Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

White LED intensities during co-cultivation affect the Agrobacterium-mediated soybean (Glycine max) transformation using mature half seeds as explants

  • Xiaonan Shi,

    Roles Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Resources, Software, Validation, Visualization, Writing – original draft, Writing – review & editing

    Affiliation Department of Horticultural Science, North Carolina State University, Raleigh, NC, United States of America

    ⨯
  • Baochun Li,

    Roles Conceptualization, Funding acquisition, Methodology, Writing – review & editing

    Affiliation BASF Agricultural Solutions, Durham, NC, United States of America

    ⨯
  • Marcela Rojas-Pierce,

    Roles Methodology, Writing – review & editing

    Affiliation Department of Plant and Microbial Biology, North Carolina State University, Raleigh, NC, United States of America

    ⨯
  • Ricardo Hernández

    Roles Conceptualization, Formal analysis, Funding acquisition, Methodology, Project administration, Resources, Supervision, Validation, Visualization, Writing – review & editing

    rhernan4@ncsu.edu

    Affiliation Department of Horticultural Science, North Carolina State University, Raleigh, NC, United States of America

    ⨯

Abstract

The transition of light fixture from fluorescent light to light-emitting diodes (LEDs) in growth chambers prompts a reevaluation of current practices in plant biotechnology. Agrobacterium-mediated transformation is crucial for genetic engineering and genome editing in soybean (Glycine max). The critical co-cultivation step of soybean transformation occurs under light condition. Current protocols for co-cultivation in soybean transformation lack a standard for light intensity. In the present study, the objective is to investigate the effect of light intensity during co-cultivation on soybean transformation efficiency. Five light intensities were implemented during five days of co-cultivation: 50, 100, 150, 190 μmol∙m−2∙s−1 of white LEDs in addition to 100 μmol∙m−2∙s−1 of fluorescent light. After co-cultivation, all the explants underwent shoot induction and elongation with selection pressure, rooting and acclimation under uniform condition. The experiment was conducted with two selectable markers, hppdPf-4Pa and bar, separately, investigating whether the potential light effects vary due to the marker-associated pathways. The positive PCR analysis of rooted in vitro plants suggested successful transformation events achieved under both selectable markers across all light treatments ranging from 2.4% to 6.9%. Increasing LED light intensity during co-cultivation resulted in different transformation efficiencies between the two selectable markers. Results indicated that increasing the light intensity during co-cultivation led to a linear increase in transformation efficiency when shoot regeneration was under 4-Hydroxyphenylpyruvate dioxygenase (HPPD) inhibitor selection. No difference in transformation efficiency was detected among the treatments under glufosinate selection. Furthermore, when selection occurred with HPPD inhibitor, variation of transformation efficiency was also observed between fluorescent light and white LED at 100 μmol∙m−2∙s−1. The results highlight the significance and potential applications of investigating the impact of light on transformation efficiency.

Introduction

The rapid emergence of light-emitting diodes (LEDs) technology has revolutionized lighting systems, offering high energy efficacy and prolonged durability [1]. Consequently, there has been a notable transition from fluorescent to LED lights in various industrial sectors. In plant biotechnology, growth chambers have been increasingly outfitted with LED fixtures [2]. LED fixtures have 200% higher fixture efficacy (2.2–3.2 μmol J-1) compared to fluorescent lamps (~0.84–0.95 μmol J-1) [1] which are commonly used on tissue culture chambers. Therefore, with LEDs, it is more feasible to increase light intensity with the same power input. Previous studies have demonstrated enhanced plant growth with increased light intensity and variations in endogenous phytohormone levels for soybean plants ex vitro under different light intensities [3, 4]. Additionally, while white LEDs produce a broad spectrum like fluorescent lamps, there are differences in the light spectrum profiles between the two. Even though several studies have demonstrated successful explant growth in vitro under various light intensities of LEDs, question remains whether different response of explant growth and development exist between fluorescent and LEDs. It is imperative to evaluate plant tissue responses to LEDs compared to fluorescent lights to ensure the successful adoption of LED technology and uncover new light applications in plant science, particularly in plant biotechnology. This study includes fluorescent light as industry standard to compare with LEDs treatments and provide insights for light source transition for soybean transformation process.

