Figures
Abstract
Background
Postoperative nausea and vomiting are common complications after surgery, and female patients are more likely to experience these adverse events. The goal of this study was to explore the relationship between the CHRM3 rs2165870 polymorphism and postoperative vomiting incidence in female patients who underwent laparoscopic surgery.
Methods
Two hundred female patients who underwent elective laparoscopic surgery with subsequent patient-controlled intravenous analgesia using dexmedetomidine and sufentanil were prospectively enrolled. The CHRM3 rs2165870 and KCNB2 rs349358 polymorphisms were genotyped using MassARRAY SNP typing technology. Demographic data and preoperative laboratory results of all patients were recorded. Postoperative analgesia-related information, incidence of postoperative nausea and vomiting, and other adverse events were followed up and recorded for analysis.
Results
No significant differences were observed in any of the demographic characteristics of these patients among the different genotype carriers (P>0.05). The percentages of patients with each genotype of CHRM3 were 67% (GG), 28.5% (GA) and 4.5% (AA). We found that the AA or A allele of the CHRM3 rs2165870 polymorphism elevated the risk of postoperative vomiting (AA versus GG; OR, 6.94; 95% CI, 1.49–32.46; P = 0.014; A versus G; OR, 2.52; 95% CI, 1.22–5.19; P = 0.012). The percentages of patients with each genotype of KCNB2 were 84.5% (TT), 15.5% (CT) and 0% (CC). There were no significant differences in the postoperative nausea or vomiting rate across the KCNB2 rs349358 polymorphisms (P>0.05).
Citation: Cai M, Gan L, Li J, Lei X, Yu J (2024) CHRM3 (rs2165870) gene polymorphism is related to postoperative vomiting in female patients undergoing laparoscopic surgery. Prospective observational study. PLoS ONE 19(8): e0309136. https://doi.org/10.1371/journal.pone.0309136
Editor: Guilherme Antonio Moreira de Barros, Sao Paulo State University (UNESP), Botucatu Medical School, BRAZIL
Received: March 26, 2024; Accepted: August 2, 2024; Published: August 20, 2024
Copyright: © 2024 Cai et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the manuscript and its Supporting Information files.
Funding: This study was supported by Natural Science Foundation of Chongqing of China (No. cstc2021jcyj-msxmX0763) and National Key Clinical Speciality Construction Project (Obstetrics and Gynecology).
Competing interests: The authors have declared that no competing interests exist.
Introduction
Postoperative nausea and vomiting (PONV) are the most common side effects experienced after anesthesia and are also the most common complaints of surgical patients; the overall incidence of PONV is as high as 30% in the surgical population [1, 2]. Recognizing the importance of preventing and treating PONV early is essential to avoid complications after surgery and enhance patient satisfaction. Several risk factors have been identified for the occurrence of PONV, including female sex, a history of PONV/motion sickness, nonsmoking status and the use of postoperative opioids [3, 4]. In recent years, the relationship between gene polymorphisms and the occurrence of PONV has attracted increased attention. A genome-wide association study (GWAS) revealed a significant association between a single nucleotide polymorphism (SNP; rs2165870) located upstream of the promoter region of the M3 muscarinic acetylcholine receptor (CHRM3) and PONV [5, 6]. Additionally, an intergenic variant, KCNB2 rs349358, has also been implicated [5, 7]. The CHRM3 rs2165870 polymorphism has been found to be associated with the efficacy of ondansetron in preventing PONV in the Chinese Han population [8]. A meta-analysis also indicated that CHRM3 rs2165870 and the KCNB2 rs349358 SNP appear to have significant impacts on the incidence of PONV, particularly in Caucasians [9].
Opioids are widely utilized as the primary choice for postoperative pain management [10]. In the case of female patients undergoing laparoscopy, the administration of opioids for postoperative analgesia, along with the influence of sex itself, may undeniably contribute to an increased risk of PONV. However, it remains unclear whether a correlation exists between the CHRM3 rs2165870 and KCNB2 rs349358 polymorphisms and the occurrence of PONV in female patients undergoing laparoscopic gynecological surgery and receiving sufentanil for postoperative pain relief. Thus, the aim of this study was to assess the impact of the CHRM3 rs2165870 and KCNB2 rs349358 polymorphisms on the occurrence of PONV among female patients who had undergone elective laparoscopic surgery and received patient-controlled intravenous analgesia.
Materials and methods
This study was a prospective observation between gene polymorphisms and the occurrence of PONV among female patients. This investigation was approved by the Research Ethics Committee of the Chongqing Health Center for Women and Children (approval number: 2022–006) and was conducted in accordance with the Declaration of Helsinki. The study was registered with the Chinese Clinical Trial Registry (ChiCTR) (www.chictr.org) under registration ID ChiCTR2200062425. Written informed consent was obtained from all participants.
