathway is known as the sulfur mobilization (SUF) pathway and has been shown to be essential for asexual blood stage development [45]. Conditional knockout experiments targeting SufS, the first enzyme in the SUF pathway during oocyst development, resulted in impaired sporozoite formation, underscoring the significance of the SUF pathway in sporozoite development [46]. Since the deletion of hscB in P. berghei parasites did not exhibit significant impairment during the mosquito stage development [37], we wanted to study the effect of PbhscB-deletion during liver stage development and generated a clonal PbHscB-KO parasite line. We also created a GFP-tagged line (PbHscB-GFP) to study the localization of the protein. Additionally, we generated a PbHscB-PbMei2-double KO (PbHscB-PbMei2-dKO) parasite line, which holds potential as a safe candidate for a late LARC GAP.
Results
PbHscB-GFP localizes to the mitochondrion in the oocyst and liver stages
We generated a parasite line expressing PbHscB tagged with GFP at its C-terminus under the control of its endogenous promoter. To accomplish this, we transfected the PbHscB-GFP tagging vector (S1A Fig) into blood stage schizonts using a standard transfection method [47]. After positive selection with pyrimethamine, we confirmed correct integration of the construct by PCR analysis (S1B Fig). Furthermore, the expression of the PbHscB-GFP fusion protein in asexual blood stage parasites was assessed using flow cytometry (S1C Fig). To investigate the localization of PbHscB-GFP during the oocyst stage, a mouse was infected with PbHscB-GFP-expressing parasites and female Anopheles stephensi mosquitoes were allowed to feed on the anesthetized mouse. On day 12 post-feeding, we extracted midguts from the mosquitoes and stained them with the mitochondrial dye MitoView 650, while DNA was stained with Hoechst 33342. Live confocal microscopy imaging revealed overlapping signals between PbHscB-GFP and the mitochondrial dye, indicating that PbHscB-GFP localized to the mitochondria at this stage (Fig 1A). To study the localization of PbHscB-GFP during liver stage development, we extracted PbHscB-GFP-expressing sporozoites from the salivary glands of infected mosquitoes and used them to infect HeLa cells. The cells were fixed at 48 and 56 hours post-infection (hpi) and stained with antibodies against GFP and Toxoplasma gondii Hsp70 (TgHsp70), which has been shown to recognize P. berghei mitochondrial Hsp70 [48]. Although PbHscB-GFP expression was weak, a clear overlap between the PbHscB-GFP signal and the mitochondrial marker TgHsp70 was observed at both time points (Fig 1B and S1D Fig). This finding confirmed the expected localization of PbHscB to the mitochondria during these stages of the parasite’s life cycle.
(A) Mosquito midguts infected with PbHscB-GFP expressing parasites were extracted on day 12 post-feed, stained with Hoechst 33342 (DNA) and Mitoview 650 (mitochondrion), and imaged live by confocal microscopy. Nuclei are shown in blue, PbHscB-GFP in green, and mitochondrion in magenta. The scale bar is 10 μm. (B) HeLa cells were infected with PbHscB-GFP expressing sporozoites and fixed at 48 and 56 hpi. Cells were stained with DAPI (DNA, blue), antibodies against GFP (green), and against TgHsp70 (magenta) and imaged by confocal microscopy. Scale bars are 10 μm.
PbHscB is dispensable for oocyst formation and development
To investigate the role of PbHscB in parasite development, a clonal PbHscB-KO line was generated. This was achieved by transfecting blood stage schizonts with a PlasmoGEM knockout vector (PbGEM-239805) [49] targeting the PBANKA_0821000 locus using a standard transfection method [47]. The PlasmoGEM vector was designed to undergo double crossover homologous recombination, resulting in its integration at the correct locus (S1E Fig). To obtain a clonal knockout parasite line, transgenic parasites were subjected to limiting dilution. This process yielded three clones, and PCR analysis (S1F Fig) confirmed the presence of the knockout construct and the absence of the endogenous locus in all three clones. Clone 1 (Cl.1) was selected for further analysis. Since viable oocysts and sporozoites are a prerequisite for the investigation of parasite liver stage development, we investigated oocyst development and sporozoite generation (S2 Fig). For this purpose, we allowed female A. stephensi mosquitoes to feed on anaesthetized mice that had a suitable number of gametocytes in their blood. Mosquito midguts infected with either WT or PbHscB-KO parasites, were dissected and imaged on day 7, 10, and 14 post-feeding to study oocyst development. PbHscB-KO oocysts exhibited a similar size as WT at day 7, 10 and 14 post-feeding (S2A Fig). Detailed imaging at higher magnification revealed normal sporozoite formation on day 14 post-feeding (S2B Fig, white arrows). Importantly, PbHscB-KO parasites produced normal sporozoite numbers in the salivary glands of the mosquitoes (see below). These findings collectively suggest that PbHscB is not essential for oocyst development and sporozoite formation.
PbHscB-KO strongly impairs liver stage development in vitro and in vivo
To assess exo-erythrocytic or liver stage development, PbHscB-KO and WT sporozoites were used to infect HeLa cells in vitro. The size of parasites was measured using automated microscopy from 6 to 56 hours post-infection (hpi) and revealed a significant growth defect of PbHscB-KO parasites (Fig 2A). PbHscB-KO parasites appeared smaller compared to WT at 24, 48 and 56 hpi. However, it is worth noting that the KO parasites were still able to grow over time. Comparison of the parasite numbers at 6 and 48 hpi indicated reduced survival in the PbHscB-KO parasites (Fig 2B). Previous studies have linked reduced survival of WT parasites during liver stage development to host cell autophagy [50, 51]. To investigate whether PbHscB-KO parasites might be impaired in shedding the autophagy marker microtubule-associated protein 1 light chain 3 (LC3) from their parasitophorous vacuole membrane (PVM), WT and PbHscB-KO parasites were fixed at 24 and 48 hpi and stained with LC3 antibodies. At 24 hpi, both WT and PbHscB-KO parasites were heavily decorated with LC3. However, at 48 hpi, approximately half of the WT parasites were able to shed the autophagy marker, while the majority of KO parasites remained LC3-positive (Fig 2C). This reduced shedding capacity of the PbHscB-KO parasite correlates with the reduced survival observed in Fig 2B and could explain the lower number of PbHscB-KO parasites present at 48 hpi. Due to the small size of PbHscB-KO parasites we questioned whether they are still able to initiate late liver stage development. Therefore, infected cells were fixed at 56 hpi for WT parasites and at 96 hpi for PbHscB-KO parasites. Cells were stained with antibodies against merozoite surface protein 1 (MSP1), which is known to be only expressed at late liver stage (from 48 hpi onwards). MSP1 was readily detected at 56 hpi in WT parasites (Fig 2D), while it was weakly detected at 72 hpi (not shown) and more strongly detected at 96 hpi in PbHscB-KO parasites (Fig 2D). This observation indicates a significant delay in liver stage development for PbHscB-KO parasites but also suggests that, although delayed, these parasites might be capable of completing their liver stage development. To assess if parasites lacking PbHscB can indeed complete their liver stage and establish a blood stage infection, C57BL/6 mice were infected with either 5,000 WT or PbHscB-KO sporozoites. Parasitemia was monitored daily by flow cytometry, and a threshold of 100 parasites per 1 million erythrocytes (≙ 0.01%) was set to classify a mouse as blood stage positive. All mice infected with WT parasites were blood stage parasites positive on day 3 post-injection, while mice infected with KO parasites were positive on days 5 to 7 post-injection. On average, PbHscB-KO parasites exhibited a delay in prepatency of 2.6 days compared to WT (Fig 2E). This represents a significant impairment of liver stage development; however, it also demonstrates that PbHscB-KO parasites are still capable of establishing a blood stage infection.
