Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Effects of two types of Coccomyxa sp. KJ on in vitro ruminal fermentation, methane production, and the rumen microbiota

  • Yoshiaki Sato ,

    Roles Conceptualization, Formal analysis, Funding acquisition, Investigation, Supervision, Visualization, Writing – original draft

    yoshis@cc.utsunomiya-u.ac.jp

    Affiliation Department of Agrobiology and Bioresources, School of Agriculture, Utsunomiya University, Tochigi, Japan

  • Honoka Shioya,

    Roles Formal analysis, Investigation, Writing – review & editing

    Affiliation Department of Agrobiology and Bioresources, School of Agriculture, Utsunomiya University, Tochigi, Japan

  • Yuma Uda,

    Roles Investigation, Writing – review & editing

    Affiliation University Farm, School of Agriculture, Utsunomiya University, Tochigi, Japan

  • Hiroshi Asano,

    Roles Investigation, Writing – review & editing

    Affiliation University Farm, School of Agriculture, Utsunomiya University, Tochigi, Japan

  • Yoshikazu Nagao,

    Roles Resources, Writing – review & editing

    Affiliation University Farm, School of Agriculture, Utsunomiya University, Tochigi, Japan

  • Hitoshi Kuno,

    Roles Conceptualization, Resources, Writing – review & editing

    Affiliation KJ Bio Co., Ltd., Kumamoto, Japan

  • Fumiaki Yoshizawa

    Roles Resources, Writing – review & editing

    Affiliation Department of Agrobiology and Bioresources, School of Agriculture, Utsunomiya University, Tochigi, Japan

Abstract

Coccomyxa sp. KJ is a unicellular green microalga that accumulates abundant lipids when cultured under nitrogen-deficient conditions (KJ1) and high nitrogen levels when cultured under nitrogen-sufficient conditions (KJ2). Considering the different characteristics between KJ1 and KJ2, they are expected to have different effects on rumen fermentation. This study aimed to determine the effects of KJ1 and KJ2 on in vitro ruminal fermentation, digestibility, CH4 production, and the ruminal microbiome as corn silage substrate condition. Five treatments were evaluated: substrate only (CON) and CON + 0.5% dry matter (DM) KJ1 (KJ1_L), 1.0% DM KJ1 (KJ1_H), 0.5% DM KJ2 (KJ2_L), and 1.0% DM KJ2 (KJ2_H). DM degradability-adjusted CH4 production was inhibited by 48.4 and 40.8% in KJ2_L and KJ2_H, respectively, compared with CON. The proportion of propionate was higher in the KJ1 treatments than the CON treatment and showed further increases in the KJ2 treatments. The abundances of Megasphaera, Succiniclasticum, Selenomonas, and Ruminobacter, which are related to propionate production, were higher in KJ2_H than in CON. The results suggested that the rumen microbiome was modified by the addition of 0.5–1.0% DM KJ1 and KJ2, resulting in increased propionate and reduced CH4 production. In particular, the KJ2 treatments inhibited ruminal CH4 production more than the KJ1 treatments. These findings provide important information for inhibiting ruminal CH4 emissions, which is essential for increasing animal productivity and sustaining livestock production under future population growth.

Introduction

The sustainability of livestock production is crucial because the demand for animal protein products, such as meat and milk, is increasing with global population growth. Ruminants play a pivotal role in supplying food to humans; however, they are also the primary emitters of methane (CH4), a greenhouse gas (GHG). CH4 emitted during ruminal fermentation accounts for 39% of the GHG emissions in the agricultural sector [1]. Additionally, CH4 emissions result in dietary energy losses ranging from 2 to 12% in ruminants [2]. Thus, inhibiting ruminal CH4 emissions is essential for increasing animal productivity and sustaining livestock production. Consequently, dietary strategies for mitigating ruminal CH4 using feed additives, such as synthetic compounds [3, 4], cashew byproducts [5], fats and fatty acids [69], and organic acids [1012], have attracted substantial attention.

Microalgae are microscopic unicellular organisms that efficiently convert solar energy into valuable bioactive compounds, such as proteins, lipids, and carbohydrates, thus indicating their commercial potential to enhance the nutritional value of animal feed supplements [13]. For example, dietary Spirulina platensis increases the average daily gain in lambs [14] and milk yield in cows [15]. Microalgae have also attracted attention as feed additives to inhibit CH4 production in ruminants. Some microalgae are rich in n–3 polyunsaturated fatty acids (PUFA) and can inhibit methanogenesis in the rumen, thereby shifting volatile fatty acid (VFA) production from acetate to propionate [16]. In fact, several microalgae, such as Euglena gracilis [17] and Chlorella vulgaris [18], inhibit CH4 production during ruminal fermentation. However, microalgae can also cause adverse effects in ruminants. For example, dietary Schizochytrium sp. decreases milk yield in dairy cows [19], while Nannochloropsis gaditana, Phaeodactylum tricornutum, and Schizochytrium sp. do not have anti-methanogenic effects in vitro [20]. Thus, although microalgae can be used as feed additives for ruminants, the effects of microalgal supplementation are debatable and different types of microalgae have different effects on rumen fermentation, CH4 production, and animal productivity.

Coccomyxa sp. KJ (IPOD FERM BP-22254) is a unicellular green microalga isolated from hot springs in Japan and belongs to the class Trebouxiophyceae. Coccomyxa sp. KJ can grow under low-pH conditions (pH 3.0–4.0) [21]. Owing to these characteristics, Coccomyxa sp. KJ can be cultivated in an open pond without contamination by other microorganisms and can be easily produced on an industrial scale. The KJ strain exhibits different characteristics when cultured under different conditions. For example, it accumulates lipids at > 30% of the dry cell weight when cultured under nitrogen-deficient conditions (KJ1) [21]. In contrast, the KJ strain contains high amounts of nitrogen when cultured under nitrogen-sufficient conditions (KJ2). KJ1 can be used in biofuel production [22], whereas KJ2 and its components can be used as immune-promoting supplements [23] and antiviral agents [2427]. In ruminant feeds, KJ1 and KJ2 represent promising supplements as fat and nitrogen sources. In particular, because KJ2 contains a high amount of linolenic acid [23], using it as a feed additive for ruminants could change the fatty acid composition of milk and meat, thereby improving the product quality. In addition, supplementation with Coccomyxa sp. KJ is expected to change the rumen microbiome, resulting in the inhibition of CH4 production by the high amount of long-chain PUFAs [23], thus, this microalga has promising potential as a CH4 inhibitor [79].