Participants
The recruitment criteria included female patients aged 18 to 60 years, classified as ASA I–III, and scheduled for gynecological laparoscopic surgery under general anesthesia with the need for postoperative patient-controlled intravenous analgesia (PCIA). Furthermore, the patients were required to possess normal communication skills and the ability to appropriately use a postoperative PCIA pump. Patients with mental illness, cognitive impairments, known allergies to analgesic and sedative medications, chronic pain requiring long-term use of analgesic and sedative medications, symptoms of peripheral neuropathy, or abnormal liver and kidney function were excluded. The sample size was estimated using G Power 3.1.9.2 software. A total of 238 female patients who underwent gynecological laparoscopic surgery between August 10 2022 and December 30 2022 were enrolled in this study.
Anesthesia and postoperative analgesia protocol
All patients underwent a standardized protocol of general intravenous anesthesia with tracheal intubation which was initiated using a controlled infusion of remifentanil (target plasma concentration of 5 ng/ml), propofol (target plasma concentration of 3.5 μg/ml), a single intravenous injection of sufentanil (0.25 μg/kg) and rocuronium (0.6 mg/kg). Anesthesia was continuously maintained using propofol and remifentanil in TCI mode, with additional doses of rocuronium administered as needed.
For PCIA, a combination of dexmedetomidine (100 μg), sufentanil (75 μg), dexamethasone (10 mg), and normal saline was used in a total volume of 100 ml. The analgesic pump used was the PCA-100C type, a disposable adjustable infusion pump manufactured by Zhejiang Chen He Medical Equipment Co., Ltd., China. The infusion was administered continuously at a rate of 2 ml/h, with a lockout time of 15 minutes. Patients were advised to self-administer a dose of 0.5 ml by pressing the control button.
DNA extraction and genotyping
Whole venous blood samples (2 ml) were collected from each participant and stored in an EDTA anticoagulant tube. The blood was gradually cooled and then stored in a freezer at -80°C. All the extracted DNA was confirmed to meet the required criteria with a standardized DNA extraction process. MassARRAY SNP typing technology was used for SNP determination. The primer sequences used for rs2165870 were as follows: 2nd PCR reverse primer sequence 5’->3’, ACGTTGGATGAGTAGTTCTCAACAGTAGGC; 1st PCR forward primer sequence 5’->3’, ACGTTGGATGGGAATAACAAAGCCTGGATG; and UEP_SEQ single-base extension primer sequence, AGTAGGCTTAAAATATTCAGTATA. The sequences of the primers used for rs349358 were as follows: 2nd PCR reverse primer sequence 5’->3’, ACGTTGGATGTAAGCACTTTATCCATGCCC; 1st PCR forward primer sequence 5’->3’, ACGTTGGATGGGCACATTACACATGTGTATG; and UEP_SEQ single-base extension primer sequence, AAAACACCACCTCAAAC. After sampling, the SpectraCHIP chip was analyzed using a MALDI-TOF mass spectrometer, and the detection results were obtained using TYPER 4.0 software to obtain the raw data and genotype maps. The 384-well SpectroCHIP® bioarray chip, MassARRAY nanoinspector point prototype and MassARRAY Analyzer 4.0 mass spectrometer were obtained from Agena Bioscience, Inc.
Observation indicators
Demographics and preoperative laboratory examinations of all participants were recorded. The incidences of postoperative nausea and vomiting, as well as other adverse events (hypotension, respiratory depression, bradycardia, dizziness, drowsiness, urinary retention and chills), were followed up and recorded by an anesthesiologist for analysis. Postoperative analgesic-related information, including the number of self-controlled compressions performed with the analgesic pump within the first 24 hours postoperatively, the time when the analgesics in the pump were completely depleted, the dosage of the postoperative 24-hour analgesic solution, the longest continuous sleep time on the night of the operation, the time to first mobilization out of bed and the time to first flatus after the operation, the duration of urinary catheterization and the number of postoperative hospitalization days, were also recorded.
Definition of adverse events
Hypotension was defined as a systolic blood pressure less than 90 mmHg; respiratory depression was defined as SpO2 <90% under inhalation of air; bradycardia was defined as a heart rate of <50 beats/minute; nausea was defined as discomfort in the upper abdomen and a feeling of urgency to vomit; vomiting was defined as the phenomenon of ejecting the contents of the stomach to pass through the esophagus and mouth due to the strong contraction of the stomach; and urinary retention was defined as the inability to discharge urine when the bladder was filled with urine, resulting in unbearable bloating and pain. Dizziness, drowsiness and chills were recorded based on the patient’s subjective statement.
