Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Unveiling the anti-obesity potential of Kemuning (Murraya paniculata): A network pharmacology approach

  • Rizka Fatriani,

    Roles Data curation, Investigation, Visualization, Writing – original draft

    Affiliation Tropical Biopharmaca Research Center, IPB University, Bogor, Indonesia

  • Firda Agustin Kartika Pratiwi,

    Roles Data curation, Investigation, Writing – original draft

    Affiliation Department of Computer Science, Faculty of Mathematics and Natural Sciences, IPB University, Bogor, Indonesia

  • Annisa Annisa,

    Roles Methodology, Supervision, Writing – review & editing

    Affiliation Department of Computer Science, Faculty of Mathematics and Natural Sciences, IPB University, Bogor, Indonesia

  • Dewi Anggraini Septaningsih,

    Roles Data curation, Methodology, Writing – review & editing

    Affiliation Department of Chemistry, Faculty of Military Mathematics and Natural Sciences, Republic of Indonesia Defense University, Bogor, Indonesia

  • Sandra Arifin Aziz,

    Roles Supervision, Writing – review & editing

    Affiliation Department of Agronomy and Horticulture, Faculty of Agriculture, IPB University, Bogor, Indonesia

  • Isnatin Miladiyah,

    Roles Conceptualization, Writing – review & editing

    Affiliation Faculty of Medicine, Islamic University of Indonesia, Indonesia

  • Siska Andrina Kusumastuti,

    Roles Data curation, Investigation, Methodology

    Affiliation Research Center for Pharmaceutical Ingredients and Traditional Medicine, National Research and Innovation Agency (BRIN), Bogor, Indonesia

  • Mochammad Arfin Fardiansyah Nasution,

    Roles Data curation, Investigation, Visualization

    Affiliation Department of Chemistry, Faculty of Mathematics and Natural Sciences, Universitas Indonesia, Depok, Indonesia

  • Donny Ramadhan,

    Roles Data curation, Investigation, Visualization

    Affiliation Research Center for Pharmaceutical Ingredients and Traditional Medicine, National Research and Innovation Agency (BRIN), Bogor, Indonesia

  • Wisnu Ananta Kusuma

    Roles Conceptualization, Methodology, Supervision, Writing – review & editing

    ananta@apps.ipb.ac.id

    Affiliations Tropical Biopharmaca Research Center, IPB University, Bogor, Indonesia, Department of Computer Science, Faculty of Mathematics and Natural Sciences, IPB University, Bogor, Indonesia

Abstract

Obesity has become a global issue that affects the emergence of various chronic diseases such as diabetes mellitus, dysplasia, heart disorders, and cancer. In this study, an integration method was developed between the metabolite profile of the active compound of Murraya paniculata and the exploration of the targeting mechanism of adipose tissue using network pharmacology, molecular docking, molecular dynamics simulation, and in vitro tests. Network pharmacology results obtained with the skyline query technique using a block-nested loop (BNL) showed that histone acetyltransferase p300 (EP300), peroxisome proliferator-activated receptor gamma (PPARG), and peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PPARGC1A) are potential targets for treating obesity. Enrichment analysis of these three proteins revealed their association with obesity, thermogenesis, energy metabolism, adipocytokines, fat cell differentiation, and glucose homeostasis. Metabolite profiling of M. paniculata leaves revealed sixteen active compounds, ten of which were selected for molecular docking based on drug-likeness and ADME results. Molecular docking results between PPARG and EP300 with the ten active compounds showed a binding affinity value of ≤ -5.0 kcal/mol in all dockings, indicating strong binding. The stability of the protein-ligand complex resulting from docking was examined using molecular dynamics simulations, and we observed the best average root mean square deviation (RMSD) of 0.99 Å for PPARG with trans-3-indoleacrylic acid, which was lower than with the native ligand BRL (2.02 Å). Furthermore, the RMSD was 2.70 Å for EP300 and the native ligand 99E, and the lowest RMSD with the ligand (1R,9S)-5-[(E)-2-(4-Chlorophenyl)vinyl]-11-(5-pyrimidinylcarbonyl)-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one was 3.33 Å. The in vitro tests to validate the potential of M. paniculata in treating obesity showed that there was a significant decrease in PPARG and EP300 gene expressions in 3T3-L1 mature adipocytes treated with M. paniculata ethanolic extract starting at concentrations 62.5 μg/ml and 15.625 μg/ml, respectively. These results indicate that M. paniculata can potentially treat obesity by disrupting adipocyte maturation and influencing intracellular lipid metabolism.