Considering the differences in the characteristics between KJ1 and KJ2, the effects of these two types of Coccomyxa sp. KJ on rumen fermentation are expected to differ. However, previous studies have not investigated these differences. Furthermore, previous studies have not reported on the use of Coccomyxa sp. KJ as a feed additive for ruminants. Thus, the appropriate amount to use an additive must be determined. Therefore, this study aimed to determine the appropriate amount of supplementary Coccomyxa sp. KJ and investigate the effects of KJ1 and KJ2 as additives to corn silage substrate, which is commonly used for dairy production in Japan and worldwide, on in vitro ruminal fermentation, digestibility, CH4 production, and the ruminal microbiome.

Materials and methods

Ethical approval

The study was approved by the Utsunomiya University Animal Ethics Committee (approval no. A22-0013). Anesthesia and euthanasia were not performed in this study.

Substrate, additives, and experimental treatments

Collected corn silage was dried at 60°C, ground using a sanitary crusher (SC-02, Sansho Industry Co. Ltd, Osaka, Japan), and passed through a 1 mm screen. The sample was used as the substrate for in vitro incubation. KJ1 and KJ2 were separately incubated in open ponds, concentrated by centrifugation, and dried to a powder at 140°C using a drum dryer. The dried KJ1 and KJ2 powders were used as additives (Fig 1). The following five experimental treatments were applied: I) substrate only (CON), II) CON + 0.5% dry matter (DM) KJ1 (KJ1_L), III) CON + 1.0% DM KJ1 (KJ1_H), IV) CON + 0.5% DM KJ2 (KJ2_L), and V) CON + 1.0% DM KJ2 (KJ2_H).

thumbnail
Fig 1. Images of dried powders of two types of Coccomyxa sp. KJ.

The images on the left and right show KJ1 and KJ2, respectively.

https://doi.org/10.1371/journal.pone.0308646.g001

In vitro experiments

Two female Holstein cows (body weight: 593 ± 63.6 kg, parity: 3 and 4) at the Utsunomiya University Farm were used. The animals were mostly housed in a tie-stall housing system, although they were allowed to graze on Italian ryegrass-based pasture from 09:00 to 13:00. The cows were primarily fed corn silage and concentrate five times daily at 05:30, 07:00, 13:00, 17:00, and 21:00. The ingredient compositions of the concentrate were as follows: 28.6% corn, 24.2% soybean meal, 13.2% barley, 8.8% wheat bran, 8.2% rice bran, 6.6% cotton seed, 5.5% fodder beet, 2.7% CaCO3, 1.1% NaCl, and 1.1% vitamin-mineral premix on a fresh matter basis. The average 7-day feed intake of corn silage and concentrate before sampling was 7.7 ± 0.14 kg and 7.4 ± 0.35 kg on a DM basis, respectively. Additionally, timothy hay was offered at < 2.5 kg daily. The cows were provided ad libitum access to water.

Rumen liquid (approximately 200 mL) was collected from each animal through orogastric tubing before the first feeding. The rumen samples were strained through four layers of gauze and mixed equally. The mixed samples were placed in preheated collection bottles and immediately transferred to the laboratory within 30 min. The rumen sample and artificial saliva [28], which was flushed with CO2, were mixed at a ratio of 1:4. The mixture (40 mL) was infused into each test tube containing 0.5 gDM of the substrate and additives under a stream of CO2. All tubes were immediately closed with rubber stoppers fitted with a plastic syringe to collect fermentation gas. The tubes were then incubated for 24 h at 39°C. Each treatment and blank containing only the mixture was set up in triplicates. The cumulative gas production at 0, 3, 6, 9, 12, 18, and 24 h was recorded during incubation. After incubation, samples (0.5 mL) were collected for DNA extraction and stored at −80°C, and additional 0.5 mL of the culture was mixed with 4.5 mL of methyl green formalin saline (MFS) solution to count the number of protozoa [29]. The remaining samples were centrifuged at 500 × g for 5 min. Subsequently, the pH was measured (LAQUAtwin pH-33B, HORIBA, Kyoto, Japan), and 10 mL of the supernatant was mixed with 2 mL of 25% metaphosphate solution to analyze the VFA and ammonia nitrogen (NH3-N) concentrations. The residue was used to determine DM degradability. The gas production, CH4 production, and DM degradability values for the experimental treatments were correlated with those of the blank.

