Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Unveiling the endogenous CRISPR-Cas system in Pseudomonas aeruginosa PAO1

Abstract

Multidrug resistance in Pseudomonas aeruginosa, a high-priority pathogen per the World Health Organization, poses a global threat due to carbapenem resistance and limited antibiotic treatments. Using the bioinformatic tools CRISPRCasFinder, CRISPRCasTyper, CRISPRloci, and CRISPRImmunity, we analyzed the genome of P. aeruginosa PAO1 and revealed an orphan CRISPR system, suggesting it may be a remnant of a type IV system due to the presence of the DinG protein. This system comprises two CRISPR arrays and noteworthy DinG and Cas3 proteins, supporting recent evidence about the association between type IV and I CRISPR systems. Additionally, we demonstrated a co-evolutionary relationship between the orphan CRISPR system in P. aeruginosa PAO1 and the mobile genetic element and prophages identified. One self-targeting spacer was identified, often associated with bacterial evolution and autoimmunity, and no Acr proteins. This research opens avenues for studying how these CRISPR arrays regulate pathogenicity and for developing alternative strategies using its endogenous orphan CRISPR system against carbapenem-resistant P. aeruginosa strains.

Introduction

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immune system mechanism present in ∼50% of bacteria that plays a role in regulating virulence factors, which are also regulated by quorum sensing (QS), a cell-cell communication through autoinducers, either in a dependent or independent manner of CRISPR-associated (Cas) proteins [13]. The CRISPR-Cas system facilitates interference processes and is commonly used in genetic engineering [4]. This system is classified into two classes, each subdivided into three types, and a total of 33 subtypes [5]. Recently, the endogenous CRISPR-Cas system has emerged as a genome editing tool for bacteria that carry it due to its effectiveness, simplicity, suitability, and cost-efficiency. It also avoids the potential cytotoxicity associated with the use of heterologous Cas effectors and facilitates plasmid transformation because of its smaller size [6, 7].

The World Health Organization [8] has classified Pseudomonas aeruginosa as a high-priority pathogen due to its multidrug resistance (MDR) posing a global threat. The most critical form is carbapenem-resistant P. aeruginosa (CRPA), particularly in healthcare-associated infections, which has a high mortality rate (>30%) and very limited potential antibiotic treatments.

The P. aeruginosa PAO1 strain is widely utilized in genetics research aimed at understanding and combating drug resistance through the study of biofilm formation, QS, and its disruption, known as quorum quenching (QQ) [9]. For these reasons, it is crucial to identify and characterize the endogenous CRISPR arrays and Cas proteins in P. aeruginosa PAO1 as an initial step towards understanding its CRISPR-Cas system and developing alternative strategies against CRPA.

A bioinformatic approach is essential for understanding the complex functions and evolution of CRISPR-Cas systems. Genomic pattern-matching programs and machine learning algorithms can predict CRISPR arrays, while classical protein homology search tools like the Hidden Markov Model (HMM) can identify Cas proteins in bacteria. For this reason, a combination of various bioinformatic methods is required to characterize each CRISPR-Cas system and understand its evolutionary immune system [1012].

The first study of the CRISPR-Cas system in P. aeruginosa PAO1, using the bioinformatic tool CRISPRFinder, concluded that this strain does not harbor a CRISPR-Cas system [13]. Moreover, nowadays, CRISPRFinder is an old version that has been updated to CRISPRCasFinder. Wheatley and MacLean [14] utilized this last one, and they computationally identified the presence of I-F, I-E, and I-C as CRISPR-Cas system subtypes in 300 P. aeruginosa genomes. However, these studies did not provide precise or additional information concerning punctual CRISPR-Cas details in P. aeruginosa PAO1. Uncertain CRISPR structures should not be overlooked, even if they slightly deviate from canonical forms, as many CRISPR structures initially go undetected because of insufficient processing of microbial genomes in databases [15].

CRISPRimmunity, CRISPRloci, CRISPRCasTyper, and CRISPRCasFinder are some of the most updated bioinformatical tools to identify CRISPR-Cas systems from complete genome sequences, where CRISPRimmunity distinguishes from the others due to its robust development by integrating multiple databases and other computational tools (such as PILER-CR, CRT, and CRISPRidentify), also its Cas database is the most up-to-date using an updated version of HMM similar to that utilized by CRISPRCasTyper and CRISPRCasFinder, while CRISPRloci uses the Casboundary method. Each bioinformatics tool relies on specific databases and algorithms, which can introduce biases. Therefore, using multiple tools for a comprehensive analysis is important, as their combined use mitigates individual biases and provides a more thorough overview of CRISPR-Cas systems in P. aeruginosa PAO1 [1619].

Therefore, the use of advanced bioinformatic tools is crucial to elucidate the endogenous CRISPR-Cas system in P. aeruginosa PAO1. Additionally, it is important to investigate whether this genome harbors prophage sequences and anti-CRISPR (Acr) proteins capable of inactivating its system. Understanding the fundamental aspects of its CRISPR-Cas system could help to decide the suitability of exogenous CRISPR-Cas for future research aimed at engineering P. aeruginosa PAO1, avoiding its endogenous system for biomedical applications towards developing alternative strategies against CRPA, or using its endogenous CRISPR-Cas system as a genome editing tool.