Introduction

In 2016, 1.9 billion adults over the age of 18 (39%) were overweight worldwide, and 650 million (13%) were in the obesity category; this figure tripled compared to 1975. The incidence of overweight and obesity in children and adolescents (aged 5–19 years) is 350 million (18%), and this percentage has increased dramatically from 4% (1975) to 18% (2016) [1]. In 2030, this figure is expected to be 2.16 billion for overweight cases and 1.12 billion for obesity cases [2]. Obesity contributes significantly to the incidence of various diet-related chronic diseases, including diabetes mellitus, dyslipidemia, heart and blood vessel disorders, organ fat, and several other disorders, including cancer. Overweight and obesity occur because of excessive fat accumulation in adipose tissue due to an energy imbalance, in which the energy consumed is higher than that expended [3]. The global pandemic of overweight and obesity and its relationship with energy imbalance requires a deeper understanding of the role of adipose tissue in regulating energy metabolism.

In recent years, the adipose tissue has become a central focus in studying energy-related metabolic disorders because it plays a significant role in the interactions between nutrition, health [4], metabolism, inflammation [5], and energy balance [4, 5]. The adipose tissue is also important for regulating glucose levels, lipid homeostasis, and body weight [6, 7]. The two large adipose tissues are white adipose tissue (WAT) and brown adipose tissue (BAT) [6, 8]. WAT stores excess energy as fat, whereas BAT removes excess fat in the form of energy [6]. Obesity can cause WAT dysfunction in calorie storage due to excess nutrition. Adipose tissue expansion is caused by an increase in the number of adipocytes (hyperplasia) and their size (hypertrophy) [9]. Massive expansion of adipose tissue in obesity impacts on blood vessel dysfunction and cardiovascular disease [10]. In addition, excess nutrition in obesity will induce an increased accumulation of ectopic lipids called lipotoxicity [9].

Various approaches, including the use of herbal plants, have been utilized to treat obesity. Kemuning (Murraya paniculata) is an herbal plant native to the Andaman Islands, Assam, Bangladesh, the Bismarck Archipelago, Borneo, Cambodia, South-Central China, Southeast China, Christmas Island, Eastern Himalayas, Hainan, Java, Laos, Lesser Sunda Is., Malaya, Maluku, Myanmar, Nepal, New Guinea, New South Wales, Northern Territory, Philippines, Queensland, Solomon Island, Sri Lanka, Sulawesi, Sumatra, Taiwan, Thailand, Vanuatu, Vietnam, Western Himalayas, and Western Australia [11]. This plant has various pharmacological activities, including anti-obesity [1214], analgesic [1517], anti-inflammatory [15, 17, 18], antioxidant [1921], anti-diarrheal [18], anti-bacterial [2224], and anti-hyperglycemic effects [25]. M. paniculata is reported to contain flavonoids [2629], coumarins [3033], alkaloids, saponins, and tannins [34].

The anti-obesity effect of M. paniculata has been reported by Suwandi et al., who administered an ethanol extract of M. paniculata leaves at doses of 200, 400, and 800 mg/kg to mice that had been subcutaneously induced with monosodium L-glutamate (2 g/kg) for five days and high-carbohydrate diets, and showed inhibited body weight gain. An effective dose of 200 mg/kg inhibited body weight gain by 109.28% [12]. Other studies on the anti-obesity activity of M. paniculata, based on its ability to inhibit pancreatic lipase activity, showed that 100 ppm of M. paniculata water extract had an inhibitory effect of 25.66% [13].