Chemical analyses

The substrate and additives were analyzed for DM, ether extract, and crude ash content according to the standards of the Association of Official Analytical Chemists (AOAC; 930.15, 920.39, and 942.05, respectively) [30]. The crude protein content was determined using the Dumas method with a nitrogen analyzer (Sumigraph NC-TRINITY; Sumika Chemical Analysis Service, Tokyo, Japan). The amylase-treated neutral and acid detergent fiber contents were determined as previously described [31]. The chemical compositions of the experimental feeds and substrates are shown in Tables 1 and 2, respectively. To measure DM degradability, the incubation residue was dried at 105°C until reaching a constant weight. To determine the fatty acid composition of Coccomyxa sp. KJ, direct transesterification was performed using a previously described method [32]. The fatty acid methyl ester (FAME) contents were analyzed using a gas chromatography system (GC-2010 Plus, Shimadzu Co., Ltd., Kyoto, Japan) equipped with a flame ionization detector (FID) and a capillary column (SP-2560, 100 m × 0.25 mm × 0.2μm, Supelco, Pennsylvania, USA) at a split rate of 100. The column, injector, and detector temperatures were 185°C, 250°C, and 250°C, respectively. The FAME contents were identified by matching the retention times with the standards of the Supelco® 37 Component FAME Mix. VFA concentrations were measured using gas chromatography (GC-2014, Shimadzu, Kyoto, Japan) equipped with a FID and a Restek Stabilwax column (30 m × 0.32 mm × 0.50 μm) at a split rate of 5. The temperatures of the injection and detector were 200°C and 250°C, respectively. The column temperature was linearly increased from 120°C to 230°C at 10°C/min. CH4 production was determined using a GC-2014 (Shimadzu) equipped with a FID and a capillary column (SH-Q-BOND, 30 m × 0.53 mm × 20 μm, Shimadzu) at a split rate of 5. The column, injection, and detector temperatures were 220°C, 250°C, and 250°C, respectively. The NH3-N concentration was analyzed using the microdiffusion method [33].

thumbnail
Table 1. Chemical composition of the feeds and Coccomyxa sp. KJ (% dry matter basis).

https://doi.org/10.1371/journal.pone.0308646.t001

thumbnail
Table 2. Chemical composition of the substrates in treatments (% dry matter basis).

https://doi.org/10.1371/journal.pone.0308646.t002

DNA extraction, amplicon sequencing, and bioinformatics

The liquid samples after incubation were thawed and centrifuged at 12,000 × g at 4°C for 15 min. After removing the supernatants, the pellets were used for DNA extraction, as previously described [34] and slightly modified [35]. The extracted DNA was stored at -20°C until use.

To amplify prokaryotic DNA, the V3–V4 hypervariable region of the 16S rRNA genes was amplified using PCR with Pro341F (5′-CCTACGGGNBGCASCAG-3′) and Pro805R (5′-GACTACNVGGGTATCTAATCC-3′) primers [36]. Additionally, RP841F (5′-GACTAGGGATTGGARTGG-3′) and Reg1302R (5′-AATTGCAAAGATCTATCCC-3′) were used for protozoal 18S rRNA gene amplification [37]. Forward and reverse primers were tagged with the Illumina overhang adapter (forward: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, reverse: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG). Amplification was performed under the following conditions: 95°C for 3 min; followed by 25 or 35 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s for the prokaryotic and protozoal primers, respectively; and a final elongation step at 72°C for 5 min. The samples were indexed using a Nextera XT index kit (Illumina, San Diego, CA, USA) and paired-end sequenced on an Illumina MiSeq platform (2 × 300 bp).

After sequencing, the data were analyzed using QIIME2 [38]. Paired-end reads were trimmed and merged, and chimeric sequences were removed using the DADA2 plugin [39], followed by the construction of a feature table of amplicon sequence variants (ASVs). Taxonomy was assigned using the SILVA 138 reference database [40]. For the prokaryotic analysis, ASVs taxonomically assigned to the unassigned kingdom, eukaryotes, mitochondria, and chloroplasts were removed, whereas ASVs assigned to the unassigned kingdom, bacteria, and archaea were removed for protozoa. For diversity analysis, all sequence data were rarefied to the lowest sample depths of 32,879 and 1,737 sequences per sample for the prokaryotes and protozoa, respectively. The observed ASVs and Shannon diversity indices [41] were estimated using the ‘Phyloseq’ package of R [42]. The weighted UniFrac distance metric based on ASV was calculated using the ‘Phyloseq’ package [42], and the principal coordinates analysis (PCoA) plot was visualized with ‘ggplots2’ in R [43].

Statistical analyses

The pH, gas and CH4 production, DM degradability, NH3-N content, VFA concentration, protozoal count data, and alpha diversity were analyzed using the GLM procedure in SAS Studio 9.04.01. The mathematical model was as follows: where μ represents the overall mean, Ti represents the effect of treatment, and eij represents the residual error. For beta diversity, permutational multivariate analysis of variance (PERMANOVA) with 9,999 permutations was performed. Differential abundance analysis between each group for microbial composition was performed using the Wald test within DESeq2 based on the read count matrix [44], and P-values were adjusted using the Benjamini–Hochberg method. Differences were considered statistically significant at P < 0.05.

Results

Fatty acid composition

The fatty acid composition of the Coccomyxa sp. KJ is shown in Table 3. The percentages of C16:0 (palmitic acid) in KJ1 and KJ2 were equivalent at 19.15 and 17.82%, respectively. The C18:1 (oleic acid) content in KJ1 was largely dominant at 56.67% and was approximately 2.7 times higher than that in KJ2 (20.87%). In contrast, PUFA such as C18:2 (linoleic acid) and C18:3 (linolenic acid) in KJ2 were 10.63 and 29.61%, respectively, and were more abundant compared to KJ1.

thumbnail
Table 3. Fatty acid composition (%) of Coccomyxa sp. KJ.

https://doi.org/10.1371/journal.pone.0308646.t003

In vitro gas and CH4 production

Total gas production was decreased after 24 h of incubation in KJ1_H, KJ2_L, and KJ2_H (P < 0.05) compared to that in CON. In contrast, no significant differences were observed between the KJ1_L and CON treatments (Table 4 and S1 Fig). Similarly, total CH4 production in KJ1_H, KJ2_L, and KJ2_H was 34.1, 51.3, and 41.6% lower than that in CON (P < 0.05), respectively (Fig 2A). DM degradability-adjusted CH4 production was inhibited by 48.4 and 40.8% in KJ2_L and KJ2_H compared to that in CON (P < 0.05), respectively (Fig 2B).

thumbnail
Fig 2. In vitro methane (CH4) production after 24 h of incubation.