Materials and methods

Obtaining the genome of Pseudomonas aeruginosa PAO1

For this research, the Pseudomonas aeruginosa PAO1 strain was selected, and its genome was obtained from NCBI [20] (https://www.ncbi.nlm.nih.gov/datasets/genome/; accessed on March 20, 2024) with the GenBank accession GCA_000006765.1, name: ASM676v1, which is a complete genome that consists of a circular chromosome (6.3 Mb).

CRISPR-Cas identification in P. aeruginosa PAO1

The identification and comparison of CRISPR arrays and Cas proteins in P. aeruginosa PAO1 was obtained by applying the bioinformatical tools: CRISPRCasFinder [16] v4.2.2 (https://crisprcas.i2bc.paris-saclay.fr/), CRISPRCasTyper [17] v1.8.0 (http://cctyper.crispr.dk), CRISPRloci [18] v1.1.0 (http://rna.informatik.uni-freiburg.de), and CRISPRimmunity [19] (http://www.microbiome-bigdata.com/CRISPRimmunity). The default parameters were used in all four bioinformatic tools.

Validation of CRISPR-Cas system and DR length analysis

In addition to using the four most up-to-date bioinformatic tools mentioned in the previous section, the validation of the CRISPR-Cas system identification was conducted with two well-annotated CRISPR-Cas systems from P. aeruginosa strains PA14, which harbors a CRISPR-Cas type I-F, and P. aeruginosa PA83, which possesses both types I-F and IV-A, attributed to its chromosome and plasmid, respectively [15, 21, 22]. Following the procedure previously described, their genomes were obtained from NCBI [20] (https://www.ncbi.nlm.nih.gov/datasets/genome/; accessed on September 2, 2024) with GenBank accession numbers GCA_000014625.1 and CP017293.1, respectively.

Moreover, a statistical analysis of Direct Repeats (DR) was performed to determine whether the DR sequences found in P. aeruginosa PAO1 align with the length range commonly observed in other organisms. The DR data were obtained from the CRISPRCasdb database [23] (https://crisprcas.i2bc.paris-saclay.fr/). Additionally, DR data from orphan CRISPRs were obtained from the CRISPRimmunity database [19] (http://www.microbiome-bigdata.com/CRISPRimmunity) to compare DR lengths in orphan CRISPR systems in P. aeruginosa strains. The analysis was conducted using STATGRAPHICS Centurion 19 software package (version 19.6.03).

Screening of unknown and neighbor proteins of CRISPR arrays

The neighbor protein sequences of CRISPR arrays and unknown proteins identified with CRISPRimmunity [19] and CRISPRloci [18] were additionally submitted to investigate their conserved domains (functional units in proteins) and refine the protein classification using Batch CD-search [24] (https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi).

Analysis of the adaptive immunity of P. aeruginosa PAO1

The prediction and characterization of prophage sequences, mobile genetic elements (MGE), self-targeting sequences, and anti-CRISPR (Acr) were used to elucidate the co-evolution of CRISPR in P. aeruginosa PAO1 using CRISPRImmunity [19] (http://www.microbiome-bigdata.com/CRISPRimmunity).

Phylogenetic analysis and the relation between the CRISPR system and prophages

The multiple sequence alignment was performed using MEGA11 [25], incorporating the prophage sequences, CRISPR spacers, and the MGE identified in P. aeruginosa PAO1, aligned with CLUSTALW. Additionally, Enterobacteria phage T4 (NC_000866.4) was included as the phage outgroup. The best-fitting DNA model, namely Hasegawa–Kishino–Yano model (HKY)+F+G4, was determined using IQ-TREE 2 [26], which also applied the bootstrap method with 100,000 bootstrap replications to test the phylogeny, enabling faster analysis. The phylogenetic tree was visualized using FigTree [27].

Results

Identification of the CRISPR-Cas system in P. aeruginosa PAO1

An orphan CRISPR system was identified in P. aeruginosa PAO1 using the CRISPRimmunity bioinformatic tool. This system is composed of two CRISPR arrays (one of 114 bp and another of 228 bp length; the first array was also identified using CRISPRCasFinder, with an evidence level 1 indicating a low potential for this CRISPR array) (Table 1).

thumbnail
Table 1. CRISPR arrays in P. aeruginosa PAO1.

https://doi.org/10.1371/journal.pone.0312783.t001

The noteworthy consensus among CRISPRImmunity, CRISPRloci, and CRISPRCasTyper is the identification of DinG and Cas3 proteins (see S1 Dataset for more details on the identification of the CRISPR-Cas system). Individually, CRISPRimmunity detected six signature genes encoding the accessory proteins DinG, Cas3, RT, WYL, Csa3, DEDDh, and TnsC. Meanwhile, CRISPRloci identified the proteins Cas1, Cas7, Cas8, Cas11, and Csx3 without CRISPR arrays. Moreover, CRISPRCasTyper identified the proteins Csf4, CysH, RecD, and NYN with no CRISPR arrays.