Soybean is a major agronomic crop with significant economic and food security value. The soybean genetic transformation is critical for crop improvement by genetic engineering and genome editing [5]. Various explant types have been employed in Agrobacterium-mediated transformation systems, including cotyledonary node from immature seed [6], hypocotyl from germinated seedlings [7], and half-seed from mature seed [8]. The use of half-seed explants offers significant advantages over methods involving immature seeds and seedlings, as these latter approaches require prolonged plant care and maintenance in greenhouses or growth chambers prior to the transformation process. From which half-seed explants derive, mature seeds are easy to store and avoid the need for greenhouse facilities. Additionally, the half-seed method enables rapid and direct shoot organogenesis from the meristem, bypassing the callogenesis stage. This is crucial for expediting the regeneration process of genetically modified shoots. Notably, the meristem on half-seeds is exposed to Agrobacterium during infection and co-cultivation and serves as the site for shoot induction. Co-cultivation of Agrobacterium and infected explants constitutes a crucial step in successful transformation, during which foreign DNA integrates into the plant genome [9]. In soybean transformation, the co-cultivation stage occurs under light conditions. Meristem activity intricately links to light signaling pathways involving phytohormones such as cytokinins and auxins [10] and the direct regulation of gene expression for cell proliferation [11]. Previous studies have explored the effects of light signaling during co-cultivation on transformation efficiency, focusing on light absence or presence in tobacco (Nicotiana benthamiana) [12] and tepary bean (Phaseolus acutifolius) [13]. However, the impact of light intensity during co-cultivation on transformation efficiency remains largely unexplored regardless of the plant species and the implemented light source. Moreover, a wide range of light intensities, ranging from 50 μmol∙m−2∙s−1 to 140 μmol∙m−2∙s−1, has been utilized across previous soybean transformation studies [14–16]. This fair-sized variation of light intensity could bear potential influence on inconsistent transformation efficiency across the studies. The present study initiates efforts of evaluating the effects of light intensity during the co-cultivation stage of soybean transformation.

The bar gene is a commonly used selective marker in soybean transformation, with glufosinate (an herbicide) typically applied as the selective agent [17]. The bar gene encodes a phosphinothricin acetyltransferase (PAT) [18]. PAT can detoxify phosphinothricin, commercially known as glufosinate, which inhibits glutamine synthetase [19]. However, challenges arise in this process, including chimeric plants and escaping transgenic events [20]. The hppd gene, integral to the photosynthesis pathway, holds potential as an alternative selective marker for plant transformation [21]. One of hppd genes is hppd-Pf-4Pa, derived from Pseudomonas fluorescens (ISAAA database). Transformed soybean plants containing hppd-Pf-4Pa demonstrate resistance to HPPD inhibitors (herbicides), while wild-type soybean plants exhibit "bleaching" effects (white leaves) in the presence of HPPD inhibitors [21]. Leveraging hppd-Pf-4Pa as a selective marker provides the advantage of a distinguishable phenotype during selection, dueto the contrasting color difference between plant tissues with and without the gene. Moreover, employing hppd-Pf-4Pa may mitigate the chimeric plants resulting from transformation. However, the implementation of HPPD inhibitors as selective agents in soybean transformation has yet to be fully established in the publications, regarding the applied selection pressure. This current research explores a selection protocol utilizing tembotrione, a member of the HPPD inhibitors family, as the selective agent in the Agrobacterium-mediated transformation process of soybean. Outcome of selection pressure by tembotrione can set in motion for its application in transformation of many plant species. Given the difference between the pathways of the bar gene and hppd-Pf-4Pa, investigation result indicates whether the choice of selective marker impacts potential light effects on transformation efficiency.

The objective of the present study was to determine the effects of white LEDs intensity during co-cultivation on soybean transformation using bar and hppd-Pf-4Pa as selective markers. The study hypothesized that an increase in light intensity during co-cultivation improves the efficiency of Agrobacterium-mediated transformation in soybeans, but the effects are dependent on the type of selective marker used in the shoot organogenesis phase. Furthermore, the present study confirmed the possibility of using HPPD inhibitors as selective agents in the transformation process.

Materials and methods

Explant preparation

The experiments used soybean cultivar ’Thorne’ as the plant material. The seeds were provided by the BASF Innovation Center. Half-seed preparation was done as previously reported [15]. A single layer of mature soybean seeds was placed on petri dishes and subjected to surface sterilization using chlorine gas, specifically a mixture of 100 ml NaClO and 3.5 ml HCl (12N). This process took place in a large Pyrex desiccator for 16 hours. After sterilization, the petri dishes containing the soybean seeds were uncovered in a laminar flow hood for at least 30 minutes to allow excess chlorine gas to dissipate. The sterile seeds were then rinsed with sterile distilled water and imbibed in 250 ml flasks filled with sterile distilled water in the dark at 24°C for 16 hours. The seeds were loaded up to the 100 ml scale line. The imbibed seeds were prepared as half-seeds in a laminar hood by trimming the embryonic axis of the soybean seed to approximately one-third of its length, removing the radicle and part of the hypocotyl. The seed was then split longitudinally into two halves at the hilum using a #10 blade. If any seed coat remained on the half-seed, it was removed. The plumule, which refers to the first true leaves of the soybean seed, was removed from the cotyledon to expose the shoot meristem on the half-seed.