(A) Cumulative CH4 production and (B) dry matter degradability-adjusted CH4. Significant differences are indicated by different superscripts (P < 0.05). IVDMD, in vitro dry matter degradability.

https://doi.org/10.1371/journal.pone.0308646.g002

thumbnail
Table 4. Effect of two types of Coccomyxa sp. KJ on in vitro rumen fermentation after 24 h incubation.

https://doi.org/10.1371/journal.pone.0308646.t004

Degradability, rumen fermentation characteristics, and protozoa population

No significant differences were observed in pH, NH3-N, or protozoa count among the treatments (Table 4). DM degradability in KJ2_L was lower than in CON (P < 0.05), whereas no significant differences were observed among the other treatments (Table 4). No significant differences were observed among the treatments in the total VFA concentration and proportion of each VFA except for propionate (Table 4). The proportion of propionate in the KJ1-supplemented treatments was higher than that in the CON treatment and was further increased in the KJ2-supplemented treatments (P < 0.05).

Rumen microbiome after in vitro incubation

The Shannon diversity index of KJ2_H was lower than that of CON for the rumen prokaryotes (Fig 3A). However, the number of observed ASVs was not significantly different among treatments (Fig 3A). Additionally, the observed ASVs of KJ2_L and KJ2_H were lower than those of CON for the rumen protozoa (Fig 3B). Beta diversity analysis based on weighted UniFrac distance showed significant differences in the rumen prokaryote communities among treatments (PERMANOVA, P < 0.05). In particular, prokaryotic communities in KJ2_L and KJ2_H were distinctly different from those in CON and KJ1_L (Fig 3C). However, no differences were observed among treatments for rumen protozoa communities (Fig 3D).

thumbnail
Fig 3. Rumen microbial diversity after 24 h of in vitro incubation.

Alpha diversity of (A) rumen prokaryotes and (B) protozoa at the ASV level. Different letters at the top indicate significant differences between treatments (P < 0.05). Beta diversity of principal coordinate analysis (PCoA) based on weighted UniFrac distances of (C) rumen prokaryotes and (D) protozoa at the ASV level. Significance was analyzed using a permutational multivariate analysis of variance with 9,999 permutations.

https://doi.org/10.1371/journal.pone.0308646.g003

Based on 16S rRNA amplicon sequencing, 18 bacterial and two archaeal phyla were observed, and Bacteroidota, Firmicutes, and Proteobacteria accounted for approximately 95% of the total abundance (Fig 4A). Compared to CON, the abundance of Verrucomicrobiota and Patescibacteria was low while that of Firmicutes was high in KJ1_H and KJ2_H (adjusted P < 0.05) (S1 Table). Additionally, the abundances of 14, 11, and 22 genera were significantly different in KJ1_H, KJ2_L, and KJ2_H, respectively, compared with CON (S1 Table). However, no significant difference was observed between CON and KJ1_L (S1 Table). Compared with CON, Butyrivibrio, Shuttleworthia, Megasphaera, and Succiniclasticum were enriched in KJ1_H and KJ2_H (adjusted P < 0.05) (Fig 4B and S1 Table). Furthermore, the abundance of Pseudobutyrivibrio, Selenomonas, and Ruminobacter was also higher in KJ2_H than in CON (adjusted P < 0.05) (Fig 4B and S1 Table). In contrast, the abundance of 10 genera, most of which accounted for < 1.0% of total abundance, was lower in KJ2_H than in CON (adjusted P < 0.05).

thumbnail
Fig 4. Microbial communities after 24 h of in vitro incubation.

(A) Taxonomic distribution of the rumen microbiome at the phylum level. All phyla with a relative abundance of < 0.1% in all treatments were combined into “Others.” (B) Relative abundances of significantly different genera between CON and KJ2_H (adjusted P < 0.05). Differential genera were identified using DESeq2. Only genera with a relative abundance of at least 0.5% were present.

https://doi.org/10.1371/journal.pone.0308646.g004

For the rumen protozoa, only one phylum, Ciliophora, was identified. Seven genera were identified, and Entodinium was the most abundant (93.5%), followed by Charonina (2.4%), and Diplodinium (2.3%) (S2 Fig). Only Polyplastron in KJ2_H was lower than that in CON (adjusted P < 0.05); however, no significant differences were observed at the genus level between CON and the other treatments.

Discussion

To our knowledge, this study is the first to investigate the effects of two types of Coccomyxa sp. KJ (KJ1 and KJ2) on rumen total gas and CH4 production, rumen fermentation characteristics, and the rumen microbiome under in vitro conditions. The use of microalgae as feed additives has been predicted to inhibit CH4 production from the rumen. In a previous study, adding 10 and 25% E. gracilis reduced ruminal CH4 production in vitro by 4.4 and 11%, respectively, when hay and concentrate (50%:50%) were used as substrates [17]. Additionally, in vitro ruminal CH4 production was reduced by approximately 19% by supplementation with 2% and 3% C. vulgaris [18]. In this study, supplementary KJ1 and KJ2 decreased CH4 production by 34.1–51.3% compared to that in CON, indicating that Coccomyxa sp. KJ, particularly KJ2, had a significantly stronger inhibitory effect on ruminal CH4 than other microalgae. Importantly, the amounts of additives used in this study were very low, from 0.5 to 1.0%. Generally, feed additives are more expensive than basal diet. Therefore, the addition of a significantly lower amount of Coccomyxa sp. KJ is an economical and feasible strategy to decrease ruminal CH4 production.

One possible factor for reducing ruminal CH4 is the fatty acid content, particularly monounsaturated fatty acids (MUFAs) and PUFAs, in Coccomyxa sp. KJ. In a previous study, Martin et al. [7] reported that adding 5.7% linseed oil, which has a high PUFA content, inhibited CH4 production from dairy cows by 64%. Furthermore, calcium salts of long-chain fatty acids, most of which are PUFAs, from linseed oil drastically decrease in vitro ruminal CH4 production [8, 9]. KJ1 and KJ2 used in this study included high amounts of oleic and linolenic acid, respectively. Considering that the ruminal CH4 reduction effect of linolenic acid is higher than that of oleic acid [45], KJ2 likely had a greater reduction effect on ruminal CH4 production than KJ1. However, it is curious that Coccomyxa sp. KJ had a significant reduction effect on ruminal CH4 emissions, although the ether extract content of KJ1 and KJ2 was only 11.5–22.8% DM, and the amount of fatty acids added was much lower than that in previous studies [7, 8]. Therefore, substances other than fatty acids in Coccomyxa sp. KJ may be responsible for inhibiting ruminal CH4.