Validation of CRISPR-Cas system and DR length analysis

The CRISPR-Cas system in P. aeruginosa PA14 was identified as a type I-F, consisting of the proteins Cas6, Cas7, Cas5f, Cas8, Cas3-Cas2, Cas1, Csy3, Csy2, and Csy1, using CRISPRImmunity, CRISPRCasFinder, and CRISPRCasTyper, but was not identified with CRISPRloci. For P. aeruginosa PA83 the CRISPR-Cas type I-F was identified using all four bioinformatic tools. Additionally, a CRISPR-Cas type IV located on plasmid was identified specifically through CRISPRCasFinder and CRISPRimmunity and includes the proteins Csf5, Csf4, Csf3, Csf2, and Csf1 (additional information on the CRISPR-Cas system of both strains can be found in the S2 Dataset).

Regarding the statistical analysis of DR length, the analysis of 28,712 DR sequences in several organisms yielded an average DR length of 31.57 bp, with a standard deviation of 4.23 bp, a median of 30 bp, and a minimum and maximum length of 23 bp and 50 bp, respectively. Among these, 4,225 DR sequences had a length of 28 bp, matching the DR length in CRISPR array 1 of P. aeruginosa PAO1, and four DR sequences had a length of 50 bp, corresponding to the DR length in CRISPR array 2. In contrast, the analysis of 122 P. aeruginosa strains identified with orphan CRISPR systems, encompassing 1,809 DR sequences, resulted in an average DR length of 29.54 bp, with a standard deviation of 6.85 bp, and a minimum and maximum length of 15 bp and 55 bp, respectively. Of these, 1,201 DR sequences in P. aeruginosa strains had a length of 28 bp, consistent with the DR in CRISPR array 1 of P. aeruginosa PAO1, and 56 DR sequences with the length of 50 bp, corresponding to the DR length in CRISPR array 2 (see S3 Dataset for more details on DR length).

Screening of unknown and neighbor proteins of CRISPR arrays

In the genome of P. aeruginosa PAO1, CRISPRloci detected four unknown proteins as possible candidates for Cas proteins (S4 Dataset). These sequences identified have the conserved domains of RimL, MiaB, HupE/UreJ, FecR, and DUF4880. On the other hand, CRISPRImmunity threw 40 sequences as possible Cas proteins, 20 for each CRISPR array identified, of which only 35 have conserved domains: PvdQ, potG superfamily, 2-thiour_desulf, AcrR, agmatine_aguB, Arabinose_bd, AraC, COG3224, COG3450, COG3492, DadA, DUF6160 superfamily, DUF6436, EGL9, folX, GlnA, HisM, HopJ, HTH_18, hydroxyacyl-CoA-like_DH_SDR_c-like, LrgB, MenH, MopI, PBP2_PotF, Peptidase_C26, PldB, PRK05723, PRK06483, PRK07044, PRK07480, PRK08259, PRK12606, ssuB, transpos_IS110 superfamily and YohJ.

Analysis of the adaptive immunity of P. aeruginosa PAO1

Bioinformatic analysis of P. aeruginosa PAO1 reveals the presence of one MGE, one self-targeting spacer, four prophages (Table 2), and no Acr proteins. The MGE found in P. aeruginosa PAO1 corresponds to the Pseudomonas phage vB_Pae_CF23b (MK511017.1), with the protospacer located at 32–85 (bp) that matches with the Spacer-2 (92.6% identity). According to this result, Spacer-2 is associated with the adaptation of the CRISPR-Cas system in P. aeruginosa PAO1, where the MGE from Pseudomonas phage vB_Pae_CF23b was incorporated into CRISPR array 2. The match between protospacer from the Pseudomonas phage vB_Pae_CF23b (MK511017.1) and Spacer-2 is shown below:

CAGCTCGGCAGAGGCTACGGCGGATAACGCCTGGGGGCGTTATTCGCCCTACCG Spacer-2

CCCCACAGCAGAGGCTACGGCGGATAACGCCTGGGGGCGTTATTCGCCCTACCG Protospacer

thumbnail
Table 2. Prophage identification in P. aeruginosa PAO1.

https://doi.org/10.1371/journal.pone.0312783.t002

P. aeruginosa PAO1 harbors one self-targeting spacer in which the protospacer matches with an identity of 100% with the CRISPR Spacer-3 identified in previous subtitles. The protospacer is located at 3843530–3843580 (bp), with a length of 51 bp. Given that the self-targeting spacer does not resemble the prophage sequences detected, P. aeruginosa PAO1 did not incorporate it into its genome from those prophages. The sequence of the self-targeting spacer found is CCTCGGCAGGCGTTTCGGCGGATAACGCCTGGGGCGTTATTCGCCCTACCG.

Phylogenetic analysis of relation between the CRISPR spacers, prophages, and MGE

The phylogenetic tree was constructed to infer whether the identified prophages share a common origin and homology. The genome sequences of the four prophages Phage PS17 (D26449.1), Pseudomonas phage Pf1 (NC_001331.1), an uncultured Caudovirales phage (NC_055725.1), and Pseudomonas phage DVM-2008 (EU982300.1), along with the CRISPR-Cas spacers found in P. aeruginosa PAO1, were used to construct the phylogenetic tree, as shown in Fig 1.

thumbnail
Fig 1. Maximum likelihood bootstrap phylogenetic tree of CRISPR spacers, prophages, and MGE in P. aeruginosa PAO1.