Although M. paniculata has been widely studied as an anti-obesity agent, no comprehensive studies have explored the mechanism of M. paniculata as an anti-obesity agent using a network pharmacological and in vitro assay approach. This study aimed to answer these questions by investigating the mechanism of active compounds found in M. paniculata using a metabolomic approach and by screening target proteins associated with obesity using a network pharmacology approach. The results were validated using molecular docking, molecular dynamics simulations, and in vitro tests. In vitro tests used 3T3-L1 pre-adipocytes, which are model cells from white adipose tissue, to observe the effect of M. paniculata on adipose tissue development.

This network pharmacology approach has been widely used to investigate the potential of bioactive compounds from natural products and determine their therapeutic capability in certain diseases [35, 36]. In addition to using the network pharmacology approach, one of the contributions of this study is the application of skyline queries, a technique used in constrained optimization problems, to the domain of protein-protein interaction networks, especially in protein target selection. Using this technique, we identified the significant protein targets that were used to screen for potential compounds in M. paniculata.

Material and methods

Network pharmacology

Screening of protein targets.

The protein targets were screened based on the disease and active compounds of M. paniculata. Protein targets associated with obesity were obtained from the OMIM database (https://www.omim.org/) [37]. Data were collected via web scrapping using Python 3.9 programming language [38]. The input keywords were "+Brown+Adipose+Tissue".

The protein targets related to the active compounds were collected from the IJAH Analytics database (http://ijah.apps.cs.ipb.ac.id/) [39] using the keyword "Murraya paniculata" as the search input. This database contains plant data, most of which are from Indonesia, and compounds, target proteins, and their interactions were obtained from PubChem (https://pubchem.ncbi.nlm.nih.gov/) and UniProt (https://www.uniprot.org/). In addition, protein targets were filtered based on active compounds obtained from the STITCH database (http://stitch.embl.de/) [40]. The input entered was in the form of SMILES data from the active compounds and was limited to the "Homo sapiens" category.

Construction of protein-protein interaction (PPI) network.

Targets obtained from the OMIM and STITCH databases were combined, and protein interactions were constructed using STRING (https://string-db.org/) [41]. The parameters used to search for the PPI data were the network-type full STRING network and a medium confidence score of 0.400.

Protein interactions obtained from the STRING database were analyzed using Cytoscape [42]. Subgraphs that do not interact with the main graph were omitted, and the data were transformed into a skyline query domain. Data transformation into a skyline query domain was carried out using centrality measures, which is one way to measure the influential nodes. The centrality measures used included degree, betweenness, closeness, bridging, radiality, and eigenvector centralities. Data transformation was carried out using the CentiScaPe2.2 tool in the Cytoscape application.

Selecting target protein using skyline query technique.

A skyline query is a widely recognized technique for selecting a limited number of dominant objects. Based on the skyline concept, a significant protein in an interaction network is considered a non-dominant protein. A protein, p, is considered to dominate another protein, q, if, in each of the degree centrality values, p is either equal to or better than q and in at least one degree centrality, p is superior to q. A skyline query fetches a collection of proteins that are not dominated by another.

For example, proteins a, b, c, d, e, f, and g were mapped to two centrality values, where for both values, the better one was the larger value. In Fig 1, it can be observed that based on these two centrality values, protein d dominates proteins e, c, and b, protein f dominates proteins c and b, and protein g dominates proteins b and a. Proteins d, f, and g do not mutually dominate each other, and none of the proteins can dominate all three. Based on these two centrality values, significant proteins were identified as d, f, and g.

thumbnail
Fig 1. Example of skyline query for proteins.

https://doi.org/10.1371/journal.pone.0305544.g001

The block-nested loop (BNL) algorithm is a common approach for implementing skyline queries. This involves the use of nested loops to compare and identify non-dominated points. The “Dominates” function in the BNL is used to determine whether one point dominates another. The skyline query function then iterates through each point in the dataset and compares it with all the other points using nested loops. If a point is not dominated by any other point, it is added to the skyline. Fig 2 shows the pseudocode of the BNL algorithm for obtaining the skyline points.