Agrobacterium preparation, infection, and co-cultivation

Agrobacterium tumefaciens strain EHA105 carrying the plasmid (pBNCL2020) construct depicted in Fig 1 was used for HPPD inhibitor and glufosinate selection, which was provided by BASF Innovation Center (Ghent, Belgium). The A. tumefaciens was streaked on YEP media consisting of 10 g/L yeast extract, 5 g/L NaCl, 10 g/L peptone, and 15 g/L agar, with a pH of 7.0. This media was supplemented with spectinomycin (100 μg/ml) and streptomycin (100 μg/ml). After an incubation period of 48 hours at 28°C, a single colony was isolated. The isolated colony was then cultured in 3 ml of starter liquid YEP media, which contained 10 g/L yeast extract, 5 g/L NaCl, and 10 g/L peptone, with spectinomycin (100 μg/ml) and streptomycin (100 μg/ml). The starter liquid was placed on a shaker at 250 rpm and 28°C overnight. Subsequently, 100 μl of the starter media was transferred to 100 ml of liquid YEP media in a 250 ml flask, again supplemented with spectinomycin (100 μg/ml) and streptomycin (100 μg/ml). The Agrobacterium culture was then incubated on a shaker at 250 rpm and 28°C until the OD600 reading reached a range of 0.6 to 0.8. The bacterial pellet was collected by centrifugation at 4000 rpm and 20°C for 15 minutes. This pellet was then suspended in infection medium, which consisted of B5 salt, B5 vitamins, 3.9 g/L MES, 0.25 mg/L gibberellic acid (GA3), 1.67 mg/L 6-Benzylaminopurine (BAP), 30 g/L sucrose, 40 mg/L acetosyringone, with a pH of 5.4, at an OD600 range of 0.6 to 0.8.

thumbnail
Fig 1. Schematic map of T-DNA that contains hppdPf-4Pa and bar and neighboring region for Agrobacterium selection.

The T-DNA consists of border sequences (LB and RB), promoter PcsvmvXYYZ that drives hppdPf-4Pa fused with coding sequence of an optimized transit peptide derivative TPotpY-1Pf, promoter P35S3 that drives bar. The neighboring region includes an antibiotic-resistant site aadA that is driven by promoter PaadA.

https://doi.org/10.1371/journal.pone.0312129.g001

The prepared half-seeds were submerged in the infection media containing Agrobacterium for a duration of 40 minutes. After the incubation, the half-seeds were drained and transferred to the co-cultivation phase. Placed adaxial side up in petri dishes, the half-seeds were positioned on three layers of filter papers soaked with co-cultivation media. The co-cultivation media consisted of B5 salt, B5 vitamins, 3.9 g/L MES, 0.25 mg/L GA), 1.67 mg/L BAP, 30 g/L sucrose, 40 mg/L acetosyringone, 400 mg/L L-cysteine, and 154.2 mg/L dithiothreitol, with a pH of 5.4. The co-cultivation process lasted for five days under various treatments of light intensity. Each petri dish contained 20 half-seeds.

Light treatments during co-cultivation

Five light treatments were implemented during co-cultivation phase, including four light intensities of white LEDs (TS 600, 100 W, Mars Hydro, Shenzhen, Guangdong, China): 50, 100, 150, 190 μmol∙m−2∙s−1, and one light intensity of fluorescent light (T5s, 4100 Kelvin, 24W, Philips, Amsterdam, Netherlands): 100 μmol∙m−2∙s−1, which is a common fixture in tissue culture chambers. The light composition is shown in Fig 2 and Table 1, which was measured by a spectroradiometer (PS-200, Apogee Instruments, Inc. Logan, UT, USA). All co-cultivation took place in a walk-in growth chamber that had separate compartments. A light intensity map was created in each compartment, specifically at each Petri dish position targeting the desired light intensity using white LED and fluorescent fixtures. Each treatment consisted of four to five petri dishes, resulting in a total of 80 to 90 explants for each treatment. This experiment was conducted six times. The temperature on the surface of each petri dish was monitored using thermocouples (0.005-gauge, T-type, Omega Inc., Stamford, CT, USA). The temperature, CO2 concentration, and relative humidity within the growth chamber were measured and recorded using a data logger (CR1000, Campbell Scientific Inc., Logan, UT, USA). All data were collected every five seconds and recorded as averages every five minutes throughout the duration of the experiment. The environmental data is summarized in Table 2. Co-cultivation period was five days, suggested by previously published work of Agrobacterium-mediated transformation using soybean half-seeds [11, 14, 15].

thumbnail
Fig 2.

Light spectrum of white LED (A) and fluorescent (B) used in the present study.

https://doi.org/10.1371/journal.pone.0312129.g002

thumbnail
Table 1. Light spectrum composition of white LED and fluorescent.

Photon flux density of Photosynthetically Active Radiation (PAR: 400–700 nm) and Extended Photosynthetically Active Radiation (ePAR; 400–750 nm) are present in μmol∙m−2∙s−1. Light spectrum of UV (300–400 nm), blue (400–500 nm), green (500–600 nm), red (600–700 nm), and far-red (700–800 nm) are present in percentage of total photon flux (300–800 nm). R/FR is the photon flux density ratio of red to far-red light. PSS represents Phytochrome Photostationary State. The light composition of white LED and fluorescent light was measured by a spectroradiometer.

https://doi.org/10.1371/journal.pone.0312129.t001

thumbnail
Table 2. Environmental data during co-cultivation for HPPD inhibitor selection and glufosinate selection.