(A) HeLa cells were infected with either WT or PbHscB-KO sporozoites and imaged at indicated time points using automated microscopy. Parasite size of 500 parasites each was measured based on cytosolic mCherry signal expressed by the parasites. The significance of the results was determined with Kruskal-Wallis test; p-values that are below 0.0001 are presented with ****. The result shown represents one out of three experiments. (B) Parasite number was determined at 6 hpi and 48 hpi by automated microscopy. The number of parasites at 6 hpi was set to 100%. Significance was calculated by unpaired t-test; p = 0.0461 and is presented as * (p < 0.05). Each dot represents an infection experiment. (C) WT- or PbHscB-KO-infected HeLa cells were fixed at 24 and 48 hpi and stained with anti-LC3B antibodies. LC3-staining on PVM was quantified manually at 24 and 48 hpi (n = WT 24 hpi: 200; KO 24 hpi: 107; WT 48 hpi: 137; KO 48 hpi: 81). Significance of results was determined using unpaired t-test; **** represents p < 0.0001. (D) Infected cells were fixed at 56 hpi for WT and 96 hpi for PbHscB-KO parasites and stained with DAPI (DNA, blue) and anti-MSP1 antibodies (parasite plasma membrane, green). Cytoplasmic mCherry is shown in red. Scale bars are 10 μm. (E) 5,000 sporozoites per mouse were injected intravenously into C57BL/6 mice per parasite line in two independent experiments. Represented is one experiment (4 mice for WT and 4 mice for PbHscB-KO parasites). Parasitemia of mice was monitored daily by flow cytometry. A parasitemia of 0.01% (100 parasites per 1 million erythrocytes) was set as a threshold. The average prepatent period was calculated for both parasite lines (WT: 3 days; PbHscB-KO: 5.6 days).
This result demonstrates that PbHscB-KO is not sufficient for generating a single knockout GAP but the significant delay in liver stage development exhibited by PbHscB-KO parasites makes PbHscB an interesting candidate for a double gene deletion approach to generate a safe attenuated parasite vaccine strain.
PbHscB-PbMei2-dKO parasites show normal oocyst development and sporozoite production
As a second gene deletion, PlasMei2 (PbMei2) was chosen, as this gene was shown to be essential for liver stage completion in P. yoelii [31]. To generate a marker-free PbHscB-KO line, negative selection was used (S3A and S3B Fig). Subsequently, the PlasmoGEM vector for PbMei2-KO (PbGEM-300555) [49] was transfected into the marker-free PbHscB-KO schizonts as performed in [47] (S3C Fig). Correct integration of the construct was confirmed by PCR analysis (S3D Fig). The transgenic parasites were subjected to limiting dilution to obtain clonal parasite lines resulting in four clones with the correct knockout of the PbMei2 locus (S3D Fig). Clone 1 (Cl.1) was selected for further investigation. Initially, oocyst development was analyzed as described previously. In addition to the PbHscB-PbMei2-double knockout (dKO) parasite line, a PbMei2 single knockout (sKO) line was also included for comparison. No significant difference in oocyst size was observed between WT, PbHscB-KO, PbMei2-KO and PbHscB-PbMei2-dKO lines at day 7 and day 14 post-feeding, indicating that both gene deletions are dispensable for oocyst development (Fig 3A). This finding was further supported when counting the number of sporozoites present in salivary glands at earlier (day 18 and 19 post-feeding) and later (day 24, 26, and 28 post-feeding) time points, which showed no significant difference among the WT and the three KO lines (Fig 3B). Thus, all three KO lines, including the PbHscB-PbMei2-dKO line, produce normal numbers of salivary gland sporozoites, an important prerequisite for the generation of attenuated parasites as vaccine strains.
(A) Midguts of infected mosquitoes were dissected (n = 10) and imaged on day 7 and day 14 post-feeding. Images were acquired using a 5x objective and analyzed using ImageJ software: mCherry signal was binarized using the threshold function and oocyst size was measured with the ‘analyze particles function’. The presented result is a representative of three experiments and shows 240 oocysts per parasite line as violin plot with individual oocyst sizes and medians with interquartile ranges. Kruskal-Wallis test did not result in a significant difference (ns) between WT and modified parasite line oocysts in neither at day 7 nor at day 14 post feeding. (pday7 1868-dKO = 0.5731, all others >0.9999). (B) Infected salivary glands were dissected on indicated time points, homogenized and the number of sporozoites was determined with a Neubauer counting chamber. Each data point represents the mean of salivary gland sporozoites number from 10 mosquitoes determined in four independent experiments. The significance of the results was calculated using the One-way Anova test.
PbHscB-PbMei2-dKO parasites are fully arrested during late liver stage development
To investigate liver stage development of PbHscB-PbMei2-dKO parasites, HeLa cells were infected with sporozoites from WT, PbHscB-KO, PbMei2-KO and PbHscB-PbMei2-dKO parasites. As previously shown, automated microscopy analysis revealed that PbHscB-KO parasites exhibited impaired growth at 24, 48 and 56 hpi, while PbHscB-PbMei2-dKO parasites showed an even more pronounced growth defect (Fig 4A). PbHscB-KO parasites consistently showed a significant reduction in size at all time points. When both knockouts were combined in the PbHscB-PbMei2-dKO parasites, the phenotype resembled that of PbHscB-KO, displaying a substantial reduction in size and slow growth towards 48- and 56-hours post-infection (hpi) (Fig 4A). To assess parasite survival, the parasites were counted at 48 hpi and compared to the count at 6 hpi. This analysis revealed that the three mutant lines showed reduced survival compared to the WT parasites, with the PbHscB-KO parasites exhibiting a significant reduction in survival (Fig 4B). Since PbMei2-KO parasites appeared to grow to a normal size, as previously reported for P. yoelii Mei2-KOs [31], further investigation was conducted on the late liver stage. PbMei2-KO-infected cells were fixed at 56 hpi and stained for MSP1, which is expressed just prior to merozoite formation [52], and for mitochondria using anti-TgHsp70 antibodies to assess parasite fitness. While WT parasites displayed cytomere stages with the invaginated plasma membrane and a strong MSP1 signal, PbMei2-KO parasites showed neither plasma membrane invaginations nor distinct MSP1 signal (Fig 4C). This finding confirms the observations made by Dankwa and colleagues for P. yoelii Mei2-KO parasites [31]. Our findings indicate that the single knockout PbMei2-dKO and the double knockout PbHscB-PbMei2-dKO parasites do not express MSP1, suggesting they do not reach the very late stages of liver development where this protein is typically produced. Additionally, the mitochondria exhibited abnormal accumulations, and the cytoplasmic mCherry signal revealed numerous vacuoles within the parasite (Fig 4C). These findings indicate that the parasite is no longer developing normally. Some PbMei2-KO parasites also displayed an aberrant shape, which could result from issues related to the maintenance of the PVM. Indeed, staining with the PVM marker UIS4 showed that PbMei2-KO parasites at 56 hpi had a corrupted PVM and an apparent leakage into the host cell cytosol was observed (Fig 4D). This observation could also explain the slight increase in parasite size measured at 48 and 56 hpi (Fig 4A), as parasites lacking an intact PVM might expand to occupy more space within the host cell cytosol. Further investigation is required to understand why the PVM breaks down and the role of PbMei2 in this process.