Sample size calculation
Based on data from the literature [11, 12], the baseline incidence rate of PONV after such surgeries is estimated to be 30–50%. Based on the mutation proportion of CHRM3 [11], it is expected that the proportions of the GG, GA, and AA genotypes are 45%, 45%, and 10%, respectively. G Power 3.1.9.2 software was used to determine the sample size before this study under the following conditions: α = 0.05, β = 0.2, power value = 0.8, and estimated odds ratio (OR) = 2.79. The total sample size required was 167.
Statistical methods
All the statistical analyses were performed with SPSS 21.0 (SPSS, Inc., Chicago, USA). Hardy‒Weinberg equilibrium among groups was assessed using the χ2 test. One-way ANOVA for homogeneous variances was applied for comparison of measurement data between groups, and Brown-Forsythe ANOVA was used for heterogeneous variances. The chi-square test and Fisher’s exact test were used to determine differences in the incidence of postoperative adverse reactions. A nonparametric test (Kruskal‒Wallis rank test) was used for normally distributed data. The crude odds ratios (ORs) and 95% confidence intervals (CIs) were evaluated via logistic regression analysis. A P value < 0.05 was considered to indicate statistical significance.
Results
Study population
Two hundred and thirty-eight female patients were enrolled in the study, and two hundred patients were ultimately analyzed (Fig 1). No significant differences were observed in any of the demographic data and preoperative laboratory examination results of these patients among the different genotype carriers (P>0.05) (Tables 1 and 2). The percentages of patients with each genotype of CHRM3 were 67% (GG), 28.5% (GA), and 4.5% (AA). The distribution of the three genotypes conformed to Hardy‒Weinberg equilibrium after the performance of a chi-square test (χ2 = 0.401, P value = 0.818>0.05). The percentages of patients with each genotype of KCNB2 were 84.5% (TT), 15.5% (CT), and 0% (CC) (Fig 2).
The inner circle represents CHRM3 rs2165870, and the outer circle represents KCNB2 rs349358.
Postoperative analgesia-related information
There were no significant differences in postoperative analgesia-related indicators across the three SNP loci of the CHRM3 (P>0.05), including the number of self-controlled compressions with the analgesic pump within the first 24 hours postoperatively, the time when the analgesics in the pump were completely depleted, the dosage of the postoperative 24-hour analgesic solution, the longest continuous sleep time on the night of the operation, the time to start mobilizing out of bed and the time to first flatus after the operation, the duration of urinary catheterization, or the postoperative hospitalization days (Table 3).
Association of the CHRM3 rs2165870 polymorphism with postoperative adverse reactions
The incidences of nausea during postoperative analgesia were 12.7% with GG, 17.5% with GA and 33.3% with AA, and the incidences of vomiting during postoperative analgesia were 6.7% with GG, 12.3% with GA and 33.3% with AA. The incidence of vomiting during postoperative analgesia in patients with homozygous AA mutations was greater than that in patients with GG mutations (P<0.05). There were no significant differences in the incidence of other adverse events across the three genotypes of the CHRM3 SNP (P>0.05) (Table 4).
The AA genotype was related to an elevated risk of postoperative vomiting (AA versus GG; OR, 6.94; 95% CI, 1.49–32.46; P = 0.014). In addition, the A allele of the CHRM3 rs2165870 polymorphism increased the risk of postoperative vomiting according to the allelic model (A versus G; OR, 2.52; 95% CI, 1.22–5.19; P = 0.012) (Table 5).
Association of the KCNB2 rs349358 polymorphism with postoperative analgesia-related information and adverse reactions
There were no significant differences observed in postoperative analgesia-related indicators mentioned above or adverse reaction rates across the KCNB2 rs349358 polymorphism (P>0.05). The incidence of nausea during postoperative analgesia was 19.35% with CT and 14.20% with TT, and the incidence of vomiting was 9.68% with CT and 9.47% with TT (P>0.05) (Tables 6 and 7).
Discussion
PONV is a common complication following surgical procedures that can significantly impact patient outcomes and satisfaction [1, 2]. Genetic variations such as CHRM3 rs2165870 have been suggested to play a role in the pathogenesis of PONV [8]. This study confirmed that the CHRM3 rs2165870 polymorphism is related to the incidence of postoperative vomiting in female patients undergoing laparoscopic surgery. The AA genotype or A allele of the CHRM3 rs2165870 polymorphism was found to elevate the risk of postoperative vomiting.