Although CH4 synthesized by methanogens using H2 and CO2 as substrates is the primary H2 sink in the rumen, propionate production is associated with disposable H2 [46]. Therefore, increasing the proportion of propionate competes for H2 with methanogenesis by methanogens, thereby inhibiting CH4 production. Several studies have demonstrated that the proportion of propionate in the rumen increases with CH4 inhibition [8, 47, 48]. Similarly, compared with the CON treatment, the addition of KJ1 increased the proportion of propionate, and the addition of KJ2 led to an even greater increase in the current study.

The increase in propionate may be attributed to changes in the rumen microbiome caused by the addition of KJ1 and KJ2. Beta diversity analysis indicated that the ruminal microbiota in KJ1_H, KJ2_L, and KJ2_H was significantly different from that in CON. In addition, the proportion of some bacterial genera related to propionate production increased with the addition of 1.0% KJ2. For example, when 1.0% KJ2 was added, a significant increase was observed in the relative abundances of Selenomonas, Succiniclasticum, and Ruminobacter, which are associated with propionate synthesis via the succinate pathway. This result is consistent with that of a previous study in which ruminal CH4 was inhibited after adding calcium salts of long-chain fatty acids [8]. Ruminobacter produces succinate in the rumen [49], whereas Selenomonas and Succiniclasticum can promote the metabolism of carbohydrate fermentation-derived succinate to propionate [50, 51]. Furthermore, Megasphaera, which converts lactate to propionate via the acrylate pathway in the rumen [49], was also enriched in the KJ2_H treatment. Megasphaera spp. are more abundant in low than in high-CH4-emitting sheep [52], and Megasphaera elsdenii is more abundant in the rumen of cows with a high feed efficiency [53]. The relative abundance of the genus Megasphaera is positively correlated with the average daily gain [54] and microbial proteins that can be used to synthesize milk proteins [55]. Therefore, increasing Megasphaera abundance by adding KJ2 would benefit milk production. The abundance of Shuttleworthia, which is positively correlated with the propionate concentration in the rumen [56, 57], was also increased in KJ1_H, KJ2_L, and KJ2_H. Thus, the increasing proportion of propionate produced through the addition of KJ1 and KJ2 can be attributed to the higher abundance of these genera that contribute to propionate production.

Similarly, the abundance of Butyrivibrio and Pseudobutyrivibrio, the main butyrate-producing bacteria in the rumen [58], increased with the addition of 1.0% KJ2. Some researchers have demonstrated that the abundance of these genera is positively correlated with CH4 emissions [59], which is inconsistent with our results. As Butyrivibrio spp. and Pseudobutyrivibrio spp. can perform ruminal biohydrogenation of unsaturated fatty acids, such as linoleic and α-linolenic acid [6063], increased PUFAs caused by adding KJ2 lead to an increase in the abundance of these bacteria. Thus, Butyrivibrio spp. and Pseudobutyrivibrio spp. may not be positively correlated with CH4 emissions when PUFA suppress CH4 production in the rumen.

Ciliate protozoa, which are hydrogen producers in the rumen, harbor methanogens on the cell surface and in the cytoplasm as endosymbionts [64, 65]. Interspecies hydrogen transfer has been observed between rumen ciliates and methanogens, resulting in enhanced methanogenesis in the rumen [66]. In the present study, the alpha diversity of protozoa decreased in the 0.5% and 1.0% KJ2 treatments compared to the CON treatment, suggesting that KJ2 has a toxic effect against protozoa. The reduction in protozoan diversity may be related to suppressing ruminal CH4 production.

The addition of KJ1 and KJ2 did not affect ruminal pH, NH3-N concentrations, and total VFAs, suggesting that Coccomyxa sp. KJ had no negative effect on ruminal characteristics. However, a slight reduction in DM degradability was observed with the addition of 0.5% KJ2 (CON: 46.5%; KJ2_L: 43.5%). This finding may be attributed to the antimicrobial effect of Coccomyxa sp. KJ, particularly MUFAs and PUFAs, on bacteria. In the present study, reduced prokaryotic alpha diversity was observed after addition of 1.0% KJ2. Similarly, the addition of calcium salts of long-chain fatty acids decreases alpha diversity, resulting in reduced DM degradability and CH4 production [8].

In this study, we evaluated the effects of supplementation with Coccomyxa sp. KJ as the corn silage source because corn silage is a common roughage source in dairy production. Although many studies have investigated the effects of feed additives on in vitro rumen fermentation under corn silage conditions [67, 68], different effects have been reported for substrate at different concentrate to roughage ratios [69]. Therefore, we need to verify whether supplementary Coccomyxa sp. KJ has an inhibitory effect on ruminal CH4 under different substrate conditions.

In conclusion, both types of Coccomyxa sp. KJ—KJ1 and KJ2—had a high inhibitory effect on rumen CH4 production when only 0.5–1.0% was added. In particular, KJ2 had a greater inhibitory effect on ruminal CH4 production than KJ1. Furthermore, Coccomyxa sp. KJ modified the rumen microbiome, resulting in increased propionate and decreased CH4 production. These findings provide important information for inhibiting ruminal CH4 emissions, which is essential for increasing animal productivity and sustaining livestock production under future population growth. Future in vivo studies are needed to validate the inhibitory effect and to determine the optimal dose of Coccomyxa sp. KJ supplementation without decreasing digestibility and productivity.