(A) HeLa cells were infected with either WT or PbHscB-KO sporozoites and imaged at indicated time points using automated microscopy. The shown result is a representative of three experiments and shows parasite size of 500 parasites measured based on cytosolic mCherry signal expressed. The significance of the results was determined with Kruskal-Wallis test; (****: p<0.0001, ns: p24h1868-Mei2KO = 0.9528, p48h1868-Mei2KO = 0.076, p56h1868-Mei2KO = 0.0674). (B) The number of parasites was determined at 6 hpi and 48 hpi by automated microscopy and the number at 6 hpi was considered as 100%. Significance was calculated by Kruskal-Wallis test, with Dunn’s multiple comparison test (*: p = 0.0276; ns: p1868-Mei2KO>0.9999, p1868-dKO = 0.4231). Each dot represents an infection experiment. (C) HeLa cells infected with WT or PbMei2-KO parasites were fixed at 56 hpi and stained with DAPI (DNA, blue), anti-TgHsp70 antibodies (mitochondrion, green), and anti-MSP1 antibodies (parasite plasma membrane, magenta). Cytosolic mCherry signal is shown in red. Scale bars are 10 μm. (D) HeLa cells infected with WT or PbMei2-KO parasites were fixed at 56 hpi and stained with DAPI (DNA, blue) and antibodies against UIS4 (PVM, magenta). Cytosolic mCherry is shown in red. Scale bars are 10 μm. (E) Albino mice (B6(C)/Rj-Tyrc/c) injected with 100,000 sporozoites from mosquito salivary glands infected with either PbHscB-PbMei2-dKO or WT parasites were assessed for luciferase activity via luminescence measurement. Salivary glands from uninfected P. berghei mosquitoes served as a negative control (Mock). At 44 hpi mice were anaesthetized, injected with luciferin and parasite load in the liver was analyzed using an In Vivo Imaging System (IVIS). The graph displays the mean total photon counts per second, with each dot representing an individual mouse (N = 3 per group). Statistical significance was determined using an unpaired t-test. (F) C56BL/6 mice were infected with 100,000 sporozoites each (4 mice for WT, 3 mice for PbHscB-KO, 4 mice for PbMei2-KO and 6 mice for PbHscB-PbMei2-dKO). Parasitemia was monitored daily by flow cytometry and a parasitemia of 0.01% (100 parasites per 1 million erythrocytes) was set as threshold. In a pilot study, it was already confirmed that infection of mice with 100,000 PbMei2-KO sporozoites resulted in breakthrough infections.
As PbMei2-KO [32] and PbHscB-KO (this study) have shown breakthrough infections in mice, we verified whether the double-KO line would be completely arrested during liver stage development. First, we confirmed that the PbHscB-PbMei2-dKO line could invade and develop in mouse hepatocytes. Using luminescence imaging, we monitored in vivo liver stage manifestation after injecting 100,000 WT or PbHscB-PbMei2-dKO sporozoites, while salivary glands from uninfected mosquitoes served as a negative control (Mock). At 44 hpi, although the luminescence signal was reduced relative to WT, most likely due to the smaller parasite size (Figs 2A and 4A), it was still detectable in mouse livers. Following confirmation of liver presence, we assessed potential breakthrough infections by injecting 100,000 sporozoites from WT, PbHscB-KO, PbMei2-KO, or PbHscB-PbMei2-dKO lines into mice and tracking parasitemia over time. As anticipated, blood-stage parasitemia appeared with a 2–3 day delay in PbHscB-KO and a 5–6 day delay in PbMei2-KO sporozoite-injected mice. Importantly, no breakthrough infections were observed in mice injected with PbHscB-PbMei2-dKO sporozoites for up to 41 days post-injection (Fig 4F). This demonstrates that the PbHscB-PbMei2-dKO line is robustly blocked during P. berghei liver stage development under these conditions. The next step would be to test this approach in P. falciparum, as both genes, HscB and Plasmei2, are present in the genome of the human parasite. This strategy of fully attenuating P. falciparum by simultaneously knocking out PfHscB and PfMei2 could potentially result in the development of a safe and effective malaria vaccine.
Discussion
This study underscores the significance of targeting distinct pathways in Plasmodium liver stage development to create safer GAPs. Our work demonstrates that the deletion of PbHscB in combination with PlasMei2 (PbHscB-PbMei2-dKO) effectively arrests liver stage progression, preventing breakthrough infections under experimental conditions. This double-knockout strategy builds on prior findings that single gene deletions, while partially effective, may not fully prevent parasite escape and blood stage development [32].
The double deletion approach addresses critical concerns raised by single-knockout models such as PbPlasMei2-KO and PbHscB-KO, which have shown delayed blood stage emergence but potential for breakthrough under certain conditions [32]. The robustness of the PbHscB-PbMei2-dKO line in halting liver stage progression highlights the importance of disrupting multiple, non-redundant pathways to achieve complete developmental arrest. By combining deletions affecting mitochondrial iron-sulfur cluster biogenesis and RNA-binding processes critical for the parasite’s final replication stage, we effectively block a pivotal point in liver stage development.
It has been demonstrated that the parasite relies on the apicoplast SUF pathway for ISC biogenesis during blood stage development and sporogony [45, 46]. Our findings indicate that the parasite relies on the SUF pathway for ISC generation during both the blood and mosquito stages, while it requires the mitochondrial ISC pathway only during liver stage development. The loss of PbHscB and potential loss of sufficient ISC biogenesis have a significant impact on liver stage growth. However, since some PbHscB-depleted parasites are still able to complete liver stage development, the protein is apparently important but not essential for this parasite stage. The observed reduced growth phenotype of PbHscB-KO parasites may result from impairment in different metabolic pathways due to limited ISC availability.
One example of a metabolic pathway that could be affected is the electron transport chain (ETC) in the mitochondrial inner membrane, which contains several Fe-S proteins, including succinate dehydrogenase [53]. The pyrimidine synthesis pathway is highly dependent of the ETC via the dihydroorotate dehydrogenase [54]. Consequently, issues in the ETC due to lacking ISCs could explain the reduced growth rate in the liver.
Another crucial pathway for liver stage development is the de novo synthesis of heme. During intra-erythrocytic development, the parasite can scavenge heme from the host cell. However, during exo-erythrocytic development, the parasite relies on de novo heme synthesis [55]. The impairment of ISC biogenesis in the absence of PbHscB could potentially affect the availability of ISCs for heme synthesis, leading to further disruptions in liver stage growth. The presence of an iron-response element (IRE) in the mRNA of δ-aminolevulinic acid synthetase (ALAS), the first enzyme in the de novo heme biosynthesis pathway, suggests a potential link between ISC availability and heme biosynthesis regulation during mosquito and liver stage development [56]. Aconitase, another enzyme involved in ISC metabolism, typically contains an ISC to carry out its catalytic function. However, under conditions of limited ISC availability, aconitase lacking bound ISC can repress the translation of IRE-containing transcripts [57, 58]. In the context of PbHscB-KO parasites, if ISC concentration is low, it is possible that the translation of ALAS, which contains an IRE, could be repressed. This repression could lead to impaired heme biosynthesis, thereby affecting liver stage development. Further investigations and experimental studies are needed to validate this hypothesis and explore the precise molecular mechanisms underlying the role of PbHscB in ISC assembly and its potential influence on heme biosynthesis regulation during liver stage development. By unraveling these connections, we can enhance our understanding of the intricate processes involved in Plasmodium parasite biology and potentially identify new targets for intervention strategies against malaria.
The studies on PlasMei2 have provided compelling evidence for its crucial role in liver stage development of Plasmodium parasites, including P. yoelii, P. berghei and P. falciparum [31–33]. Deletion of PlasMei2 in P. yoelii and P. falciparum resulted in an arrest of the parasite just before merozoite formation [31–33] indicating its crucial function for late liver stage development. In the case of PbMei2-KO parasites, it was observed that PVM integrity is lost at approximately 56 hpi, leading to leakage into the host cell cytosol (Fig 4D).
The exact function of PlasMei2 and its underlying molecular mechanisms is unknown. The presence of an RNA-binding motif in PlasMei2 suggests its involvement in translational regulation [31]. Translational regulation has been demonstrated to be important for stage transitions in the parasite’s life cycle, particularly during the sporozoite to trophozoite transition [26, 27, 59–61]. We speculate that PlasMei2 may play a role in regulating specific transcripts that are critical for initiating liver stage merogony, the process of daughter cell formation. Depletion of PlasMei2 results in the failure to initiate daughter cell formation in most mutants, as indicated by the absence of membrane invaginations during cytomere stage and the failure to express MSP1 on the parasite plasma membrane. Because of being unable to progress in their development, the PVM integrity might ultimately be lost.