The CHRM3 gene encodes the muscarinic acetylcholine receptor subtype 3 (M3 receptor), which is primarily expressed in the central nervous system and peripheral tissues, including the gastrointestinal tract [13]. The M3 receptor is a G protein-coupled receptor involved in the transmission of cholinergic signals and plays a crucial role in regulating smooth muscle contraction, salivation, and gastric acid secretion. The rs2165870 SNP involves the substitution of adenine (A) for guanine (G) at position 1358 of the CHRM3 gene. The different genotypes associated with this polymorphism are GG, AG, and AA, representing the homozygous wild-type, heterozygous and homozygous variant genotypes, respectively [13]. Previous studies demonstrated that sequence variations in the promoter region of the CHRM3 gene may be associated with asthma, atopy and early-onset type 2 diabetes [14, 15].
A GWAS of 122 surgery patients with severe PONV and 129 matched controls revealed that the GG+AA genotype of the CHRM3 rs2165870 polymorphism was the only risk factor related to PONV. Moreover, the A allele of the CHRM3 rs2165870 polymorphism elevated the risk of PONV (OR = 2.3, 95% CI = 1.36–4) [5]. Another prospective, controlled study with 454 individuals undergoing elective surgery reported that the CHRM3 rs2165870 polymorphism could predict PONV susceptibility and that AA or GA genotype carriers had a higher risk for PONV than GG genotype carriers [6]. A retrospective study involving 472 patients who underwent elective surgery also revealed that the CHRM3 rs2165870 and KCNB2 rs349358 polymorphisms increased the risk of PONV [7]. In this study, we observed that the AA or A allele of the CHRM3 rs2165870 polymorphism increased the risk of postoperative vomiting in female patients who underwent laparoscopic surgery with PCIA, which is consistent with the findings of the above mentioned studies. However, in this study, there was no significant difference in the risk of postoperative nausea, although it differed during postoperative analgesia. The possible reason may be the clinical heterogeneity of these disorders, the different sample sizes or the differences in the inclusion criteria of patients. Notably, no association between KCNB2 rs349358 and PONV was found in this study.
The variant A allele of the CHRM3 polymorphism may confer increased susceptibility to PONV, possibly through dysregulated cholinergic signaling in the central and peripheral nervous systems. Cholinergic signaling plays a crucial role in the regulation of nausea and vomiting pathways. Stimulation of M3 receptors in the postrema area, which is a key emetic center in the brain, may trigger the emetic reflex. Altered M3 receptor function due to the variant A allele may disrupt the normal balance of cholinergic signaling, resulting in increased susceptibility to PONV. Furthermore, the M3 receptor is also present in the gastrointestinal tract, where it regulates smooth muscle contraction and gut motility. Dysfunctional M3 receptors due to the variant A allele may impair gastric emptying and intestinal transit [16, 17], contributing to the development of PONV.
Patients with the AA genotype or who were A allele carriers had a high incidence of PONV after elective surgery, which encouraged clinicians to use medications for these patients to prevent the occurrence of PONV. Thus, genetic analysis of surgical patients before anesthesia may be necessary in the future.
This study has several limitations. Despite the promising findings regarding the association between the CHRM3 rs2165870 genotype and postoperative vomiting in female patients undergoing laparoscopic surgery, it is important to note that the sample size in our study was relatively small, especially because the AA genotype had fewer mutations than estimated. Therefore, well-designed studies to confirm these associations are needed. Additionally, the genetic basis of PONV is likely multifactorial and involves the interplay of multiple genes and environmental factors. It is thus necessary to conduct research with larger sample sizes and explore the feasibility of providing individual preventive treatment for patients with the A allele to provide a more comprehensive understanding of this phenomenon.
Conclusions
This study revealed that the CHRM3 rs2165870 polymorphism, rather than KCNB2, is related to postoperative vomiting in female patients undergoing laparoscopic surgery. The AA genotype or A allele of the CHRM3 rs2165870 polymorphism elevates the risk of postoperative vomiting.
Supporting information
S1 Checklist. STROBE statement—Checklist of items that should be included in reports of cohort studies.
https://doi.org/10.1371/journal.pone.0309136.s001
(DOCX)
Acknowledgments
We are grateful to Prof. Yongchun Su at Chongqing Youyoubaobei Women and Children’s Hospital for his manuscript preparation assistance.