Enterobacteria phage T4 was included to serve as the phage outgroup for phylogenetic rooting. Constructed with Hasegawa–Kishino–Yano model (HKY)+F+G4 and 100,000 bootstrap replicates. Evolutionary analyses were conducted in IQ-TREE 2.

https://doi.org/10.1371/journal.pone.0312783.g001

Spacer-2 and the MGE identified, which corresponds to the Pseudomonas phage vB_Pae_CF23b (MK511017.1), show a high resolution between these sequences (89%). Moreover, the evolutionary history of Spacer-3, which matches the protospacer of the self-targeting spacer, is clearly evolutionary-associated (90%) with Pseudomonas phage Pf1 (NC_001331.1). Additionally, Spacer-1 has similarities (70%) with uncultured Caudovirales phage (NC_055725.1); it is also revealing that the prophage NC_001331.1 and the MGE MK511017.1 belong to similar evolutionary origins. On the other hand, Phage PS17 (D26449.1), uncultured Caudovirales phage (NC_055725.1), and Pseudomonas phage DVM-2008 (EU982300.1) belong to distinct lineages within the family of bacteriophages.

Discussion

The orphan CRISPR system identified in P. aeruginosa PAO1 is suggested to be maintained to perform relevant biological functions, such as the regulation of other gene expression, although these functions are not yet fully understood [28]. The DRs identified in the two CRISPR arrays are within the range of 23 to 50 bp, as observed in the analysis of 28,712 DR sequences. Additionally, these DRs are more aligned with the DR length in orphan CRISPR systems in P. aeruginosa strains, which have a wider length range of up to 55 bp, consistent with literature reports that indicate a maximum DR length of 55 bp for bacteria [29, 30]. The identification of the CRISPR-Cas system using the four bioinformatic tools was validated with P. aeruginosa PA14 and PA83. The results for these strains are consistent with the literature, showing a CRISPR-Cas type I-F in P. aeruginosa PA14 and both a type I-F on the chromosome and a type IV-A on the plasmid in P. aeruginosa PA83) [15, 21, 22].

It is possible that this orphan CRISPR system in P. aeruginosa PAO1 employs the proteins surrounding the CRISPR arrays as the Cas machinery [31, 32]. Remarkably, the detected Cas proteins include DinG and Cas3, supporting recent evidence about the association between type IV and I CRISPR systems [33]. DinG is deeply associated with CRISPR-Cas IV-A by mediating RNA-guided interference against plasmids; on the other hand, Cas3 is categorized as CRISPR-Cas type I and is generally bound to the CRISPR-associated complex for antiviral defense (Cascade) [14, 15, 22, 34, 35].

The other Cas proteins identified are RT, WYL, Csa3, and DEDDh, which are CRISPR ancillary effectors, and TnsC, which is an effector transposon [5, 19, 36]. Cas1 is required for CRISPR-Cas adaptive immunity and is one of the most evolutionarily conserved components of all CRISPR-Cas systems [37]. Cas7, involved in CRISPR-Cas type IV, and Cas11 are implicated in locking the target DNA after it hybridizes with the CRISPR RNA (crRNA) [38]. Cas8 is involved in immune activation and regulation [39]. Csx3 acts as a ring nuclease identified in type IV and III CRISPR-Cas systems [40, 41]. Csf4, which pertains to the DinG family, and RecD are helicases; CysH possibly acts as a putative effector, all pertaining to CRISPR-Cas type IV systems [33, 42, 43]. The nuclease NYN has implications for crRNA maturation; nonetheless, it is important to establish that this protein has not been well explored [44, 45].

Despite the identification of Cas1, which is involved in spacer acquisition, this CRISPR system lacks a complete Cas1-Cas2 adaption module. Additionally, a co-evolutionary relationship has been demonstrated between the MGE and prophages identified and the orphan CRISPR system in P. aeruginosa PAO1. This is evidenced by the detection of protospacers integrated as spacers in the CRISPR arrays, indicating a dynamic role in defense against bacteriophages; both are distinctive features of type IV CRISPR-Cas systems [46]. These new findings contrast with previous studies on the CRISPR-Cas system of P. aeruginosa PAO1, which utilized only one computational tool and had fewer databases for comparing CRISPR arrays and Cas proteins [13, 14].

In accordance with the conserved domains identified, PvdQ is a Quorum Quenching enzyme that degrades the autoinducers of QS, suggesting a potential regulation of QS by the CRISPR system through the activation of PvdQ [47]. In the case of the potG superfamily, potG has been declared an off-target integration site that can increase the crRNA expression levels and strengthen the immune response. HopJ, transpos_IS110 superfamily, AraC, and DadA act in some way on the transcription and packaging processes of genetic material, which may be closely related to the adaptive mechanisms of the microorganism for the development of resistance to antibiotics and virulence factors [4852].

Furthermore, RimL acetylates ribosomal proteins at the Nα terminal and is involved in CRISPR-related activities, though its precise function remains unclear [53, 54]. Based on a CRISPR-based dataset, it has been suggested that the tRNA modification enzyme MiaB plays a significant role in cellular functions [55]. It is important to highlight that the purposes of some of the identified domains remain unknown, necessitating further studies.