Supporting information

S1 Fig. In vitro gas production during 24 h of incubation.

https://doi.org/10.1371/journal.pone.0308646.s001

(TIF)

S2 Fig. Relative abundance of protozoa after 24 h of incubation.

https://doi.org/10.1371/journal.pone.0308646.s002

(TIF)

S1 Table. Relative abundance (%) of each taxa at phylum and genus level in treatment.

1Taxa with significant differences between CON and other treatments (adjusted P < 0.05). 2Treatments with higher or lower abundance compared to CON.

https://doi.org/10.1371/journal.pone.0308646.s003

(XLSX)

Acknowledgments

Supercomputing resources were provided by the Human Genome Center, Institute of Medical Science, University of Tokyo, Japan.

References

  1. 1. Gerber PJ, Steinfeld H, Henderson B, Mottet A, Opio C, Dijkman J, et al. Tackling climate change through livestock: a global assessment of emissions and mitigation opportunities. Food and Agriculture Organization of the United Nations (FAO); 2013.
  2. 2. Johnson KA, Johnson DE. Methane emissions from cattle. J Anim Sci. 1995;73: 2483–2492. pmid:8567486
  3. 3. Romero-Perez A, Okine EK, McGinn SM, Guan LL, Oba M, Duval SM, et al. The potential of 3-nitrooxypropanol to lower enteric methane emissions from beef cattle. J Anim Sci. 2014;92: 4682–4693. pmid:25184838
  4. 4. Duin EC, Wagner T, Shima S, Prakash D, Cronin B, Yáñez-Ruiz DR, et al. Mode of action uncovered for the specific reduction of methane emissions from ruminants by the small molecule 3-nitrooxypropanol. Proc Natl Acad Sci. 2016;113: 6172–6177. pmid:27140643
  5. 5. Shinkai T, Enishi O, Mitsumori M, Higuchi K, Kobayashi Y, Takenaka A, et al. Mitigation of methane production from cattle by feeding cashew nut shell liquid. J Dairy Sci. 2012;95: 5308–5316. pmid:22916936
  6. 6. Machmüller A, Ossowski DA, Wanner M, Kreuzer M. Potential of various fatty feeds to reduce methane release from rumen fermentation in vitro (Rusitec). Anim Feed Sci Technol. 1998;71: 117–130.
  7. 7. Martin C, Rouel J, Jouany JP, Doreau M, Chilliard Y. Methane output and diet digestibility in response to feeding dairy cows crude linseed, extruded linseed, or linseed oil. J Anim Sci. 2008;86: 2642–2650. pmid:18469051
  8. 8. Sato Y, Tominaga K, Aoki H, Murayama M, Oishi K, Hirooka H, et al. Calcium salts of long-chain fatty acids from linseed oil decrease methane production by altering the rumen microbiome in vitro. PLoS One. 2020;15: e0242158. pmid:33170886
  9. 9. Aoki H, Sato Y, Katsumata S, Yamauchi M, Yamanaka S, Kishi Y, et al. Effects of calcium salt of linseed oil fatty acid with different oil adsorbents on in vitro gas production and ruminal fermentation characteristics. Anim Sci J. 2022;93: e13707. pmid:35289034
  10. 10. Asanuma N, Iwamoto M, Hino T. Effect of the addition of fumarate on methane production by ruminal microorganisms in vitro. J Dairy Sci. 1999;82: 780–787. pmid:10212465
  11. 11. Carro MD, Ranilla MJ. Influence of different concentrations of disodium fumarate on methane production and fermentation of concentrate feeds by rumen micro-organisms in vitro. Br J Nutr. 2003;90: 617–623. pmid:13129468
  12. 12. Yamada K, Iwamae K, Suzuki Y, Koike S, Kobayashi Y. Batch culture analysis to identify potent organic acids for suppressing ruminal methane production. Anim Sci J. 2023;94: e13873. pmid:37721187
  13. 13. Priyadarshani I, Rath B. Commercial and industrial applications of micro algae–A review. J Algal Biomass Util. 2012;3: 89–100.
  14. 14. Elsabagh MR, Abd Eldaim MA, Mahboub DH, Abdel-Daim M. Effects of Spirulina platensis algae on growth performance, antioxidative status and blood metabolites in fattening lambs. J Agric Sci. 2014;6: 92.
  15. 15. Kulpys J, Paulauskas E, Pilipavicius V, Stankevicius R. Influence of cyanobacteria Arthrospira (Spirulina) platensis biomass additive towards the body condition of lactation cows and biochemical milk indexes. Agron Res. 2009;7: 823–835.
  16. 16. Palangi V, Taghizadeh A, Abachi S, Lackner M. Strategies to mitigate enteric methane emissions in ruminants: A review. Sustainability. 2022;14: 13229.
  17. 17. Ahmed E, Suzuki K, Nishida T. Micro-and Macro-Algae Combination as a Novel Alternative Ruminant Feed with Methane-Mitigation Potential. Animals. 2023;13: 796. pmid:36899652
  18. 18. Kholif AE, Gouda GA, Morsy TA, Matloup OH, Sallam SM, Patra AK. Associative effects between Chlorella vulgaris microalgae and Moringa oleifera leaf silage used at different levels decreased in vitro ruminal greenhouse gas production and altered ruminal fermentation. Environ Sci Pollut Res. 2023;30: 6001–6020. pmid:35986854
  19. 19. Boeckaert C, Vlaeminck B, Dijkstra J, Issa-Zacharia A, Van Nespen T, Van Straalen W, et al. Effect of dietary starch or micro algae supplementation on rumen fermentation and milk fatty acid composition of dairy cows. J Dairy Sci. 2008;91: 4714–4727. pmid:19038948