Values are present as mean ± standard deviation (n = 6).

https://doi.org/10.1371/journal.pone.0312129.t002

Shoot induction and elongation

After five days of co-cultivation, all half-seeds from five light treatments were moved to the shoot regeneration process, involving shoot induction and shoot elongation phases. The basic shoot induction medium (SIM) is composed of full strength of B5 salts, B5 vitamins, 0.59 g/L MES, 1.67 mg/L BAP, 30 g/L sucrose, 7 g/L agar, 100 mg/L timentin, 200 mg/L cefotaxime, 50 mg/L vancomycin, pH 5.7. For glufosinate selection, SIM included 6 mg/L of glufosinate. Tembotrione was used as the HPPD inhibitor for selection in this experiment. Various rates of tembotrione were evaluated for its “bleaching” effects on shoot regeneration of soybean (Fig 3). Tembotrione selection concentration was determined at 0.15 -μmol∙L−1 in SIM. After two weeks of incubation in SIM, soybean explants with green shoots were selected. The induced leaves of chosen soybean explants were trimmed off, and the cotyledons with remaining shoot meristem were transferred to fresh SIM for two weeks.

thumbnail
Fig 3. The “bleaching” effects of various rates of tembotrione on soybean shoot regeneration.

The shoots present in the figure were 28-day-old culture in shoot induction medium.

https://doi.org/10.1371/journal.pone.0312129.g003

After four weeks of shoot induction, the shoot clusters with green shoots were isolated and transferred to shoot elongation medium (SEM). SEM consisted of full strength of MS salts, B5 vitamins, 0.59 g/L MES, 50 mg/L L-asparagine, 100 mg/L L-pyroglutamic acid, 0.1 mg/L Indole-3-acetic acid (IAA), 0.5 mg/L GA3, 1 mg/L zeatin-R, 30 g/L sucrose, 7 g/L agar, 100 mg/L timentin, 200 mg/L cefotaxime, 50 mg/L vancomycin, pH 5.7. The chemical selections were again used at 0.15 μmol∙L−1 tembotrione and 6 mg/L glufosinate. The soybean shoots were sub-cultured every two weeks until the green shoots elongated to higher than 3 cm. The elongated shoots were harvested and transferred to rooting medium. The shoot regeneration process is shown in Fig 4 (B&C: under tembotrione selection; F&G: under glufosinate selection).

thumbnail
Fig 4. Regeneration process of transgenic soybean plant.

The top panel is HPPD inhibitor selection. The bottom panel is glufosinate selection. Soybean half-seed explants after five days of co-cultivation (A and E). Explants in shoot induction medium (B and F). Elongated soybean shoots in shoot elongation medium (C and G). Potential transgenic soybean plants under acclimation (D and H).

https://doi.org/10.1371/journal.pone.0312129.g004

Rooting and acclimation

Rooting medium contained ½ strength of MS salts, ½ B5 vitamins, 15 g/L sucrose, 7 g/L agar, pH 5.6. The cut end of the soybean shoot was dipped into 1 mg/L Indole-3-butyric acid (IBA) for one minute prior to being inserted to rooting medium. Once the roots were formed, the soybean plants were moved to the acclimation stage for further establishment.

The shoot regeneration, rooting, and acclimation process took place in a walk-in chamber, where the environmental condition was monitored and recorded by a data logger (UX100-003, Onset®, HOBO Data Logger, Bourne, MA, USA). The condition was maintained at temperature of 26 ± 0.7°C, white LED (Arize® Life, BRV full spectrum, 32W, GE Current Lighting Solutions, Greenville, SC, USA) light intensity of 100 ± 3.3 μmol∙m−2∙s−1, and photoperiod of 18 hours, relative humidity of 39 ± 6.9% for all treatments.

Transgene confirmation

The genomic DNA of the youngest mature leaf on acclimated soybean plants was extracted using adapted method from Edwards et al. 1991 [23]. Then the genomic DNA was evaluated for the transgene presence by PCR amplification of two amplicons for each selectable marker. For the amplification of hppdPf-4Pa, a pair of specific primers was designed. The forward primer “hppd-F” (GGATGGTGTATTGGGCTAACT) was designed to target the 5’ region of hppdPf-4Pa, while the reverse primer “hppd-R” (CTGGTGCTGACATAGCTTTAGA) was designed to target the 3’ region of hppdPf-4Pa. To amplify bar gene, the forward primer “bar-F” (AAGTCCAGCTGCCAGAAA) and reverse primer “bar-R” (CGAGGCGCTCGGATATG) were designed to target 5’ and 3’ region of bar, respectively. The amplified PCR product was then visualized through gel electrophoresis (2% w/v agarose) to confirm the transgene presence.

Transformation efficiency determination

Based on the PCR analysis for selective maker presence in the leaf tissue, the number of soybean plants carrying transgene was counted. Transformation efficiency (%) was calculated as Eq (1) for every repetition (co-cultivation) of each selective marker.

(1)

Statistical analysis

The present study used a completely randomized design. Each soybean half-seed was randomly assigned to a treatment. The experiment was repeated six times. Each repetition contained 70–80 half-seed explants per treatment. The transformation efficiency of HPPD inhibitor selection was analyzed by simple linear regression model across increasing light intensity during co-cultivation. The transformation efficiency of glufosinate selection was analyzed by ANOVA analysis. All the data analysis was conducted in JMP software (JMP Statistical Discovery LLC, Cary, NC, USA).