thumbnail
Fig 2. Pseudocode of block-nested loop (BNL).

https://doi.org/10.1371/journal.pone.0305544.g002

Enrichment analysis

Enrichment analysis was performed by analyzing gene ontology (GO) and pathways. GO provides information related to gene function and products. GO is divided into three ontologies: molecular functions, biological processes, and cell components. Molecular functions are activities that occur at the molecular level and are regulated by gene products. Biological processes occur via various molecular mechanisms. Cell components are the relative locations in the cell structure where gene products carry out their activities [43]. The Reactome [44], Bioplanet [45], and Kyoto Encyclopedia of Genes and Genomes [46] pathways were analyzed. GO and pathway analyses were performed using the web-based application Enrichr (https://maayanlab.cloud/Enrichr/) [47]. Enrichment results were visualized using SRPlot [48] (https://www.bioinformatics.com.cn/en).

Metabolite profiling

M. paniculata leaves extract.

M. paniculata leaves were obtained from Cikabayan Experimental Garden, Tropical Biopharmaca Research Center, IPB University. 1 g of Simplicia from M. paniculata leaves was weighed and extracted using 10 ml of water, 50% ethanol, and 100% ethanol using the sonication method for 30 min, left for 30 min, and sonicated again for 30 min. The mixture was sonicated for 1 h and filtered. The resulting filtrate was filtered with a 0.22 μm nylon membrane.

LC-MS analysis of M. paniculate.

The metabolite profile of M. paniculata leaves was determined using an ultra-high-performance liquid chromatography-tandem Q Extractive Plus Orbitrap HRMS (Thermo Scientific, Munich, Germany). The Accucore C18 column (100 mm × 2.1 μm, particle size, 1.5 μm, Thermo Scientific™, Waltham, MA, USA) was set to 30°C. The mobile phases were 0.1% formic acid in water (A) and 0.1% formic acid in acetonitrile (B) at a flow rate of 0.2 mL/min. The gradient system used was as follows: 0–1 min (5% B), 1–15 min (5–45% B), 15–25 min (45–95% B), 25–28 min, (95%B), 28–33 min (5%B). The MS system settings were m/z = 100−1500 (mass range), resolution = 70,000, and AGC target = 1× × 105. The MS2 system settings were as follows: resolution = 17,500, AGC target, 1× × 105; and (N)CE, 18, 35, and 53. The analysis was conducted in positive ionization mode, with a sheath gas flow rate of 35, auxiliary gas flow rate of 15, sweep gas flow rate of 0, spray voltage of 3.8 KV, capillary temperature of 320°C, S-lens RF level of 50, and auxiliary gas heater temperature of 38°C. The sample (2 μL) was injected into the LC HRMS.

Drug-likeness and ADME prediction

SwissADME (http://www.swissadme.ch/) [49] was used to obtain Lipinski’s rule of five, GI absorption, and ligand bioavailability scores. Ligands were obtained from the metabolite profiles of the M. paniculata leaves. Compounds that met the requirements of Lipinksi’s rule of five [50] and had high GI absorption and bioavailability of > 0.3 were chosen for molecular docking [51].

Molecular docking

Crystal structures of peroxisome proliferator-activated receptor gamma (PPARG) (PDB ID: 7AWC) [52] and histone acetyltransferase p300 (EP300) [53] (PDB ID: 5NU5) were obtained from the RCSB Protein Data Bank (https://www.rcsb.org/) [54]. The 3D structures of the ligands were retrieved from PubChem (https://pubchem.ncbi.nlm.nih.gov/) [55]. The 3D structure of the ligands was then optimized using Avogadro2 software [56]. Proteins and ligands were prepared using AutoDockTools [57] by deleting all water molecules and adding hydrogen bonds. The location of the binding site was determined based on the positions of native ligands in the crystal structure. The grid box was adjusted to 20 × 20 × 20 (x-, y-, and z-axes). Molecular docking was performed using AutoDock Vina [58, 59] in AutoDockTools. The docking results were visualized using PyMOL (https://pymol.org/2/) [60] for 3D visualization and BIOVIA Discovery Studio [61] for 2D interactions.