To further elucidate the function of PlasMei2 and improve the safety profile of PlasMei2-KO parasites as GAPs, it is essential to identify its potential mRNA targets. This identification could offer valuable insights into the mechanisms governing the parasite’s transition from proliferation to daughter cell formation, a process that remains poorly understood. Confirming PlasMei2’s role in translational regulation would deepen our understanding of the complex molecular processes involved in Plasmodium development and could potentially reveal new strategies for malaria control.
The safety and efficacy of PlasMei2-KO parasites as GAPs have been assessed in various experimental models, including P. yoelii in BALB/c mice and P. falciparum in humanized mice [31, 33]. However, given that breakthrough infections have been observed with rodent mei2-KO parasites in our study and others [32], a single mei2 knockout strategy may not be sufficiently safe for the human parasite P. falciparum as well, especially in immunocompromised individuals. This underscores the need for additional genetic attenuations to enhance safety. In addition, previous research [35], has demonstrated exceptionally low breakthrough rates in GAPs. This highlights the importance of considering such results when evaluating breakthrough infections, especially when using a limited number of animals for testing.
Combining PlasMei2-KO with a second gene deletion that has a different function might increase the likelihood of targeting distinct crucial developmental pathways within the parasite, thus avoiding redundancy in protein function and preventing the parasite from overcoming the impaired pathway. In a recent study, simultaneous deletion of the PlasMei2 and linup genes was employed to achieve parasite attenuation [36]. The resulting double-attenuated parasite lines, PyLARC2 and PfLARC2, demonstrated either no expression (PyLARC2) or very weak expression (PfLARC2) of MSP1. This limited MSP1 expression raises questions about the generation of protective immune responses against late liver and asexual blood-stage parasites. Potentially breakthrough infections then lead to a full blood-stage infection. This underscores the importance of considering the stage-specific expression of protective antigens when evaluating the efficacy and safety of genetically attenuated parasites. Moreover, as the authors pointed out, both proteins, PlasMei2 and LINUP, might act in concert to regulate gene expression and may thus have partly redundant function. It is therefore crucial to identify alternative pathways or functions for generating safely attenuated parasites. In our study, PbHscB-PbMei2-dKO parasites perfectly fulfill this latter criterion. In vitro studies revealed that the PbHscB-PbMei2-dKO parasites exhibit a similar phenotype to the PbHscB-KO parasites, displaying a reduced growth rate. This reduced growth rate may be beneficial for generating a strong and long-lasting protective immune response. PlasMei2-KO parasites grow normally until the end of schizogony, potentially allowing the host cells to present a wider array of parasite epitopes via the major histocompatibility complex I (MHC-I) pathway compared to early arresting GAPs. However, given that our newly generated PbHscB-PbMei2-dKO parasites also do not express MSP1, we do not anticipate an advantage in this regard. It will now be important to determine whether P. falciparum HscB-Mei2-dKO parasites express MSP1 to fully assess their potential for inducing protective immunity.
The observed breakdown of the PVM in PbMei2-KO parasites indicates that the parasites may be eliminated faster following schizogony. The slow growth phenotype of PbHscB-PbMei2-dKO parasites may enable them to persist in the liver for a longer period, potentially providing better long-term protection [62]. PbHscB-PbMei2-dKO parasites may prolong the period during which hepatocytes can present parasite antigens, which has been demonstrated to be important for priming parasite-specific CD8+ T cells and generating a robust immune response [63, 64]. For this work, we decided against performing challenge experiments, as the goal of this study was to demonstrate that deleting completely unrelated parasite pathways still allows parasites to develop until the late liver stage but prevents breakthrough infections. The next objective is to test this in P. falciparum to generate a potent and safe LARC GAP and evaluate its protective efficacy in preclinical and clinical studies.
In conclusion, this study highlights that targeting divergent yet essential pathways in the Plasmodium liver stage can create a strong block against parasite progression. The PbHscB-PbMei2-dKO parasite line sets the stage for further exploration into multigene knockouts as a strategic pathway for safe, effective malaria vaccine development. Ongoing and future preclinical studies will be pivotal to validate this approach in human models, advancing the fight against malaria.
Experimental procedures
Animal experiments conducted at the University of Bern
Animal experiments were carried out in strict accordance with the guidelines of the Swiss Tierschutzgesetz (TSchG; Animal Rights Laws) and approved by the ethical committee of the University of Bern (Permit Number: BE98/19). Mice were kept in specific-pathogen-free conditions and screened regularly for pathogens. They were housed in individually ventilated cages with autoclaved aspen woodchip, a mouse house and paper tissue at a temperature of 21 ± 2°C with a 12:12 h light-dark cycle and a relative humidity of 55 ± 10%. Mice were fed ad libitum with commercially prepared and autoclaved dry rodent pellets and water. Health of mice was monitored by routine daily visual health checks. The parasitemia of infected animals was measured by flow cytometry or by blood smears.
BALB/c mice (6–8 weeks; Janvier Laboratories, France) were used to maintain parasites and for mosquito feeds. Mice were infected with parasites by intraperitoneal or intravenous injection. When parasitemia reached 2–5%, mice were euthanized by CO2 and parasitized blood was isolated by heart puncture. For feeding of mosquitoes, mice were anaesthetized upon reaching a parasitemia of 5–7% with sufficient gametocyte number. Anesthesia was carried out with ketamine:xylazine and when mice did no longer react to touch stimulus, were placed on cages with approximately 150 mosquitoes.
Female C57BL/6 mice (6–8 weeks; Janvier Laboratories, France) were used to conduct in vivo studies of liver development (see “in vivo experiments” in this section for mice and salivary gland sporozoites number used and duration of experiment). For this, mice were infected intravenously with isolated salivary gland sporozoites. When parasitemia reached 2%, this was considered as the end of the experiment and mice were euthanized by CO2 and parasitized blood was isolated by heart puncture to perform further genotypical analysis.
We were careful in verifying Plasmodium infected animals during the parasite maintenance and in vivo experiments with signs where animals have to be euthanized as: abnormal behaviors, pathological changes, ruffled fur, reduced mobility. During these experiments no animals infected with parasites were found dead before meeting criteria for euthanasia.
Parasite strains
All parasite strains used were of P. berghei ANKA background that expressed cytosolic mCherry under the hsp70 promoter and luciferase under the eEF1α promoter (Pb1868). These Pb1868 parasites are phenotypically similar as PbWT [50] and were used as background line for the GFP and knockout lines that were generated.
Generation and selection of transgenic parasites
To generate an endogenously GFP-tagged parasite line for PbHscB, the C-terminal part of the gene PBANKA_0821000 was amplified (Fwd_Primer: AAggtacccaatccaattcatagATAGTAATAAATC/ Rev_Primer: AAgggcccTATATTTTGCAACCTATCC) and cloned into a vector containing a GFP and hdhfr as selection marker (resulting in a C-term HscB-GFP fusion protein). The construct was linearized with EcoRV restriction digest. To generate a PbHscB-KO parasite line, a knockout construct was provided by PlasmoGEM (PbGEM-239805) [49]. The constructs were transfected into blood stage Pb1868 schizonts by a standard procedure [47]. In short, a mouse was infected with Pb1868 parasites and blood was extracted once parasitemia reached 1–3%. The infected blood was cultured in schizont culture medium (Roswell Park Memorial Institute RPMI1640 medium supplemented with 20% fetal calf serum (FCS)) under 5% CO2, 5% O2 and 90% N2. Parasites were cultured over night at 36.5°C with constant rotation. The following day, schizonts were isolated by density gradient centrifugation. For this, the schizont culture was underlaid with a 60% Nycodenz in PBS mixture. Parasites were centrifuged for 20 min at 450 g with minimal acceleration and deceleration. The resulting brownish schizont layer was harvested and centrifuged in RPMI1640 for 8 min at 450 g. The schizont pellet was resuspended with 100 μL transfection buffer (Amaxa® Human T cell Nucleofector® Kit) supplemented with 10 μg of either EcoRV-digested PbHscB-GFP vector or NotI-digested PbGEM-239805. The schizont-DNA mixture was transferred to a transfection cuvette and electroporated with an Amaxa Nucleofector 2b device using program U33. After immediate addition of 100 μL of fresh RPMI1640 the electroporated parasites were injected intravenously into BALB/c mice. The next day, pyrimethamine (70 μg/L) was added to the drinking water. When parasitemia of infected mice reached 3%, mice were euthanized by CO2 and blood was extracted by heart puncture. Genomic DNA was extracted, and presence of the constructs was determined by PCR. Primers used for integration of GFP-construct were Primer 1: ATGAATAAAATTAAATATGCATTTCC and Primer 2: TCGATGCCCTTCAGCTCG (S1A Fig). Primers used for PbHscB-KO construct were Primer 3: catcatttaactgttgtaatatattgtttatactc; Primer 2: gttacttagttacccaacaatccg and Primer 5: cataatctggaacatcatatggatac (S1E Fig). KO parasites were subjected to limiting dilution. For this, a mouse was infected with transgenic parasites. Once parasitemia was between 0.2 and 1%, the mouse was euthanized, and blood was collected. The number of infected erythrocytes/mL was determined by flow cytometry and parasites were diluted to inject 0.7 parasites per mouse into 10 mice. When parasitemia reached 3%, blood was again collected, and another PCR was performed to confirm presence of KO construct and absence of WT locus. Clone 1 was chosen for further analysis.