Results

HPPD inhibitor selection

The transformation was confirmed by PCR analysis. Under tembotrione selection, the transformation efficiency responded linearly to increasing light intensity of white LED during co-cultivation (Fig 5). For example, soybean half-seeds that were co-cultured at 190 μmol∙m−2∙s−1 had 2.2 times (116%) greater transformation efficiency than those co-cultured at the lowest light intensity (50 μmol∙m−2∙s−1) of white LED. The 190 μmol∙m−2∙s−1 of white LED during co-cultivation yielded the highest transformation efficiency of 5.2%. Meanwhile, different mean value of the transformation efficiency was observed (not statistically different) between white LED and fluorescent light at 100 μmol∙m−2∙s−1. The transformation efficiency was 5.4% from the co-cultivation at 100 μmol∙m−2∙s−1 of fluorescent light, which was similar to the result from the co-cultivation at 190 μmol∙m−2∙s−1 of white LED.

thumbnail
Fig 5. Transformation efficiency response to light intensity during co-cultivation under tembotrione selection.

The simple linear regression model was significant with p-value of 0.0499, y = 0.022x + 1.0. PFD: photon flux density. The circle symbols represent the values from white LED treatments. The triangle symbol represents the value from fluorescent light. Standard errors are indicated as the error bards in the figure (n = 6).

https://doi.org/10.1371/journal.pone.0312129.g005

Glufosinate selection

The transformation efficiency was determined by using Eq (1) after confirming transformation event by PCR analysis on rooted soybean plants. Under glufosinate selection, the transformation efficiency showed no significant difference when co-cultivation took place under various light intensities (Table 3). Neither did the transformation under fluorescent light outperform the white LED at 100 μmol∙m−2∙s−1 or any other intensity. The transformation efficiency varied from 2.8% to 6.9% with big variation among the treatments.

thumbnail
Table 3. Transformation efficiencies under glufosinate selection after various light intensities during co-cultivation.

Values are present as mean ± standard error (n = 6). Data was analyzed by ANOVA analysis with significant p-value equal or less than 0.05.

https://doi.org/10.1371/journal.pone.0312129.t003

Discussion

This study revealed a linear increase of transformation efficiency under HPPD inhibitor selection, but not under glufosinate selection, when increasing light intensity during co-cultivation in soybean. This outcome indicates that light intensity during co-cultivation affects transformation efficiency possibly depending on the transgene and its expression. Prior to the present study, we explored the effect of the same range of light intensities during co-cultivation on GUS transient expression percentage. Higher GUS transient expression was observed under low light intensity (50, 100 μmol∙m−2∙s−1) compared to high light intensity (150, 190 μmol∙m−2∙s−1), indicating further investigation was needed to understand transformation efficiency (Shi et al., in press). Very few studies have characterized the impact of light intensity during co-cultivation on the Agrobacterium-mediated transformation efficiency. Previous research focused on the comparison between darkness and light environments during co-cultivation [12, 13]. Both studies showed enhanced GUS transient expression under light environments in Arabidopsis thaliana and Phaseolus acutifolius [12, 13]. There are similarities in the promotion of transformation efficient by light between these two previous studies and the present study of HPPD-inhibitor selection. However, our study included a wide range of light intensities (50, 100, 150, 190 μmol∙m−2∙s−1) during co-cultivation. Transient expression only reports on the efficiency of transgene delivery into plant cells without selection pressure of integrated T-DNA fragments. In contrast, transformation efficiency is dependent of transgene integration in the plant genome and successful regeneration of resistant cells [24]. Furthermore, the present study also compared white LED and fluorescent light at the equivalent light intensities; these results provide some reference for adapting LED light sources to plant transformation protocols and potential light quality effects on transformation which is further discussed below.

The detection of an effect of light on transformation efficiency exclusively under HPPD selection may be partially attributed to the differential transient expression of each transgene during co-cultivation before the presence of selectable agents. Prior to integration into the host genomic DNA, the T-DNA needs to be imported into the plant nucleus, where the integrated transgene can be expressed. Though no clear timeline of T-DNA transport into the nucleus has been presented, a study demonstrated that GUS activity was detected after five days of co-cultivation in soybean when expressed under the control of the 35S promoter [11]. During the co-cultivation stage of Agrobacterium-mediated transformation in soybean, transgene expression is possible. Therefore, expression-associated factors may contribute to the differences in transformation efficiency observed between the two selective markers. Firstly, the use of different promoters to drive expression of two selective markers, PcsvmvXYYZ for hppdPf-4Pa and P35S3 for bar, could potentially contribute to the observed variations between them. Promoter activity can be influenced by light intensity and light quality. A previous study has shown that light intensity regulates promoter activity depending on the core promoter architecture [25]. Moreover, the sequence structure of the Pcsvmv core promoter differs from P35S [26], which could result in different levels of expression at varying light intensities. The effects of light intensity have been investigated using transient expression via agroinfiltration. GUS transient expression driven by 35S promoter showed no significant difference when leaves were placed under low and high light intensities [27–29]. This result shares similarity with the outcome of the present study under glufosinate selection, where bar (selective marker of glufosinate) was driven by P35S promoter. However, since the transformation methods and plant materials differ between the two studies, comparisons should be made with caution. Furthermore, evidence of different responses of promoters to light intensity has been observed in other plant systems. For instance, in grapevine (Vitis vinifera), the VviLAR1 promoter activity increased with rising light intensity, while the VviLAR2 promoter remained insensitive to various light intensities [30]. Additionally, light quality, such as far-red light, has demonstrated regulation on a promoter activity in photoautotrophic cyanobacteria (Chlorogloeopsis fritschii) [31]. According to those findings, it is possible that the use of two different promoters led to the different transformation efficiency in the present study.