Molecular dynamics simulations

The stability of the protein-ligand complexes formed in earlier docking studies was further examined using molecular dynamics (MD) simulations. Molecular dynamics simulations were carried out using a Dell Precision 5820 Tower X-Series with an Ubuntu 20.04 (Focal Fossa) 64-bit operating system, Intel® Core™ i9-10900X CPU @ 4.60 GHz × 20 processors, 62.5 GiB memory, and an NVIDIA® Quadro RTX™ 8000 graphics card. The GROMACS 2023.02 software [62, 63] was used for this purpose. Before initiating the MD simulation, both PPARG and EP300 enzyme structures had their N- and C-termini manually capped with ACE and NME, respectively, utilizing Chimera v1.15 software [64]. Additionally, the topologies of the ligands from previous docking results and the standard ligands for each enzyme (BRL and 99E for PPARG and EP300, respectively) were generated using Gaussian03 software [65]. The AMBER ff98SB-ILDN force field [66] was employed for the system parameterization. This was followed by box preparation, adding ligands to the system, solvent addition using TIP3P water, and neutralizing the system by adding Na+ and Cl-. Subsequently, two iterations of energy minimization were conducted, followed by an equilibration run comprising 100 ps of the NVT simulation and 100 ps of the NPT simulation at 300 K. Finally, a production run of 100 ns at 300 K was performed with a time step of 2 fs. For each ligand-protein system, root mean square deviation (RMSD) and root mean square fluctuation (RMSF) analyses were conducted, focusing on the top three ligands in each system and their corresponding standard ligands.

In vitro testing

Cell lines and culture.

3T3-L1 preadipocyte cells were obtained from Elabscience (Texas, USA). Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, New York, USA) containing 1% penicillin/streptomycin (PS, 100 units of penicillin/mL and 100 pg streptomycin/mL; Gibco) and supplemented with 10% newborn calf serum (NBCS, Gibco). The cells were maintained at 37°C in a humidified atmosphere containing 5% CO2, and the medium was changed every 48 h.

3T3-L1 cell viability assay.

3T3-L1 preadipocytes were plated at 1.0 × 104 cells/well. The cells were treated with various concentrations (7.81–500 μg/mL) of M. paniculata ethanol extract and then incubated at 37°C in a humidified 5% CO2 atmosphere for 24 h. The viability of 3T3-L1 preadipocyte cells was assessed using a previously described 3-[4,5- dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT) assay protocol with slight modifications [67]. After the cells were incubated with 0.5 mg/ml MTT for 4h, 10% sodium dodecyl sulfate (SDS) was added to each well, followed by overnight incubation. Cell viability was measured at 540 nm using a microplate reader. Non-toxic concentrations of the extract were determined based on the viability assay results and used in subsequent experiments.

Coating the plates.

A 1.3% gelatin solution (Sigma Aldrich, Saint Louis, USA) was prepared in phosphate-buffered saline (PBS). Gelatin solution (2 ml) was transferred to each well of a 6-well cell culture plate, followed by incubation at 37°C for 1 h. After incubation, the plates were dried for 30 min and sterilized using an ultraviolet (UV) lamp for 15 min.

Differentiation of 3T3-L1 preadipocyte cells and the effect of M. paniculata ethanol extract on 3T3-L1 adipogenesis.

3T3-L1 preadipocyte cells were differentiated into mature adipocytes on a gelatin-coated 6-well plate using a previously described protocol with slight modifications [68]. Before 3T3-L1 preadipocytes were differentiated by induction agent, cells were incubated for 48h with various concentrations of M. paniculata ethanol extract (7.8, 15.625, 31.25, 62.5, and 125 μg/ml) or only the medium (for adipocyte control and preadipocyte control groups). Cells were induced with induction agent I (dexamethasone 0.25 μm, insulin 2 μg/mL, isobutyl-methylxanthine (IBMX) 0.5 mM, and Rosiglitazone 2 μM in DMEM supplemented by 10% fetal bovine serum (FBS) for 48 h at 37°C in a humidified 5% CO2 atmosphere, or only the medium (for preadipocytes control group). The medium was replaced, and the cells were treated with induction agent II (insulin 2 μg/mL in DMEM supplemented with 10% FBS) and incubated for 48 h. The medium was replaced every 2 d until droplets of lipids appeared at 70% confluency. These cells were used for further experiments.