Notably, the Spacer-2 is associated with the adaptation of the CRISPR-Cas system in P. aeruginosa PAO1, where the Pseudomonas phage vB_Pae_CF23b, with no Acr protein detected, was incorporated into CRISPR array 2, indicating that its integration into the CRISPR-Cas system confers immunity against this specific phage without the capability to inactivate it [5658]. This spacer could be integrated through naïve acquisition from RNA due to the presence of the adaptor Cas1. This mechanism aligns with the acquisition found in type I-E and IV-A CRISPR-Cas systems. Self-targeting spacers are often associated with bacterial evolution, autoimmunity, genome remodeling, and CRISPR-Cas inactivation [59, 60].

These findings reinforce the accurate theory that CRISPR-Cas systems act as a form of acquired immunity and suggest potential gene exchange events between CRISPR spacers in P. aeruginosa PAO1 and the prophages and the MGE found in its genome [11, 61]. The self-targeting spacer identified in P. aeruginosa PAO1 opens the potential for further investigations into its use for phage therapy by using the closely related phage (Pseudomonas phage Pf1) of the self-targeting spacer (Spacer-3) to activate the CRISPR system, thereby inhibiting growth and exacerbating lysis through the combined action of the phage and the toxicity of the self-targeting spacer [6264].

This orphan CRISPR system appears to be more closely related to CRISPR-Cas class 1 type IV, associated with type I due to the presence of Cas3, and potentially evolved from type III due to the presence of Csx [46]. This system could be a remnant of a decaying CRISPR-Cas system or that Cas protein loss was caused by interaction between the bacterium and a foreign MGE [5]. This theory is supported by the recent categorization of new P. aeruginosa strains, such as P. aeruginosa PA83, as CRISPR-Cas type IV and the emerging findings about the co-option of type IV and I CRISPR-Cas systems between hosts and MGEs to overcome limitations [22, 65]. These results indicate a complex regulatory network for the CRISPR system in P. aeruginosa PAO1 without sufficient available information to consider it an effective CRISPR-Cas system. However, literature highlights the presence of functional CRISPR systems, even when they are incomplete [66].

Conclusions

This research identified that P. aeruginosa PAO1 possesses an orphan CRISPR system, comprising two CRISPR arrays with noteworthy DinG and Cas3 proteins, one self-targeting spacer, and no Acr. The orphan CRISPR system found suggest it may be remnants of a decaying type IV CRISPR-Cas system, with the loss of Cas2 in the adaptive module potentially due to interaction between the bacterium and foreign MGEs. There is a possibility that the neighboring proteins of the CRISPR arrays could function as CRISPR effector proteins. These findings suggest that the endogenous CRISPR system of P. aeruginosa PAO1 will not interfere with the use of an exogenous class 2 CRISPR-Cas system for genetic engineering. Furthermore, this opens the possibility for future research into how the CRISPR arrays in P. aeruginosa PAO1 regulate its pathogenicity, the precise evolutionary context of its orphan CRISPR system, and further genome editing tools using its endogenous orphan CRISPR system to explore alternative strategies against carbapenem-resistant P. aeruginosa strains.

Supporting information

S1 Dataset. Identification of CRISPR-Cas system through CRISPRCasFinder, CRISPRCasTyper, CRISPRloci, and CRISPRimmunity.

https://doi.org/10.1371/journal.pone.0312783.s001

(XLSX)

S2 Dataset. Validation of CRISPR-Cas identification with P. aeruginosa PA14 and PA83.

https://doi.org/10.1371/journal.pone.0312783.s002

(XLSX)

S3 Dataset. DR length in CRISPR-Cas and orphan CRISPR systems in P. aeruginosa strains.

https://doi.org/10.1371/journal.pone.0312783.s003

(XLSX)

S4 Dataset. Cas and neighbor proteins of CRISPR arrays through CRISPRloci and CRISPRimmunity.

https://doi.org/10.1371/journal.pone.0312783.s004

(XLSX)