To create a second gene deletion in PbHscB-KO parasites, a negative selection with 5-fluorocytosine (5-FC) was performed. For this, a mouse was infected with clonal PbHscB-KO parasites and 5-FC (1 mg/mL) was added to the drinking water after parasitemia reached 3%. Parasites were selected for one week until parasitemia recovered to around 3%. The mouse was then euthanized by CO2 and blood was extracted by heart puncture. gDNA was extracted and absence of resistance cassette was verified by PCR. Primers used were Primer 3 catcatttaactgttgtaatatattgtttatactc; Primer 4: gttacttagttacccaacaatccg; Primer 5: cataatctggaacatcatatggatac; Primer 6: CAGAGAATGACCACAACCTCTTCAG; and Primer 7: CAAGACTTCTGTAGCCATGATAGCAC (S3A Fig). To obtain a clonal, marker-free KO line, the 5-FC-selected parasites were cloned by limiting dilution as describe above and absence of resistance cassette was confirmed for Clone 2 (S3B Fig). A PbMei2 (PBANKA_1122300) knockout construct provided by PlasmoGEM (PbGEM-300555) [49] was transfected into marker-free PbHscB-KO parasites as described above. Presence of knockout construct and absence of endogenous locus was checked by PCR. Primers used were Primer 8: gcatgatgccgaatgcccaa; Primer 9: ccaacattacatttgttacgaaaatcaattgg and Primer 10: ctttggtgacagatactac (S3C Fig). PbHscB-PbMei-dKO parasites were again subjected to limiting dilution, which resulted in 4 clones (S3D Fig). Clone 1 was chosen for further analysis.
Mosquito breeding
Anopheles stephensi mosquitoes were bred at 28°C, 80% humidity and a 12:12h light-dark cycle. They were fed with cotton pads containing 8% fructose solution. Female mosquitoes were fed with human blood once a week for egg production. Eggs were kept in water baths supplemented with Liquifry fish food and hatched larvae were grown for 7–12 days until pupae were formed. Larvae were fed with fish food. Pupae were collected in water bowls and placed in mosquito cages for hatching. After feeds on parasite infected blood, mosquitoes were kept at 20°C.
Live imaging and quantification of midgut oocysts
Mosquitoes were aspirated with a small vacuum device and anaesthetized with chloroform. Sleeping mosquitoes were kept on petri dishes on ice. Infected midguts were extracted with forceps and placed on glass slides with 1x PBS containing 1 μg/mL Hoechst 33342. To measure oocyst size, images of midguts were acquired with a Leica DM 6000B fluorescent microscope and analyzed using ImageJ software: mCherry signal was binarized using the threshold function and oocyst size was measured with the ‘analyze particles’ function. Graphs and statistical analysis were performed with GraphPad Prism. Morphology of PbHscB-KO oocysts was analyzed on a Leica DM5500 widefield fluorescence microscope. Midguts infected with PbHscB-GFP expressing parasites were stained with 1 μg/mL Hoechst 33342 and 100 nM MitoView 650 (Biotium MitoView™ 650). Localization of PbHscB-GFP signal was analyzed on a Leica TCS SP8 laser-scanning confocal microscope.
Culture and in vitro infection of HeLa cells and quantification of salivary gland sporozoites
WT HeLa (European Cell Culture Collection) cells were cultivated in Minimum Essential Medium with Earle’s salts (MEM EBS; Bioconcept, 1-31F01-I) supplemented with 10% FCS (Sigma-Aldrich), 100 U penicillin, 100 μg/mL streptomycin, and 2 mM L-glutamine (all from Bioconcept). Cells were kept at 37°C with 5% CO2 and split with Accutase (Innovative Cell Technologies). For parasite infections, salivary glands of infected mosquitoes were dissected and homogenized to release the sporozoites. Sporozoites were added to cells and incubated in normal growth medium. To determine number of salivary gland sporozoites, 10 μL of sporozoite suspension was added in a Neubauer counting chamber and all 4 fields were counted. With the total volume used and the number of mosquitoes dissected, the average number of salivary gland sporozoites per mosquito was calculated.
Automated microscopy
Infected HeLa cells were imaged live at several time points to measure number and size of parasites. Cells were imaged with an INCell Analyzer 2000 automated live cell imaging system (GE Healthcare Life Sciences). Analysis of images was carried out with INCell Developer Toolbox 1.10.0 software. Segmentation was done using “object” mode for the mCherry channel and objects smaller than 10 μm2 and bigger than 1,200 μm2 were excluded. Graphs and statistical analysis were done with GraphPad Prism.
Indirect immunofluorescence assay
Infected cells were fixed at indicated time points with 4% paraformaldehyde in PBS 1X for 20 min at room temperature and protected from light. Cells were permeabilized for 30 min with -20°C 100% methanol. Unspecific antibody binding was blocked by incubating the cells for 20 min with 10% FCS in PBS. Cells were stained with primary antibodies diluted in 10% FCS in PBS for 1 h at room temperature. After washing with PBS, cells were incubated for another hour with fluorescently labelled secondary antibodies and DAPI (1 μg/mL). Primary antibodies used were rabbit anti-UIS4 antiserum (1:1000), rat anti-MSP1 antiserum (1:500) kindly gifted by Anthony Holder, mouse monoclonal anti-GFP (Roche 11814460001; 1:1000), mouse monoclonal anti-LC3 antibody (MBL M152-3; 1:1000) and rabbit anti-TgHsp70 antiserum (1:500) kindly gifted by Dominique Soldati. Secondary antibodies used were anti-rabbit Alexa488 (Invitrogen A- 11008; 1:2000), anti-rat Alexa647 (Invitrogen A-21247; 1:2000), anti-mouse Alexa488 (Invitrogen A- 11001, 1:2000) and anti-rabbit Cy5 (Dianova; 1:2000). Stained cells were imaged on a Leica TCS SP8 laser-scanning confocal microscope. Acquired images were processed with FIJI software. Quantification of LC3-labelled parasites was done on a Leica DM5500 epifluorescence microscope. Only UIS4-positive parasites were analyzed, and parasites were counted as LC3-positive when a clear association between LC3 and UIS4 was detected. To calculate the Pearson coefficient correlation (PCC) and the Mander overlap coefficient (MOC) only two channels (PbHscB-GFP and TgHsp70) were retained, and the others were reduced using the ‘arrange channels’ function. The composite image was split into both channels and the region of interest (ROI) was defined in one of the channels (PbHscB-GFP). Colocalization analysis were calculated by using the Coloc2 tool of the FIJI software.