Quantitative polymerase chain reaction (qPCR).

Total RNA was extracted from each group using Genezol, according to the manufacturer’s instructions (Geneaid Biotech Ltd., New Taipei, Taiwan). The mRNA levels of PPARG and EP300 were determined using quantitative polymerase chain reaction (qPCR) with a Sensifast SYBR No-ROX One-Step Kit Master Mix Kit (Bioline, London, United Kingdom) and analyzed using an Eco™ Real-Time PCR instrument (Illumina Inc., San Diego, USA). The following primers were used for the qPCR: PPARG, 5’ CCATTCACAAGAGCTGACCC 3’ (forward) and 5’ CCATAGTGGAAGCCTGATGC 3’ (reverse); EP300, 5’CTGATCCAGAGAAGCGCAAGC3’ (forward) and 5’ GCAGGATTTGCCTGACTGGC 3’ (reverse); GAPDH 5’-CGTCTTCACCACCATGGAGA 3’ (forward) and 5’-CGGCCATCACGCCACAGTTT -3’ (reverse). The qPCR reaction cycling parameters were as follows: 45°C for 10 min for reverse transcriptase activation, followed by a pre-incubation step at 95°C for 2 min and amplification for 40 cycles at 95°C for 5 sec, 55°C for 10 sec and 72°C for 5 sec. The relative expression ϪϪCq method was used to quantify gene expression, and GAPDH was used as a normalizer. All the samples were measured in duplicate.

Statistical analysis. The results were presented as mean ± standard deviation (SD). Statistical analysis was conducted using unpaired Student’s t-test and analysis of variance (ANOVA) followed by a post-hoc test. Statistical significance was set at p < 0.05.

Results

This study aimed to gain insights into the targets of obesity and the mechanisms of action of active compounds in M. paniculata in response to obesity (Fig 3).

thumbnail
Fig 3. The flow diagram of drug discovery research for obesity based on the integration of metabolite profiling, network pharmacology, molecular docking, molecular dynamics, and in-vitro tests.

https://doi.org/10.1371/journal.pone.0305544.g003

Network pharmacology

The targets obtained from OMIM were 114, whereas those from STITCH were 64 targets with 152 interactions, which were derived from the 76 active compounds of M. paniculata obtained from IJAH analytics (S9 Table). Protein interactions related to obesity, after expansion, included 952 proteins with 3416 interactions, whereas those related to the active compound, M. paniculata, after expansion, included 468 proteins with 2336 interactions. The resulting protein interactions were then combined, and duplicates were removed. The elimination of the duplicates resulted in 1332 proteins with 5196 interactions. Network pharmacology was visualized using Cytoscape software. An illustration of the relationship between obesity, the active compound M. paniculata from IJAH analytics, and the target proteins is shown in Fig 4.

thumbnail
Fig 4. Pharmacological network analysis of obesity–active compound M. paniculata–target proteins.

The pink octagon represents obesity (brown adipose tissue), the purple hexagon represents the herbal plant M. paniculata, the orange “V” sign represents the active compounds of M. paniculata, and the green circle represents the target proteins.

https://doi.org/10.1371/journal.pone.0305544.g004

Selecting protein target using skyline query

Network analysis in the form of centrality measures was performed on the target proteins, consisting of degree, betweenness, closeness, bridging, radiality, and eigenvector centralities. In this process, an undirected graph was used. In this study, we used the skyline query technique to obtain a set of dominant proteins from the graph.