Differences in the activity of the enzymes encoded by each transgene could also be responsible for the differences in transformation efficiencies under varying light intensities. hppdPf-4Pa encodes HPPD-4, a bacterial enzyme that alleviates the inactivation of endogenous HPPD enzymes by HPPD inhibitors in plants [32]. The HPPD protein catalyzes the formation of the precursors of α-tocopherol and plastoquinone which both mitigate adverse high light effect on plant cells. [32–34]. In addition to its role in electron transfer during photosynthesis, plastoquinone is essential for biosynthesizing carotenoid that protects plants from radical damage from high light [35]. HPPD-4, as one form of HPPD proteins, possesses the photoprotective function. Increasing light intensity could possibly upregulate the expression of hppdPf-4Pa in plant cells during co-cultivation. Under high light intensity at the end of the co-cultivation stage, increased levels of hppdPf-4Pa expression could be beneficial for shoot regeneration of transformed cells under HPPD inhibitor selection. The observed increase in transformation efficiency followed a linear regression, prompting the question of whether further increasing light intensity during co-cultivation could lead to a continued improvement of transformation efficiency under HPPD inhibitor selection. The highest light intensity used in the present study, 190 μmol∙m−2∙s−1, is higher than the reported light intensity used in previous soybean transformations [14, 15]. However, it is important to recognize that 190 μmol∙m−2∙s−1 is not the light saturation point or the excessive light level for most plant growth. High light intensity is usually investigated at levels surpassing 900 μmol∙m−2∙s−1 [36]. Consequently, further investigations into the effects of light intensity higher than 190 μmol∙m−2∙s−1 on transformation efficiency are needed. bar is associated with nitrogen metabolism in plants [19]. In contrast, the expression of bar may have little effect on dissipating energy from high light intensity and provides no advantage.

Under HPPD inhibitor selection, the transformation efficiency exhibited numerical differences (not statistically significant) between the co-cultivation under fluorescent light and white LED light at 100 μmol∙m−2∙s−1. The main distinction in the spectrum between white LED and fluorescent light used in the present study is the presence of UV light from fluorescent light (Table 1). The measurable UV spectrum (300–400 nm) consists of UV-B (280–320 nm) and UV-A (320–400 nm) both of which can influence plant cell activity [37]. The UV-A has a similar effect on plants as blue light; however, the UV-B can cause various damages to the plant cells due to its high energy and induction of Reactive Oxidative Species (ROS) accumulation [38]. HPPD-4 expressed transiently by hppdPf-4Pa in the cell might mitigate the additional energy generated by UV-B of fluorescent light. Furthermore, the potential upregulation of hppdPf-4Pa by high ROS during co-cultivation facilitate plant cells against HPPD inhibitor selection. Furthermore, the improvement observed with fluorescent light might be explained by the effect of UV light on Agrobacterium infectivity. A previous study showed that the UV light enhanced the infectivity of A. tumefaciens despite the inhibition on bacterial viability [39]. Though, the enhancement was not observed under glufosinate selection. Another possible explanation for the difference between two selective agents is that their promoter activities could be affected differently by UV light, as explained in the previous discussion. Therefore, despite the lack of statistical significance in the comparison between fluorescent light and white LED in the current study, the existing evidence justifies further investigation into the influence of spectral variations on transformation efficiency. This experiment has shed light on the influence of light intensity and spectrum on transformation efficiency, offering prospects for future optimization of transformation protocols based on environmental conditions. Nevertheless, further investigations are warranted to provide additional evidence and a deeper understanding of the observed outcomes. Specifically, exploring the effects of higher photon flux densities, UV-B light, and considering different promoter options could enhance our comprehension of the factors influencing transformation efficiency in soybean and other plant species.

Acknowledgments

The authors express their gratitude to BASF Agricultural Solutions for funding this research (grant number 4-20-B00454-3). Special thanks are extended to Dr. Alexander Galle and Dr. Jixiang Kong from BASF Agricultural Solutions for their scientific input and guidance on the potential applications of this research. The authors also wish to acknowledge Dr. Wusheng Liu and Dr. Kedong Da from NCSU for their expert advice on tissue culture and molecular biology techniques.