In vivo experiments
Salivary glands from infected mosquitoes were extracted and homogenized. Number of sporozoites per mL was determined with a Neubauer counting chamber. Sporozoites were diluted with PBS to inject 5,000 (Fig 2E) or 100,000 (Fig 4F) sporozoites in 150ul of PBS per mouse and injections were done via the tail vein of the mouse. In Fig 2E, 5,000 sporozoites per mouse (4 mice for WT and 4 mice for PbHscB-KO) were injected intravenously into C57BL/6 mice per parasite line in two independent experiments. Mice were euthanized once parasitemia reached 2% at day 5 for mice infected with WT parasite line and between day 7 and 10 for mice infected with PbHscB-KO parasite line. Represented is one experiment. In Fig 4F, C56BL/6 mice were infected with 100,000 sporozoites each (4 mice for WT, 3 mice for PbHscB-KO, 4 mice for PbMei2-KO and 6 mice for PbHscB-PbMei2-dKO). Mice were euthanized once parasitemia reached 2% (day 5 for mice infected with WT parasite line, day 7 for mice infected with PbHscB-KO parasite line, between day 9 and 10 for PbMei2-KO parasite line and at day 41 for PbHscB-PbMei2-dKO parasite line). Parasitemia was measured daily using flow cytometry of the mCherry signal. 100 events and more per 1 Mio erythrocytes was considered as blood stage positive. Graphs were created with Microsoft Excel.
In vivo imaging: To detect liver stage parasites in vivo in Fig 4E, B6 Albino mice (B6(C)/Rj-Tyrc/c; JanvierLabs, France) were infected with 100,000 PbHscB-PbMei2-dKO or the parental parasite line PbmCherryhsp70-Lucef1a (Pb1868) named here as WT sporozoites by intravenous injection; salivary glands from mock infected mosquitoes served as negative control. At 44hpi full-body bioluminescence analysis was performed. Mice were anaesthetized using isofluorane and administered with 100ul of RediJect D-Luciferin (30mg/ml; Perkin Elmer, 770504) by intraperitoneal injection. Seven minutes after substrate administration the luciferase activity was measured for 3 minutes using the In Vivo Imaging System NightOWL LB983 (Berthold Technologies). Values are expressed as photons/sec and represent parasite load in the liver.
Supporting information
S1 Fig. Generation of transgenic parasite lines.
(A) Schematic representation of single crossover recombination of GFP-tagging vector at the PBANKA_0821000 locus. The C-terminus of PBANKA_0821000 (blue) was amplified and fused to a C-terminal GFP. Human dihydrofolate reductase (hdhfr) was used as a positive selection marker. Primers used to check for integration are marked as 1 and 2. (B) Agarose gel showing products of PCR done on genomic DNA extracted from WT and from transgenic PbHscB-GFP parasites. Expected band size for the PCR: 2,100 bp. (C) Flow cytometry graph from WT and PbHscB-GFP parasites showing mCherry-expressing parasites with a population of GFP-expressing parasites (green arrow). (D) Represents the Channel 1 (PbHscB-GFP) and the Channel 2 (TgHsp70) at 48 hpi timepoint (left panel) used to measure the Pearson correlation coefficient (PCC) and the Mander’s overlap coefficient (MOC). The 2D intensity histogram of Channel 1 and Channel 2 (right panel) shows the ratio of intensities at the exact position in a density heat map (a high intensity is displayed in yellow, a low intensity in purple). The image at 48 hpi used correspond to the one presented in Fig 1B. (E) Schematic representation of double crossover recombination of the PbHscB-KO vector (PbGEM-239805) at the PBANKA_0821000 locus. Human dihydrofolate reductase (hdhfr) was used as a positive selection marker and yeast cytosine deaminase uracil phosphoribosyl transferase (yfcu) as a negative selection marker. The purple bar represents the gene-specific barcode. Blue bars represent PbDHFR 3’ UTRs. Primers used to check for integration are marked as 3–5. (F) Agarose gel showing PCR products done on genomic DNA of PbHscB-KO parasites after limiting dilution. Expected band sizes are 2,450 bp for 3+4 (WT) and 2,130 bp for 3+5 (locus after integration of KO vector). Clone 1 was chosen for further analysis. Schematics created with BioRender.com.
https://doi.org/10.1371/journal.pone.0316164.s001
(TIF)
S2 Fig. PbHscB-KO does not affect oocyst formation and development.
(A) Midguts of infected mosquitoes (n = 10, black: WT and red: PbHscB-KO) were dissected and imaged on day 7, day 10, and day 14 post-feed. Images were acquired using a 5x objective and analyzed using ImageJ software: mCherry signal was binarized using the threshold function and the oocyst size was measured with the ‘analyze particle’s function. The shown result is a representative of three experiments and shows the size of 300 oocysts per parasite line as violin plot with individual oocyst sizes and medians with interquartile range. Kruskal-Wallis test did not result in a significant difference (ns) between WT and KO oocysts in none of the analyzed time points. (pday7 = 0.9412, pday10 = 0.4174, pday14>0.9999). (B) Infected midguts were extracted on day 14 post-feed and DNA was stained with Hoechst 33342 (cyan). Cytosolic mCherry is shown in red. Sporozoite formation in PbHscB-KO oocysts is highlighted with a white arrow. Scale bars are 10 μm.
https://doi.org/10.1371/journal.pone.0316164.s002
(TIF)
S3 Fig. Generation of PbHscB-PbMei2-dKO parasite line.
(A) Schematic representation of negative selection using 5-fluorocytosine (5-FC). PbDHFR-3’UTRs can recombine, which removes the selection cassette. Marker-free parasites can be selected using 5-FC. The absence of the selection marker was checked with indicated primers 3–7. (B) Agarose gel showing PCR products done on genomic DNA of Pb1868 WT parasites, 5-FC selected parasites, and two 5-FC selected clones after limiting dilution. Expected PCR products are 2,450 bp for 3+4; 2,130 bp for 3+5; and 1,425 bp for 6+7. The absence of a selection marker was confirmed for clone 2, which was selected for the generation of the double KO line. (C) Schematic representation of double crossover recombination of the PbMei2-KO vector (PbGEM-300555) at the PBANKA_1122300 locus. Human dihydrofolate reductase (hdhfr) was used as a positive selection marker and yeast cytosine deaminase uracil phosphoribosyl transferase (yfcu) as a negative selection marker. The purple bar represents the gene-specific barcode. Blue bars represent PbDHFR 3’ UTRs. Primers used to check for integration are marked as 8–10. (D) Agarose gel showing PCR products done on genomic DNA of Pb1868 WT and PbHscB-PbMei2-dKO parasites after transfection and after limiting dilution. Expected band sizes are 2,711 bp for 8+10 (WT) and 2,243 bp for 8+9 (locus after integration of KO vector). Clone 1 was chosen for further analysis. Schematics created with BioRender.com.
https://doi.org/10.1371/journal.pone.0316164.s003
(TIF)
S1 Raw image. Raw images of agarose gel electrophoresis.
https://doi.org/10.1371/journal.pone.0316164.s004
(PDF)
Acknowledgments
We are grateful to Chris Janse and Blandine Franke-Fayard for providing the PbMei2-KO parasite line; to Anthony Holder for the antibody anti-MSP1; to Dominique Soldati for the anti-TgHsp70 antiserum. We thank the MIC (Microscopy Imaging Center) in Bern for providing excellent imaging facilities and expertise.