References

  1. 1. Mohanraju P, Saha C, van Baarlen P, Louwen R, Staals RHJ, van der Oost J. Alternative functions of CRISPR–Cas systems in the evolutionary arms race. Nat Rev Microbiol. 2022;20: 351–364. pmid:34992260
  2. 2. Qin S, Xiao W, Zhou C, Pu Q, Deng X, Lan L, et al. Pseudomonas aeruginosa: pathogenesis, virulence factors, antibiotic resistance, interaction with host, technology advances and emerging therapeutics. Signal Transduct Target Ther. 2022;7. pmid:35752612
  3. 3. Høyland-Kroghsbo NM, Paczkowski J, Mukherjee S, Broniewski J, Westra E, Bondy-Denomy J, et al. Quorum sensing controls the Pseudomonas aeruginosa CRISPR-Cas adaptive immune system. Proc Natl Acad Sci U S A. 2017;114: 131–135. pmid:27849583
  4. 4. Wei J, Li Y. CRISPR-based gene editing technology and its application in microbial engineering. Engineering Microbiology. 2023;3. pmid:39628916
  5. 5. Makarova KS, Wolf YI, Iranzo J, Shmakov SA, Alkhnbashi OS, Brouns SJJ, et al. Evolutionary classification of CRISPR–Cas systems: a burst of class 2 and derived variants. Nat Rev Microbiol. 2020;18: 67–83. pmid:31857715
  6. 6. Liu L, Helal SE, Peng N. CRISPR-Cas-Based engineering of probiotics. BioDesign Research. 2023;5. pmid:37849462
  7. 7. Poulalier-Delavelle M, Baker JP, Millard J, Winzer K, Minton NP. Endogenous CRISPR/Cas systems for genome engineering in the acetogens Acetobacterium woodii and Clostridium autoethanogenum. Front Bioeng Biotechnol. 2023;11. pmid:37425362
  8. 8. World Health Organization. WHO Bacterial Priority Pathogens List, 2024: bacterial pathogens of public health importance to guide research, development and strategies to prevent and control antimicrobial resistance. Geneva; 2024 May. Available: https://www.who.int/publications/i/item/9789240093461
  9. 9. Grace A, Sahu R, Owen DR, Dennis VA. Pseudomonas aeruginosa reference strains PAO1 and PA14: A genomic, phenotypic, and therapeutic review. Front Microbiol. 2022;13. pmid:36312971
  10. 10. Liu Z, Liu J, Yang Z, Zhu L, Zhu Z, Huang H, et al. Endogenous CRISPR-Cas mediated in situ genome editing: State-of-the-art and the road ahead for engineering prokaryotes. Biotechnol Adv. 2023;68. pmid:37633620
  11. 11. Alkhnbashi OS, Meier T, Mitrofanov A, Backofen R, Voß B. CRISPR-Cas bioinformatics. Methods. 2020;172: 3–11. pmid:31326596
  12. 12. Sharma S, Murmu S, Das R, Tilgam J, Saakre M, Paul K. A review on bioinformatics advances in CRISPR-Cas technology. J Plant Biochem Biotechnol. 2023;32: 791–807.
  13. 13. Sánchez D, Gomila M, Bennasar A, Lalucat J, García-Valdes E. Genome analysis of environmental and clinical P. aeruginosa isolates from sequence type-1146. PLoS One. 2014;9. pmid:25329302
  14. 14. Wheatley RM, MacLean RC. CRISPR-Cas systems restrict horizontal gene transfer in Pseudomonas aeruginosa. ISME Journal. 2021;15: 1420–1433. pmid:33349652
  15. 15. Parra-Sánchez Á, Antequera-Zambrano L, Martínez-Navarrete G, Zorrilla-Muñoz V, Paz JL, Alvarado YJ, et al. Comparative Analysis of CRISPR-Cas Systems in Pseudomonas Genomes. Genes (Basel). 2023;14. pmid:37510242
  16. 16. Couvin D, Bernheim A, Toffano-Nioche C, Touchon M, Michalik J, Néron B, et al. CRISPRCasFinder, an update of CRISRFinder, includes a portable version, enhanced performance and integrates search for Cas proteins. Nucleic Acids Res. 2018;46: W246–W251. pmid:29790974
  17. 17. Russel J, Pinilla-Redondo R, Mayo-Muñoz D, Shah SA, Sørensen SJ. CRISPRCasTyper: automated identification, annotation, and classification of CRISPR-Cas loci. CRISPR Journal. 2020;3: 462–469. pmid:33275853
  18. 18. Alkhnbashi OS, Mitrofanov A, Bonidia R, Raden M, Tran VD, Eggenhofer F, et al. CRISPRloci: Comprehensive and accurate annotation of CRISPR-Cas systems. Nucleic Acids Res. 2021;49: W125–W130. pmid:34133710
  19. 19. Zhou F, Yu X, Gan R, Ren K, Chen C, Ren C, et al. CRISPRimmunity: An interactive web server for CRISPR-associated Important Molecular events and Modulators Used in geNome edIting Tool identifYing. Nucleic Acids Res. 2023;51: W93–W107. pmid:37216595
  20. 20. National Center for Biotechnology Information. Genome assembly ASM676v1. In: NCBI [Internet]. 2006 [cited 20 Mar 2024]. Available: https://www.ncbi.nlm.nih.gov/datasets/genome/GCF_000006765.1/
  21. 21. Cui N, Zhang JT, Liu Y, Liu Y, Liu XY, Wang C, et al. Type IV-A CRISPR-Csf complex: Assembly, dsDNA targeting, and CasDinG recruitment. Mol Cell. 2023;83: 2493–2508.e5. pmid:37343553
  22. 22. Crowley VM, Catching A, Taylor HN, Borges AL, Metcalf J, Bondy-Denomy J, et al. A Type IV-A CRISPR-Cas System in Pseudomonas aeruginosa Mediates RNA-Guided Plasmid Interference In Vivo. CRISPR J. 2019;2: 434–440. pmid:31809194