References

  1. 1. Nelson JA, Bugbee B. Economic Analysis of Greenhouse Lighting: Light Emitting Diodes vs. High Intensity Discharge Fixtures. PLOS ONE. 2014;9(6):e99010. pmid:24905835
  2. 2. Barceló-Muñoz A, Barceló-Muñoz M, Gago-Calderon A. Effect of LED Lighting on Physical Environment and Microenvironment on In Vitro Plant Growth and Morphogenesis: The Need to Standardize Lighting Conditions and Their Description. Plants. 2022;11(1):60. pmid:35009064
  3. 3. Yang F, Fan Y, Wu X, Cheng Y, Liu Q, Feng L, et al. Auxin-to-Gibberellin Ratio as a Signal for Light Intensity and Quality in Regulating Soybean Growth and Matter Partitioning. Frontiers in Plant Science. 2018;9. pmid:29441084
  4. 4. Feng L, Raza MA, Li Z, Chen Y, Khalid MHB, Du J, et al. The Influence of Light Intensity and Leaf Movement on Photosynthesis Characteristics and Carbon Balance of Soybean. Frontiers in Plant Science. 2019;9. pmid:30687355
  5. 5. Rahman SU, McCoy E, Raza G, Ali Z, Mansoor S, Amin I. Improvement of Soybean; A Way Forward Transition from Genetic Engineering to New Plant Breeding Technologies. Molecular Biotechnology. 2023;65(2):162–80. pmid:35119645
  6. 6. Olhoft PM, Donovan CM, Somers DA. Soybean (Glycine max) Transformation Using Mature Cotyledonary Node Explants. Humana Press. p. 385–96. pmid:16988361
  7. 7. Wang G, Xu Y. Hypocotyl-based Agrobacterium-mediated transformation of soybean (Glycine max) and application for RNA interference. Plant Cell Reports. 2008;27(7):1177–84. pmid:18347801
  8. 8. Luth D, Warnberg K, Wang K. Soybean [Glycine max (L.) Merr.]. In: Wang K, editor. Agrobacterium Protocols: Volume 1. New York, NY: Springer New York; 2015. p. 275–84.
  9. 9. Liu S-J, Wei Z-M, Huang J-Q. The effect of co-cultivation and selection parameters on Agrobacterium-mediated transformation of Chinese soybean varieties. Plant Cell Reports. 2008;27(3):489–98. pmid:18004571
  10. 10. Yoshida S, Mandel T, Kuhlemeier C. Stem cell activation by light guides plant organogenesis. Genes & Development. 2011;25(13):1439–50. pmid:21724835
  11. 11. Li S, Cong Y, Liu Y, Wang T, Shuai Q, Chen N, et al. Optimization of Agrobacterium-mediated transformation in soybean. Frontiers in plant science. 2017;8:246. pmid:28286512
  12. 12. De Clercq J, Zambre M, Van Montagu M, Dillen W, Angenon G. An optimized Agrobacterium-mediated transformation procedure for Phaseolus acutifolius A. Gray. Plant Cell Reports. 2002;21:333–40.
  13. 13. Zambre M, Terryn N, De Clercq J, De Buck S, Dillen W, Van Montagu M, et al. Light strongly promotes gene transfer from Agrobacterium tumefaciens to plant cells. Planta. 2003;216:580–6. pmid:12569399
  14. 14. Pareddy D, Chennareddy S, Anthony G, Sardesai N, Mall T, Minnicks T, et al. Improved soybean transformation for efficient and high throughput transgenic production. Transgenic Research. 2020;29(3):267–81. pmid:32303980
  15. 15. Paz MM, Martinez JC, Kalvig AB, Fonger TM, Wang K. Improved cotyledonary node method using an alternative explant derived from mature seed for efficient Agrobacterium-mediated soybean transformation. Plant Cell Rep. 2006;25(3):206–13. Epub 20051025. pmid:16249869.
  16. 16. Hada A, Krishnan V, Mohamed Jaabir MS, Kumari A, Jolly M, Praveen S, et al. Improved Agrobacterium tumefaciens-mediated transformation of soybean [Glycine max (L.) Merr.] following optimization of culture conditions and mechanical techniques. In Vitro Cellular & Developmental Biology—Plant. 2018;54(6):672–88.
  17. 17. Zhang Z, Xing A, Staswick P, Clemente TE. The use of glufosinate as a selective agent in Agrobacterium-mediated transformation of soybean. Plant Cell, Tissue and Organ Culture. 1999;56:37–46.
  18. 18. De Block M, Botterman J, Vandewiele M, Dockx J, Thoen C, Gosselé V, et al. Engineering herbicide resistance in plants by expression of a detoxifying enzyme. The EMBO Journal. 1987;6(9):2513–8. pmid:16453789
  19. 19. Christ B, Hochstrasser R, Guyer L, Francisco R, Aubry S, Hörtensteiner S, et al. Non-specific activities of the major herbicide-resistance gene BAR. Nat Plants. 2017;3(12):937–45. Epub 20171127. pmid:29180815; PubMed Central PMCID: PMC6342461.
  20. 20. Kiran KS, Pooja B-M, Thorpe TA. Genetic Transformation Technology: Status and Problems. In Vitro Cellular & Developmental Biology Plant. 2005;41(2):102–12.