References
- 1. Rosenberg R, Burge R, Schneider I. An estimation of the number of malaria sporozoites ejected by a feeding mosquito. Trans R Soc Trop Med Hyg. 1990;84: 209–212. pmid:2202101
- 2. Kanatani S, Stiffler D, Bousema T, Yenokyan G, Sinnis P. Revisiting the Plasmodium sporozoite inoculum and elucidating the efficiency with which malaria parasites progress through the mosquito. Nat Commun. 2024;15. pmid:38272943
- 3. Amino R, Giovannini D, Thiberge S, Gueirard P, Boisson B, Dubremetz JF, et al. Host cell traversal is important for progression of the malaria parasite through the dermis to the liver. Cell Host Microbe. 2008;3: 88–96. pmid:18312843
- 4. Tavares J, Formaglio P, Thiberge S, Mordelet E, Van Rooijen N, Medvinsky A, et al. Role of host cell traversal by the malaria sporozoite during liver infection. J Exp Med. 2013;210: 905–915. pmid:23610126
- 5. Mota MM, Pradel G, Vanderberg JP, Hafalla JCR, Frevert U, Nussenzweig RS, et al. Migration of Plasmodium sporozoites through cells before infection. Science. 2001;291: 141–144. pmid:11141568
- 6. Sturm A, Amino R, Van De Sand C, Regen T, Retzlaff S, Rennenberg A, et al. Manipulation of host hepatocytes by the malaria parasite for delivery into liver sinusoids. Science. 2006;313: 1287–1290. pmid:16888102
- 7. Stoute JA, Slaoui M, Heppner DG, Momin P, Kester KE, Desmons P, et al. A preliminary evaluation of a recombinant circumsporozoite protein vaccine against Plasmodium falciparum malaria. RTS,S Malaria Vaccine Evaluation Group. N Engl J Med. 1997;336: 86–91. pmid:8988885
- 8. Beeson JG, Kurtovic L, Valim C, Asante KP, Boyle MJ, Mathanga D, et al. The RTS,S malaria vaccine: Current impact and foundation for the future. Sci Transl Med. 2022;14. pmid:36383682
- 9. Datoo MS, Natama MH, Somé A, Traoré O, Rouamba T, Bellamy D, et al. Efficacy of a low-dose candidate malaria vaccine, R21 in adjuvant Matrix-M, with seasonal administration to children in Burkina Faso: a randomised controlled trial. Lancet. 2021;397: 1809–1818. pmid:33964223
- 10. Mahase E. WHO recommends second vaccine for malaria prevention in children. BMJ. 2023;383: 2291. pmid:37793685
- 11. Efficacy and safety of RTS, S/AS01 malaria vaccine with or without a booster dose in infants and children in Africa: final results of a phase 3, individually randomised, controlled trial. Lancet. 2015;386: 31–45. pmid:25913272
- 12. Schofield L, Villaquiran J, Ferreira A, Schellekens H, Nussenzweig R, Nussenzweig V. Gamma interferon, CD8+ T cells and antibodies required for immunity to malaria sporozoites. Nature. 1987;330: 664–666. pmid:3120015
- 13. Weiss WR, Sedegah M, Beaudoin RL, Miller LH, Good MF. CD8+ T cells (cytotoxic/suppressors) are required for protection in mice immunized with malaria sporozoites. Proc Natl Acad Sci U S A. 1988;85: 573–576. pmid:2963334
- 14. Romero P, Maryanski JL, Corradin G, Nussenzweig RS, Nussenzweig V, Zavala F. Cloned cytotoxic T cells recognize an epitope in the circumsporozoite protein and protect against malaria. Nature. 1989;341: 323–326. pmid:2477703
- 15. Hafalla JC, Silvie O, Matuschewski K. Cell biology and immunology of malaria. Immunol Rev. 2011;240: 297–316. pmid:21349101
- 16. Hoffman SL, Goh LML, Luke TC, Schneider I, Le TP, Doolan DL, et al. Protection of humans against malaria by immunization with radiation-attenuated Plasmodium falciparum sporozoites. J Infect Dis. 2002;185: 1155–1164. pmid:11930326
- 17. Silvie O, Semblat JP, Franetich JF, Hannoun L, Eling W, Mazier D. Effects of irradiation on Plasmodium falciparum sporozoite hepatic development: implications for the design of pre-erythrocytic malaria vaccines. Parasite Immunol. 2002;24: 221–223. pmid:12010486
- 18. Friesen J, Matuschewski K. Comparative efficacy of pre-erythrocytic whole organism vaccine strategies against the malaria parasite. Vaccine. 2011;29: 7002–7008. pmid:21787828
- 19. Belnoue E, Costa FTM, Frankenberg T, Vigário AM, Voza T, Leroy N, et al. Protective T cell immunity against malaria liver stage after vaccination with live sporozoites under chloroquine treatment. J Immunol. 2004;172: 2487–2495. pmid:14764721
- 20. Putrianti ED, Silvie O, Kordes M, Borrmann S, Matuschewski K. Vaccine-like immunity against malaria by repeated causal-prophylactic treatment of liver-stage Plasmodium parasites. J Infect Dis. 2009;199: 899–903. pmid:19434915
- 21. Roestenberg M, McCall M, Hopman J, Wiersma J, Luty AJF, van Gemert GJ, et al. Protection against a malaria challenge by sporozoite inoculation. N Engl J Med. 2009;361: 468–477. pmid:19641203
- 22. Friesen J, Silvie O, Putrianti ED, Hafalla JCR, Matuschewski K, Borrmann S. Natural immunization against malaria: causal prophylaxis with antibiotics. Sci Transl Med. 2010;2. pmid:20630856
- 23. Kreutzfeld O, Müller K, Matuschewski K. Engineering of Genetically Arrested Parasites (GAPs) For a Precision Malaria Vaccine. Front Cell Infect Microbiol. 2017;7. pmid:28620583
- 24. Borrmann S, Matuschewski K. Targeting Plasmodium liver stages: better late than never. Trends Mol Med. 2011;17: 527–536. pmid:21737347
- 25. Butler NS, Schmidt NW, Vaughan AM, Aly AS, Kappe SHI, Harty JT. Superior antimalarial immunity after vaccination with late liver stage-arresting genetically attenuated parasites. Cell Host Microbe. 2011;9: 451–462. pmid:21669394
- 26. Mueller AK, Labaled M, Kappe SHI, Matuschewski K. Genetically modified Plasmodium parasites as a protective experimental malaria vaccine. Nature. 2005;433: 164–167. pmid:15580261
- 27. Mueller AK, Camargo N, Kaiser K, Andorfer C, Frevert U, Matuschewski K, et al. Plasmodium liver stage developmental arrest by depletion of a protein at the parasite-host interface. Proc Natl Acad Sci U S A. 2005;102: 3022–3027. pmid:15699336
- 28. Ishino T, Chinzei Y, Yuda M. Two proteins with 6-cys motifs are required for malarial parasites to commit to infection of the hepatocyte. Mol Microbiol. 2005;58: 1264–1275. pmid:16313615
- 29. Van Dijk MR, Douradinha B, Franke-Fayard B, Heussler V, Van Dooren MW, Van Schaijk B, et al. Genetically attenuated, P36p-deficient malarial sporozoites induce protective immunity and apoptosis of infected liver cells. Proc Natl Acad Sci U S A. 2005;102: 12194–12199. pmid:16103357
- 30. Spring M, Murphy J, Nielsen R, Dowler M, Bennett JW, Zarling S, et al. First-in-human evaluation of genetically attenuated Plasmodium falciparum sporozoites administered by bite of Anopheles mosquitoes to adult volunteers. Vaccine. 2013;31: 4975–4983. pmid:24029408
- 31. Dankwa DA, Davis MJ, Kappe SHI, Vaughan AM. A Plasmodium yoelii Mei2-Like RNA Binding Protein Is Essential for Completion of Liver Stage Schizogony. Infect Immun. 2016;84: 1336–1345. pmid:26883588