  20. 20. Kiani A, Wolf C, Giller K, Eggerschwiler L, Kreuzer M, Schwarm A. In vitro ruminal fermentation and methane inhibitory effect of three species of microalgae. Can J Anim Sci. 2020;100: 485–493.
  21. 21. Yasui H, Kurano N, Fukuda H, Miyashita H, New microalgae. https://patents.google.com/patent/JP6088375B2/en.
  22. 22. Yoshimitsu Y, Abe J, Harayama S. Cas9-guide RNA ribonucleoprotein-induced genome editing in the industrial green alga Coccomyxa sp. strain KJ. Biotechnol Biofuels. 2018;11: 326. pmid:30555532
  23. 23. Asai S, Hayashi K, Atsumi H, Doi M, Kakizoe H, Umezawa K, et al. Immune and allergenic effects of the microalga Coccomyxa sp. strain KJ in healthy humans: A pilot study. Adv Clin Exp Med Off Organ Wroclaw Med Univ. 2023.
  24. 24. Hayashi K, Lee J-B, Atsumi K, Kanazashi M, Shibayama T, Okamoto K, et al. In vitro and in vivo anti-herpes simplex virus activity of monogalactosyl diacylglyceride from Coccomyxa sp. KJ (IPOD FERM BP-22254), a green microalga. PLoS One. 2019;14: e0219305. pmid:31310628
  25. 25. Hayashi K, Asai S, Umezawa K, Kakizoe H, Miyachi H, Morita M, et al. Virucidal effect of monogalactosyl diacylglyceride from a green microalga, Coccomyxa sp. KJ, against clinical isolates of SARS‐CoV‐2 as assessed by a plaque assay. J Clin Lab Anal. 2022;36: e24146. pmid:34837712
  26. 26. Hayashi K, Komatsu S, Kuno H, Asai S, Matsuura I, Kudkyal VR, et al. Virucidal and immunostimulating activities of monogalactosyl diacylglyceride from Coccomyxa sp. KJ, a green microalga, against murine norovirus and feline calicivirus. Mar Drugs. 2022;20: 131. pmid:35200660
  27. 27. Hayashi K, Kuno H, Komatsu S, Lee J-B, Kawahara T. Therapeutic Effects of a Dry Powder Prepared from the Green Microalga Coccomyxa sp. KJ in Mice Infected with Influenza A Virus. Appl Microbiol. 2022;2: 481–491.
  28. 28. McDougal EI. Studies on ruminant saliva. 1. The composition and output of sheep’s saliva. Biochem J. 1948;43: 99–109.
  29. 29. Ogimoto K, Imai S. Atlas of rumen microbiology. Japan Scientific Societies Press.; 1981.
  30. 30. Association of Official Analytical Chemists (AOAC) (2000). Official methods of analysis, 17th ed. Virginia: Association of Official Analytical Chemists.
  31. 31. Van Soest PJ van, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci. 1991;74: 3583–3597.
  32. 32. Lewis T, Nichols PD, McMeekin TA. Evaluation of extraction methods for recovery of fatty acids from lipid-producing microheterotrophs. J Microbiol Methods. 2000;43: 107–116. pmid:11121609
  33. 33. Conway E. Microdiffusion analysis and volumetric error. Crosby Lockwood & Son Ltd.; London; 1947.
  34. 34. Frias-Lopez J, Shi Y, Tyson GW, Coleman ML, Schuster SC, Chisholm SW, et al. Microbial community gene expression in ocean surface waters. Proc Natl Acad Sci. 2008;105: 3805–3810. pmid:18316740
  35. 35. Sato Y, Takebe H, Tominaga K, Oishi K, Kumagai H, Yoshida T, et al. Taxonomic and functional characterization of the rumen microbiome of Japanese Black cattle revealed by 16S rRNA gene amplicon and metagenome shotgun sequencing. FEMS Microbiol Ecol. 2021;97: fiab152. pmid:34864967
  36. 36. Takahashi S, Tomita J, Nishioka K, Hisada T, Nishijima M. Development of a prokaryotic universal primer for simultaneous analysis of bacteria and archaea using next-generation sequencing. PLoS One. 2014;9: e105592. pmid:25144201
  37. 37. Henderson G, Cox F, Ganesh S, Jonker A, Young W, Abecia L, et al. Rumen microbial community composition varies with diet and host, but a core microbiome is found across a wide geographical range. Sci Rep. 2015;5: 14567. pmid:26449758
  38. 38. Bolyen E, Rideout JR, Dillon MR, Bokulich NA, Abnet CC, Al-Ghalith GA, et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat Biotechnol. 2019;37: 852–857. pmid:31341288
  39. 39. Callahan BJ, McMurdie PJ, Rosen MJ, Han AW, Johnson AJA, Holmes SP. DADA2: high-resolution sample inference from Illumina amplicon data. Nat Methods. 2016;13: 581. pmid:27214047
  40. 40. Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 2012;41: D590–D596. pmid:23193283
  41. 41. Shannon CE. A mathematical theory of communication. Bell Syst Tech J. 1948;27: 379–423.
  42. 42. McMurdie PJ, Holmes S. phyloseq: an R package for reproducible interactive analysis and graphics of microbiome census data. PLoS One. 2013;8: e61217. pmid:23630581
  43. 43. Wickham H. ggplot2: elegant graphics for data analysis. Springer; 2016.
  44. 44. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15: 550. pmid:25516281
  45. 45. O’Brien M, Navarro-Villa A, Purcell PJ, Boland TM, O’Kiely P. Reducing in vitro rumen methanogenesis for two contrasting diets using a series of inclusion rates of different additives. Anim Prod Sci. 2013;54: 141–157.
  46. 46. Choudhury PK, Jena R, Tomar SK, Puniya AK. Reducing enteric methanogenesis through alternate hydrogen sinks in the rumen. Methane. 2022;1: 320–341.
  47. 47. Kone P, Machado PF, Cook RM. Effect of the combination of monensin and isoacids on rumen fermentation in vitro. J Dairy Sci. 1989;72: 2767–2771. pmid:2600235