  21. 21. Siehl DL, Tao Y, Albert H, Dong Y, Heckert M, Madrigal A, et al. Broad 4-hydroxyphenylpyruvate dioxygenase inhibitor herbicide tolerance in soybean with an optimized enzyme and expression cassette. Plant Physiol. 2014;166(3):1162–76. Epub 20140905. pmid:25192697; PubMed Central PMCID: PMC4226376.
  22. 22. Sager J C., Smith W O., Edwards J L., Cyr K L. Photosynthetic Efficiency and Phytochrome Photoequilibria Determination Using Spectral Data. Transactions of the ASAE. 1988;31(6):1882–9. https://doi.org/10.13031/2013.30952.
  23. 23. Edwards K, Johnstone C, Thompson C. A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Res. 1991;19(6):1349. pmid:2030957; PubMed Central PMCID: PMC333874.
  24. 24. Negrutiu I, Dewulf J, Pietrzak M, Botterman J, Rietveld E, Wurzer-Figurelli EM, et al. Hybrid genes in the analysis of transformation conditions: II. Transient expression vs stable transformation—analysis of parameters influencing gene expression levels and transformation efficiency. Physiologia Plantarum. 1990;79(1):197–205. https://doi.org/10.1111/j.1399-3054.1990.tb05887.x.
  25. 25. Srivastava R, Rai KM, Srivastava M, Kumar V, Pandey B, Singh SP, et al. Distinct Role of Core Promoter Architecture in Regulation of Light-Mediated Responses in Plant Genes. Molecular Plant. 2014;7(4):626–41. pmid:24177688
  26. 26. Oyelakin OO, Opabode JT, Raji AA, Ingelbrecht IL. A Cassava vein mosaic virus promoter cassette induces high and stable gene expression in clonally propagated transgenic cassava (Manihot esculenta Crantz). South African Journal of Botany. 2015;97:184–90. https://doi.org/10.1016/j.sajb.2014.11.011.
  27. 27. Patil BL, Fauquet CM. Light intensity and temperature affect systemic spread of silencing signal in transient agroinfiltration studies. Molecular Plant Pathology. 2015;16(5):484–94. pmid:25220764
  28. 28. Matsuda R, TAHARA A, MATOBA N, FUJIWARA K. Virus vector-mediated rapid protein production in Nicotiana benthamiana: effects of temperature and photosynthetic photon flux density on hemagglutinin accumulation. Environmental Control in Biology. 2012;50(4):375–81.
  29. 29. Ruiz MT, Voinnet O, Baulcombe DC. Initiation and Maintenance of Virus-Induced Gene Silencing. The Plant Cell. 1998;10(6):937–46. pmid:9634582
  30. 30. Cheng J, Yu K, Zhang M, Shi Y, Duan C, Wang J. The Effect of Light Intensity on the Expression of Leucoanthocyanidin Reductase in Grapevine Calluses and Analysis of Its Promoter Activity. Genes (Basel). 2020;11(10). Epub 20200930. pmid:33007888; PubMed Central PMCID: PMC7600843.
  31. 31. Liu T-S, Wu K-F, Jiang H-W, Chen K-W, Nien T-S, Bryant DA, et al. Identification of a Far-Red Light-Inducible Promoter that Exhibits Light Intensity Dependency and Reversibility in a Cyanobacterium. ACS Synthetic Biology. 2023;12(4):1320–30. pmid:36995145
  32. 32. Organisms EPanel oGM, Naegeli H, Bresson JL, Dalmay T, Dewhurst IC, Epstein MM, et al. Assessment of genetically modified soybean GMB151 for food and feed uses, under Regulation (EC) No 1829/2003 (application EFSA-GMO-NL-2018-153). EFSA Journal. 2021;19(4):e06424. pmid:33897857
  33. 33. Maeda H, DellaPenna D. Tocopherol functions in photosynthetic organisms. Current Opinion in Plant Biology. 2007;10(3):260–5. pmid:17434792
  34. 34. Xu K, Racine F, He Z, Juneau P. Impacts of hydroxyphenylpyruvate dioxygenase (HPPD) inhibitor (mesotrione) on photosynthetic processes in Chlamydomonas reinhardtii. Environmental Pollution. 2019;244:295–303. pmid:30343230
  35. 35. Ruiz-Sola M, Rodríguez-Concepción M. Carotenoid biosynthesis in Arabidopsis: a colorful pathway. Arabidopsis Book. 2012;10:e0158. Epub 20120119. pmid:22582030; PubMed Central PMCID: PMC3350171.
  36. 36. Poorter H, Niinemets Ü, Ntagkas N, Siebenkäs A, Mäenpää M, Matsubara S, et al. A meta-analysis of plant responses to light intensity for 70 traits ranging from molecules to whole plant performance. New Phytologist. 2019;223(3):1073–105. pmid:30802971
  37. 37. Vanhaelewyn L, Van Der Straeten D, De Coninck B, Vandenbussche F. Ultraviolet Radiation From a Plant Perspective: The Plant-Microorganism Context. Frontiers in Plant Science. 2020;11. pmid:33384704
  38. 38. Escobar-Bravo R, Klinkhamer PGL, Leiss KA. Interactive Effects of UV-B Light with Abiotic Factors on Plant Growth and Chemistry, and Their Consequences for Defense against Arthropod Herbivores. Frontiers in Plant Science. 2017;8. pmid:28303147
  39. 39. Heberlein GT, Lippincott JA. Photoreversible Ultraviolet Enhancement of Infectivity in Agrobacterium tumefaciens. Journal of Bacteriology. 1965;89(6):1511–4. pmid:14291589