- 32. Franke-Fayard B, Marin-Mogollon C, Geurten FJA, Chevalley-Maurel S, Ramesar J, Kroeze H, et al. Creation and preclinical evaluation of genetically attenuated malaria parasites arresting growth late in the liver. NPJ Vaccines. 2022;7. pmid:36333336
- 33. Goswami D, Betz W, Locham NK, Parthiban C, Brager C, Schäfer C, et al. A replication-competent late liver stage-attenuated human malaria parasite. JCI Insight. 2020;5. pmid:32484795
- 34. Scheller LF, Wirtz RA, Azad AF. Susceptibility of different strains of mice to hepatic infection with Plasmodium berghei. Infect Immun. 1994;62: 4844–4847. pmid:7927764
- 35. Kumar H, Sattler JM, Singer M, Heiss K, Reinig M, Hammerschmidt-Kamper C, et al. Protective efficacy and safety of liver stage attenuated malaria parasites. Sci Rep. 2016;6. pmid:27241521
- 36. Goswami D, Patel H, Betz W, Armstrong J, Camargo N, Patil A, et al. A replication competent Plasmodium falciparum parasite completely attenuated by dual gene deletion. EMBO Mol Med. 2024;16: 723–754. pmid:38514791
- 37. Stanway RR, Bushell E, Chiappino-Pepe A, Roques M, Sanderson T, Franke-Fayard B, et al. Genome-Scale Identification of Essential Metabolic Processes for Targeting the Plasmodium Liver Stage. Cell. 2019;179: 1112–1128.e26. pmid:31730853
- 38. Cyr DM, Langer T, Douglas MG. DnaJ-like proteins: molecular chaperones and specific regulators of Hsp70. Trends Biochem Sci. 1994;19: 176–181. pmid:8016869
- 39. Chandramouli K, Johnson MK. HscA and HscB stimulate [2Fe-2S] cluster transfer from IscU to apoferredoxin in an ATP-dependent reaction. Biochemistry. 2006;45: 11087–11095. pmid:16964969
- 40. Beinert H, Holm RH, Münck E. Iron-sulfur clusters: nature’s modular, multipurpose structures. Science. 1997;277: 653–659. pmid:9235882
- 41. Lill R, Mühlenhoff U. Iron-sulfur-protein biogenesis in eukaryotes. Trends Biochem Sci. 2005;30: 133–141. pmid:15752985
- 42. Ciofi-Baffoni S, Nasta V, Banci L. Protein networks in the maturation of human iron-sulfur proteins. Metallomics. 2018;10: 49–72. pmid:29219157
- 43. McFadden GI, Reith ME, Munholland J, Lang-Unnasch N. Plastid in human parasites. Nature. 1996;381: 482. pmid:8632819
- 44. Kumar B, Chaubey S, Shah P, Tanveer A, Charan M, Siddiqi MI, et al. Interaction between sulphur mobilisation proteins SufB and SufC: evidence for an iron-sulphur cluster biogenesis pathway in the apicoplast of Plasmodium falciparum. Int J Parasitol. 2011;41: 991–999. pmid:21722645
- 45. Haussig JM, Matuschewski K, Kooij TWA. Identification of vital and dispensable sulfur utilization factors in the Plasmodium apicoplast. PLoS One. 2014;9. pmid:24586983
- 46. Charan M, Choudhary HH, Singh N, Sadik M, Siddiqi MI, Mishra S, et al. [Fe-S] cluster assembly in the apicoplast and its indispensability in mosquito stages of the malaria parasite. FEBS J. 2017;284: 2629–2648. pmid:28695709
- 47. Janse CJ, Ramesar J, Waters AP. High-efficiency transfection and drug selection of genetically transformed blood stages of the rodent malaria parasite Plasmodium berghei. Nat Protoc. 2006;1: 346–356. pmid:17406255
- 48. Niklaus L, Agop-Nersesian C, Schmuckli-Maurer J, Wacker R, Grünig V, Heussler VT. Deciphering host lysosome-mediated elimination of Plasmodium berghei liver stage parasites. Sci Rep. 2019;9. pmid:31138850
- 49. Pfander C, Anar B, Schwach F, Otto TD, Brochet M, Volkmann K, et al. A scalable pipeline for highly effective genetic modification of a malaria parasite. Nat Methods. 2011;8: 1078–1084. pmid:22020067
- 50. Prado M, Eickel N, De Niz M, Heitmann A, Agop-Nersesian C, Wacker R, et al. Long-term live imaging reveals cytosolic immune responses of host hepatocytes against Plasmodium infection and parasite escape mechanisms. Autophagy. 2015;11: 1561–1579. pmid:26208778
- 51. Agop-Nersesian C, De Niz M, Niklaus L, Prado M, Eickel N, Heussler VT. Shedding of host autophagic proteins from the parasitophorous vacuolar membrane of Plasmodium berghei. Sci Rep. 2017;7. pmid:28526861
- 52. Suhrbier A, Holder AA, Wiser MF, Nicholas J, Sinden RE. Expression of the precursor of the major merozoite surface antigens during the hepatic stage of malaria. Am J Trop Med Hyg. 1989;40: 351–355. pmid:2469336
- 53. Takeo S, Kokaze A, Ng CS, Mizuchi D, Watanabe J ichi, Tanabe K, et al. Succinate dehydrogenase in Plasmodium falciparum mitochondria: molecular characterization of the SDHA and SDHB genes for the catalytic subunits, the flavoprotein (Fp) and iron-sulfur (Ip) subunits. Mol Biochem Parasitol. 2000;107: 191–205. pmid:10779596
- 54. Painter HJ, Morrisey JM, Mather MW, Vaidya AB. Specific role of mitochondrial electron transport in blood-stage Plasmodium falciparum. Nature. 2007;446: 88–91. pmid:17330044
- 55. Nagaraj VA, Sundaram B, Varadarajan NM, Subramani PA, Kalappa DM, Ghosh SK, et al. Malaria parasite-synthesized heme is essential in the mosquito and liver stages and complements host heme in the blood stages of infection. PLoS Pathog. 2013;9. pmid:23935500
- 56. Rouault TA, Maio N. Biogenesis and functions of mammalian iron-sulfur proteins in the regulation of iron homeostasis and pivotal metabolic pathways. J Biol Chem. 2017;292: 12744–12753. pmid:28615439
- 57.
The role of iron in the activation-inactivation of aconitase—PubMed. [cited 18 Jun 2024]. https://pubmed.ncbi.nlm.nih.gov/6309829/
- 58. Rouault TA, Tang CK, Kaptain S, Burgess WH, Haile DJ, Samaniego F, et al. Cloning of the cDNA encoding an RNA regulatory protein—the human iron-responsive element-binding protein. Proc Natl Acad Sci U S A. 1990;87: 7958–7962. pmid:2172968
- 59. Gomes-Santos CSS, Braks J, Prudêncio M, Carret C, Gomes AR, Pain A, et al. Transition of Plasmodium sporozoites into liver stage-like forms is regulated by the RNA binding protein Pumilio. PLoS Pathog. 2011;7. pmid:21625527
- 60. Zhang M, Mishra S, Sakthivel R, Fontoura BMA, Nussenzweig V. UIS2: A Unique Phosphatase Required for the Development of Plasmodium Liver Stages. PLoS Pathog. 2016;12. pmid:26735921
- 61. Zhang M, Fennell C, Ranford-Cartwright L, Sakthivel R, Gueirard P, Meister S, et al. The Plasmodium eukaryotic initiation factor-2alpha kinase IK2 controls the latency of sporozoites in the mosquito salivary glands. J Exp Med. 2010;207: 1465–1474. pmid:20584882
- 62. Scheller LF, Azad AF. Maintenance of protective immunity against malaria by persistent hepatic parasites derived from irradiated sporozoites. Proc Natl Acad Sci U S A. 1995;92: 4066–4068. pmid:7732032
- 63. Cockburn IA, Tse SW, Radtke AJ, Srinivasan P, Chen YC, Sinnis P, et al. Dendritic cells and hepatocytes use distinct pathways to process protective antigen from plasmodium in vivo. PLoS Pathog. 2011;7. pmid:21445239
- 64. Balam S, Romero JF, Bongfen SE, Guillaume P, Corradin G. CSP—a model for in vivo presentation of Plasmodium berghei sporozoite antigens by hepatocytes. PLoS One. 2012;7. pmid:23272182