  48. 48. Mitsumori M, Shinkai T, Takenaka A, Enishi O, Higuchi K, Kobayashi Y, et al. Responses in digestion, rumen fermentation and microbial populations to inhibition of methane formation by a halogenated methane analogue. Br J Nutr. 2012;108: 482–491. pmid:22059589
  49. 49. Stewart CS, Flint HJ, Bryant MP. The rumen bacteria. in The rumen microbial ecosystem. Springer; 1997. pp. 10–72.
  50. 50. Scheifinger CC, Wolin MJ. Propionate formation from cellulose and soluble sugars by combined cultures of Bacteroides succinogenes and Selenomonas ruminantium. Appl Microbiol. 1973;26: 789–795. pmid:4796955
  51. 51. Van Gylswyk NO. Succiniclasticum ruminis gen. nov., sp. nov., a ruminal bacterium converting succinate to propionate as the sole energy-yielding mechanism. Int J Syst Evol Microbiol. 1995;45: 297–300.
  52. 52. Kamke J, Kittelmann S, Soni P, Li Y, Tavendale M, Ganesh S, et al. Rumen metagenome and metatranscriptome analyses of low methane yield sheep reveals a Sharpea-enriched microbiome characterised by lactic acid formation and utilisation. Microbiome. 2016;4:56. pmid:27760570
  53. 53. Shabat SK Ben, Sasson G, Doron-Faigenboim A, Durman T, Yaacoby S, Miller MEB, et al. Specific microbiome-dependent mechanisms underlie the energy harvest efficiency of ruminants. ISME J. 2016;10: 2958–2972.
  54. 54. McLoughlin S, Spillane C, Claffey N, Smith PE, O’Rourke T, Diskin MG, et al. Rumen microbiome composition is altered in sheep divergent in feed efficiency. Front Microbiol. 2020;11: 1981. pmid:32983009
  55. 55. Amin AB, Zhang L, Zhang J, Mao S. Metagenomics analysis reveals differences in rumen microbiota in cows with low and high milk protein percentage. Appl Microbiol Biotechnol. 2023;107: 4887–4902. pmid:37306708
  56. 56. Li J, Lian H, Zheng A, Zhang J, Dai P, Niu Y, et al. Effects of different roughages on growth performance, nutrient digestibility, ruminal fermentation, and microbial community in weaned Holstein calves. Front Vet Sci. 2022;9: 864320. pmid:35903131
  57. 57. Guduk E, Hall MB, Zanton GI, Steinberger AJ, Weimer PJ, Suen G, et al. Characterization of rumen microbiota in lactating Holstein cows fed molasses versus corn grain at two levels of rumen-degradable protein. Front Microbiomes. 2023;2: 1204988.
  58. 58. Kopečný J, Zorec M, Mrazek J, Kobayashi Y, Marinšek-Logar R. Butyrivibrio hungatei sp. nov. and Pseudobutyrivibrio xylanivorans sp. nov., butyrate-producing bacteria from the rumen. Int J Syst Evol Microbiol. 2003;53: 201–209.
  59. 59. Auffret MD, Stewart R, Dewhurst RJ, Duthie C-A, Rooke JA, Wallace RJ, et al. Identification, comparison, and validation of robust rumen microbial biomarkers for methane emissions using diverse Bos Taurus breeds and basal diets. Front Microbiol. 2018;8: 2642. pmid:29375511
  60. 60. Kepler CR, Hirons KP, McNeill JJ, Tove SB. Intermediates and products of the biohydrogenation of linoleic acid by Butyrivibrio fibrisolvens. J Biol Chem. 1966;241: 1350–1354.
  61. 61. Kepler CR, Tove SB. Biohydrogenation of unsaturated fatty acids: III. Purification and properties of a linoleate Δ12-cis, Δ11-trans-isomerase from Butyrivibrio fibrisolvens. J Biol Chem. 1967;242: 5686–5692.
  62. 62. Wallace RJ, Chaudhary LC, McKain N, McEwan NR, Richardson AJ, Vercoe PE, et al. Clostridium proteoclasticum: a ruminal bacterium that forms stearic acid from linoleic acid. FEMS Microbiol Lett. 2006;265: 195–201. pmid:17147764
  63. 63. Paillard D, McKain N, Chaudhary LC, Walker ND, Pizette F, Koppova I, et al. Relation between phylogenetic position, lipid metabolism and butyrate production by different Butyrivibrio-like bacteria from the rumen. Antonie Van Leeuwenhoek. 2007;91: 417–422. pmid:17077990
  64. 64. Vogels GD, Hoppe WF, Stumm CK. Association of methanogenic bacteria with rumen ciliates. Appl Environ Microbiol. 1980;40: 608–612. pmid:6775596
  65. 65. Finlay BJ, Esteban G, Clarke KJ, Williams AG, Embley TM, Hirt RP. Some rumen ciliates have endosymbiotic methanogens. FEMS Microbiol Lett. 1994;117: 157–161. pmid:8181718
  66. 66. Ushida K, Newbold CJ, Jouany J-P. Interspecies hydrogen transfer between the rumen ciliate Polyplastron multivesiculatum and Methanosarcina barkeri. J Gen Appl Microbiol. 1997;43: 129–131. pmid:12501346
  67. 67. Goiri I, Garcia-Rodriguez A, Oregui LM. Effect of chitosans on in vitro rumen digestion and fermentation of maize silage. Anim Feed Sci Technol. 2009;148: 276–287.
  68. 68. Witzig M, Lengowski MB, Zuber KHR, Möhring J, Rodehutscord M. Effects of supplementing corn silage with different nitrogen sources on ruminal fermentation and microbial populations in vitro. Anaerobe. 2018;51: 99–109.
  69. 69. Kholif AE, Elghandour MMY, Salem AZM, Barbabosa A, Márquez O, Odongo NE. The effects of three total mixed rations with different concentrate to maize silage ratios and different levels of microalgae Chlorella vulgaris on in vitro total gas, methane and carbon dioxide production. J Agric Sci. 2017;155: 494–507.