References
- 1. Cohen M.M., Duncan P.G., DeBoer D.P., Tweed W.A., "The postoperative interview: assessing risk factors for nausea and vomiting." Anesthesia and analgesia, vol. 78, pp. 7–16, 1994. pmid:8267183
- 2. Gan T.J., "Postoperative nausea and vomiting—can it be eliminated?." JAMA, vol. 287, pp. 1233–1236, 2002. pmid:11886298
- 3. Apfel C.C., Kranke P., Eberhart L.H., Roos A., Roewer N., "Comparison of predictive models for postoperative nausea and vomiting." British journal of anaesthesia, vol. 88, pp. 234–240, 2002. pmid:11883387
- 4. Massoth C., Schwellenbach J., Saadat-Gilani K., Weiss R., Popping D., Kullmar M., et al., "Impact of opioid-free anaesthesia on postoperative nausea, vomiting and pain after gynaecological laparoscopy—A randomised controlled trial." J Clin Anesth, vol. 75, pp. 110437, 2021. pmid:34229292
- 5. Janicki P.K., Vealey R., Liu J., Escajeda J., Postula M., Welker K., "Genome-wide Association study using pooled DNA to identify candidate markers mediating susceptibility to postoperative nausea and vomiting." Anesthesiology, vol. 115, pp. 54–64, 2011. pmid:21694509
- 6. Klenke S., de Vries G.J., Schiefer L., Seyffert N., Bachmann H.S., Peters J., et al., "CHRM3 rs2165870 polymorphism is independently associated with postoperative nausea and vomiting, but combined prophylaxis is effective." British journal of anaesthesia, vol. 121, pp. 58–65, 2018. pmid:29935595
- 7. Klenke S., de Vries G.J., Schiefer L., Seyffert N., Bachmann H.S., Peters J., et al., "Genetic contribution to PONV risk." Anaesth Crit Care Pain Med, vol. 39, pp. 45–51, 2020. pmid:31077873
- 8. Wang J., Li Y., Zheng C., Sun Y., Yang J., "CHRM3 rs2165870 Polymorphism Correlates with Postoperative Nausea and Vomiting Incidence and the Efficacy of Ondansetron in a Chinese Han Population." Pharmgenomics Pers Med, vol. 13, pp. 319–326, 2020. pmid:32884327
- 9. Klenke S., Frey U.H., "Genetic variability in postoperative nausea and vomiting: A systematic review." European journal of anaesthesiology, vol. 37, pp. 959–968, 2020. pmid:32371828
- 10. Sebastian M.P., Shanmuganathan S., "Opioids in the postoperative period: a call for consensus." British journal of anaesthesia, vol. 122, pp. e210–e211, 2019. pmid:30915990
- 11. Candiotti K.A., Kovac A.L., Melson T.I., Clerici G., Joo Gan T., Palonosetron G. 04–06 Study, "A randomized, double-blind study to evaluate the efficacy and safety of three different doses of palonosetron versus placebo for preventing postoperative nausea and vomiting." Anesthesia and analgesia, vol. 107, pp. 445–451, 2008.
- 12. Yoo J.H., Kim S.I., Chung J.W., Jun M.R., Han Y.M., Kim Y.J., "Aprepitant in combination with palonosetron for the prevention of postoperative nausea and vomiting in female patients using intravenous patient-controlled analgesia." Korean J Anesthesiol, vol. 71, pp. 440–446, 2018. pmid:29843509
- 13. Tolaymat M., Sundel M.H., Alizadeh M., Xie G., Raufman J.P., "Potential Role for Combined Subtype-Selective Targeting of M(1) and M(3) Muscarinic Receptors in Gastrointestinal and Liver Diseases." Front Pharmacol, vol. 12, pp. 786105, 2021. pmid:34803723
- 14. Donfack J., Kogut P., Forsythe S., Solway J., Ober C., "Sequence variation in the promoter region of the cholinergic receptor muscarinic 3 gene and asthma and atopy." J Allergy Clin Immunol, vol. 111, pp. 527–532, 2003. pmid:12642833
- 15. Guo Y., Traurig M., Ma L., Kobes S., Harper I., Infante A.M., et al., "CHRM3 gene variation is associated with decreased acute insulin secretion and increased risk for early-onset type 2 diabetes in Pima Indians." Diabetes, vol. 55, pp. 3625–3629, 2006. pmid:17130513
- 16. Abrams P., Andersson K.E., Buccafusco J.J., Chapple C., de Groat W.C., Fryer A.D., et al., "Muscarinic receptors: their distribution and function in body systems, and the implications for treating overactive bladder." British journal of pharmacology, vol. 148, pp. 565–578, 2006. pmid:16751797
- 17. Bharucha A.E., Seide B., Guan Z., Andrews C.N., Zinsmeister A.R., "Effect of tolterodine on gastrointestinal transit and bowel habits in healthy subjects." Neurogastroenterol Motil, vol. 20, pp. 643–648, 2008. pmid:18312543