  23. 23. Pourcel C, Touchon M, Villeriot N, Vernadet JP, Couvin D, Toffano-Nioche C, et al. CRISPRCasdb a successor of CRISPRdb containing CRISPR arrays and cas genes from complete genome sequences, and tools to download and query lists of repeats and spacers. Nucleic Acids Res. 2020;48: D535–D544. pmid:31624845
  24. 24. Wang J, Chitsaz F, Derbyshire MK, Gonzales NR, Gwadz M, Lu S, et al. The conserved domain database in 2023. Nucleic Acids Res. 2023;51: D384–D388. pmid:36477806
  25. 25. Tamura K, Stecher G, Kumar S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol. 2021;38: 3022–3027. pmid:33892491
  26. 26. Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, Von Haeseler A, et al. IQ-TREE 2: new models and efficient methods for phylogenetic inference in the genomic era. Mol Biol Evol. 2020;37: 1530–1534. pmid:32011700
  27. 27. Rambaut A. FigTree v1.4.4. Institute of Evolutionary Biology, University of Edinburgh, Edinburgh; 2018. Available: http://tree.bio.ed.ac.uk/software/figtree/
  28. 28. Butiuc-Keul A, Farkas A, Carpa R, Iordache D. CRISPR-Cas System: The powerful modulator of accessory genomes in prokaryotes. Microb Physiol. 2022;32: 2–17. pmid:34192695
  29. 29. Ge R, Mai G, Wang P, Zhou M, Luo Y, Cai Y, et al. CRISPRdigger: Detecting CRISPRs with better direct repeat annotations. Sci Rep. 2016;6. pmid:27596864
  30. 30. Buyukyoruk M, Henriques WS, Wiedenheft B. Clarifying CRISPR: why repeats identified in the human genome should not be considered CRISPRs. CRISPR Journal. 2023;6: 216–221. pmid:37042651
  31. 31. Tao S, Zhou D, Chen H, Li N, Zheng L, Fang Y, et al. Analysis of genetic structure and function of clustered regularly interspaced short palindromic repeats loci in 110 Enterococcus strains. Front Microbiol. 2023;14. pmid:37168121
  32. 32. Pinilla-Redondo R, Russel J, Mayo-Muñoz D, Shah SA, Garrett RA, Nesme J, et al. CRISPR-Cas systems are widespread accessory elements across bacterial and archaeal plasmids. Nucleic Acids Res. 2022;50: 4315–4328. pmid:34606604
  33. 33. Pinilla-Redondo R, Mayo-Muñoz D, Russel J, Garrett RA, Randau L, Sørensen SJ, et al. Type IV CRISPR-Cas systems are highly diverse and involved in competition between plasmids. Nucleic Acids Res. 2020;48: 2000–2012. pmid:31879772
  34. 34. Cady KC, Bondy-Denomy J, Heussler GE, Davidson AR, O’Toole GA. The CRISPR/Cas adaptive immune system of Pseudomonas aeruginosa mediates resistance to naturally occurring and engineered phages. Journal of Bacteriology. 2012. pp. 5728–5738. pmid:22885297
  35. 35. van Belkum A, Soriaga LB, LaFave MC, Akella S, Veyrieras JB, Barbu EM, et al. Phylogenetic distribution of CRISPR-Cas systems in antibiotic-resistant Pseudomonas aeruginosa. mBio. 2015;6. pmid:26604259
  36. 36. Zheng W, Xia Y, Wang X, Gao S, Zhou D, Fu J, et al. Cascade-Cas3 facilitates high-accuracy genome engineering in Pseudomonas using phage-encoded homologous recombination. Engineering Microbiology. 2022;2. pmid:39628699
  37. 37. Salgado O, Guajardo-Leiva S, Moya-Beltrán A, Barbosa C, Ridley C, Tamayo-Leiva J, et al. Global phylogenomic novelty of the Cas1 gene from hot spring microbial communities. Front Microbiol. 2022;13. pmid:36532491
  38. 38. Hryhorowicz M, Lipiński D, Zeyland J. Evolution of CRISPR/Cas systems for precise genome editing. Int J Mol Sci. 2023;24. pmid:37762535
  39. 39. Liu TY, Doudna JA. Chemistry of Class 1 CRISPR-Cas effectors: Binding, editing, and regulation. Journal of Biological Chemistry. 2020;295: 14473–14487. pmid:32817336
  40. 40. Kamruzzaman M, Iredell JR. CRISPR-Cas system in antibiotic resistance plasmids in Klebsiella pneumoniae. Front Microbiol. 2020;10. pmid:31998256
  41. 41. Stella G, Marraffini L. Type III CRISPR-Cas: beyond the Cas10 effector complex. Trends Biochem Sci. 2024;49: 28–37. pmid:37949766
  42. 42. Al-Shayeb B, Skopintsev P, Soczek KM, Stahl EC, Li Z, Groover E, et al. Diverse virus-encoded CRISPR-Cas systems include streamlined genome editors. Cell. 2022;185: 4574–4586.e16. pmid:36423580
  43. 43. Taylor HN, Laderman E, Armbrust M, Hallmark T, Keiser D, Bondy-Denomy J, et al. Positioning Diverse Type IV Structures and Functions Within Class 1 CRISPR-Cas Systems. Front Microbiol. 2021;12. pmid:34093491
  44. 44. Matelska D, Steczkiewicz K, Ginalski K. Comprehensive classification of the PIN domain-like superfamily. Nucleic Acids Res. 2017;45: 6995–7020. pmid:28575517
  45. 45. Chi H, White MF. RNA processing by the CRISPR-associated NYN ribonuclease. Biochemical Journal. 2024;481: 793–804. pmid:38785320
  46. 46. Moya-Beltrán A, Makarova KS, Acuña LG, Wolf YI, Covarrubias PC, Shmakov SA, et al. Evolution of Type IV CRISPR-Cas Systems: Insights from CRISPR loci in integrative conjugative elements of Acidithiobacillia. CRISPR Journal. 2021;4: 656–672. pmid:34582696
  47. 47. Billot R, Plener L, Jacquet P, Elias M, Chabrière E, Daudé D. Engineering acyl-homoserine lactone-interfering enzymes toward bacterial control. Journal of Biological Chemistry. 2020;295: 12993–13007. pmid:32690609
  48. 48. Nivala J, Shipman SL, Church GM. Spontaneous CRISPR loci generation in vivo by non-canonical spacer integration. Nat Microbiol. 2018;3: 310–318. pmid:29379209
  49. 49. Jurado-Martín I, Sainz-Mejías M, McClean S. Pseudomonas aeruginosa: An audacious pathogen with an adaptable arsenal of virulence factors. Int J Mol Sci. 2021;22: 1–37. pmid:33803907
  50. 50. Mei L, Song Y, Liu D, Li Y, Liu L, Yu K, et al. Characterization of a mobilizable megaplasmid carrying multiple resistance genes from a clinical isolate of Pseudomonas aeruginosa. Front Microbiol. 2023;14. pmid:38088964
  51. 51. Clarke A, Llabona IM, Khalid N, Hulvey D, Irvin A, Adams N, et al. Tolfenpyrad displays Francisella-targeted antibiotic activity that requires an oxidative stress response regulator for sensitivity. Microbiol Spectr. 2023;11. pmid:37800934
  52. 52. Oliver KE. Characterization of the Role of dadA in Pseudomonas aeruginosa Virulence Factor Production. Auburn University. 2011.
  53. 53. Leonardo Silvestre H, Asensio JL, Blundell TL, Bastida A, Bolanos-Garcia VM. Functional and structural characterisation of RimL from Bacillus cereus, a new Nα-acetyltransferase of ribosomal proteins that was wrongly assigned as an aminoglycosyltransferase. Int J Biol Macromol. 2024;263. pmid:38395274
  54. 54. Cao J, Wang T, Wang Q, Zheng X, Huang L. Functional insights into protein acetylation in the hyperthermophilic archaeon Sulfolobus islandicus. Molecular and Cellular Proteomics. 2019;18: 1572–1587. pmid:31182439
  55. 55. Renaud EA, Pamukcu S, Cerutti A, Berry L, Lemaire-Vieille C, Yamaryo-Botté Y, et al. Disrupting the plastidic iron-sulfur cluster biogenesis pathway in Toxoplasma gondii has pleiotropic effects irreversibly impacting parasite viability. Journal of Biological Chemistry. 2022;298. pmid:35810787
  56. 56. Faure G, Shmakov SA, Yan WX, Cheng DR, Scott DA, Peters JE, et al. CRISPR–Cas in mobile genetic elements: counter-defence and beyond. Nat Rev Microbiol. 2019;17: 513–525. pmid:31165781
  57. 57. Pinilla-Redondo R, Shehreen S, Marino ND, Fagerlund RD, Brown CM, Sørensen SJ, et al. Discovery of multiple anti-CRISPRs highlights anti-defense gene clustering in mobile genetic elements. Nat Commun. 2020;11. pmid:33159058
  58. 58. Westra ER, Levin BR. It is unclear how important CRISPR-Cas systems are for protecting natural populations of bacteria against infections by mobile genetic elements. Proceedings of the National Academy of Sciences. 2020;117: 27777–27785. pmid:33122438
  59. 59. Wimmer F, Beisel CL. CRISPR-Cas systems and the paradox of self-targeting spacers. Front Microbiol. 2020;10. pmid:32038537
  60. 60. Devi V, Harjai K, Chhibber S. Self-targeting spacers in CRISPR-array: Accidental occurrence or evolutionarily conserved phenomenon. J Basic Microbiol. 2022;62: 4–12. pmid:34904260
  61. 61. Iqbal S, Begum F. Identification and characterization of integrated prophages and CRISPR-Cas system in Bacillus subtilis RS10 genome. Brazilian Journal of Microbiology. 2024;55: 537–542. pmid:38216797
  62. 62. Østergaard MZ, Nielsen FD, Meinfeldt MH, Kirkpatrick CL. The uncharacterized PA3040-3042 operon is part of the cell envelope stress response and a tobramycin resistance determinant in a clinical isolate of Pseudomonas aeruginosa. Cascales E, editor. Microbiol Spectr. 2024. pmid:38949386
  63. 63. Secor PR, Burgener EB, Kinnersley M, Jennings LK, Roman-Cruz V, Popescu M, et al. Pf Bacteriophage and their impact on Pseudomonas virulence, mammalian immunity, and chronic infections. Front Immunol. 2020;11. pmid:32153575
  64. 64. Prokopczuk FI, Im H, Campos-Gomez J, Orihuela CJ, Martínez E. Engineered Superinfective Pf Phage Prevents Dissemination of Pseudomonas aeruginosa in a Mouse Burn Model. mBio. 2023;14. pmid:37039641
  65. 65. Benz F, Camara-Wilpert S, Russel J, Wandera KG, Čepaitė R, Ares-Arroyo M, et al. Type IV-A3 CRISPR-Cas systems drive inter-plasmid conflicts by acquiring spacers in trans. Cell Host Microbe. 2024. pmid:38754416
  66. 66. Guzmán NM, Esquerra-Ruvira B, Mojica FJM. Digging into the lesser-known aspects of CRISPR biology. International Microbiology. 2021;24: 473–498. pmid:34487299