The results of protein data processing using a skyline query showed that the three most significant proteins were EP300, PPARG, and peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PPARGC1A), as shown in Table 1.

thumbnail
Table 1. The results of the skyline query to process the potential target proteins.

https://doi.org/10.1371/journal.pone.0305544.t001

Enrichment analysis

Enrichment analyses of EP300, PPARGC1A, and PPARG were performed using the enrichment database. Gene Ontology (GO) data from the three targets included 257 biological processes, three cellular components, and 45 molecular functions. Based on GO biological process data, three proteins were found to play a role in fat cell differentiation, EP300 and PPARGC1A regulate gluconeogenesis, and PPARG and PPARGC1A play a role in glucose homeostasis. PPARG also plays a role in regulating adiponectin secretion, positive regulation of adipose tissue development, and regulation of adipose tissue development. The results of the cellular components showed the presence of the three proteins in the nucleus and intracellular membrane-bound organelles. Molecular function analysis showed that these three proteins are related to RNA polymerase II-specific DNA-binding transcription factor binding, DNA-binding transcription factor binding, and DNA binding. The top 10 GOs with the lowest p-values are presented in Fig 5, and the overall results are shown in S3S5 Tables.

thumbnail
Fig 5. Top 10 gene ontologies with the lowest p-value.

https://doi.org/10.1371/journal.pone.0305544.g005

The pathways for the three targets were as follows: 111 BioPlanet, 39 KEGG, and 126 Reactome. Based on the pathway from BioPlanet, the three targets were found to be involved in the PPAR-gamma coactivator role in obesity and thermogenesis; energy metabolism; transcriptional regulation of white adipocyte differentiation; lipid metabolism regulation by peroxisome proliferator-activated receptor alpha (PPAR-alpha); fatty acid, triacylglycerol, and ketone body metabolism; Huntington’s disease; CARM1 and regulation of the estrogen receptor; RORA activation of circadian expression; and developmental biology. PPARG and PPARGC1A are involved in adipogenesis. KEGG analysis showed that PPARG and PPARGC1A were related to the longevity regulating pathway, glucagon signaling pathway, AMPK signaling pathway, and thermogenesis. EP300 and PPARGC1A are related to the glucagon signaling pathway, and PPARGC1A is related to the adipocytokine signaling pathway. In the Reactome pathway, three proteins were found to be involved in the transcriptional regulation of white adipocyte differentiation: PPARA activates gene expression, regulation of lipid metabolism by PPARalpha, SUMO E3 ligases SUMOylate target proteins, SUMOylation, and metabolism of lipids. The top ten pathways with the lowest p-values are presented in Fig 6, and the overall results are shown in S6S8 Tables.

thumbnail
Fig 6. Top 10 pathways with the lowest p-value.

https://doi.org/10.1371/journal.pone.0305544.g006

Metabolite profiling

Using sonication, M. paniculata leaf samples were extracted with three different solvents: water, 50% ethanol, and ethanol. This method was chosen because it can increase the yield and quality of bioactive compounds contained in plants. Furthermore, extraction using this method can be performed at low temperatures in a short period, thereby minimizing the use of solvents. In this method, cavitation occurs by breaking down cell walls, thus expanding the solvent contact and yield [69]. Notably, polar and semi-polar solvents were used in this study. Ethanol was selected because it is commonly used for herbal plant extraction. The base peak chromatogram in positive ionization mode for the ethanol extract is shown in Fig 7. LC-MS results from M. paniculata leaf extract predicted 16 active compounds. These compounds are listed in S1 Table.

thumbnail
Fig 7. The base peak chromatogram in positive ionization mode for the ethanol extract of M. paniculata.

https://doi.org/10.1371/journal.pone.0305544.g007

Drug-likeness of the compounds

ADME parameters were used to determine the drug-likeness of M. paniculata leaf metabolites. The measurement results are listed in S2 Table. Lipinski’s rule of five is a physicochemical parameter consisting of molecular weight < 500 D, logP < 5, hydrogen bond donors < 5, and hydrogen bond acceptors < 10. This parameter refers to active compounds administered orally and is related to their solubility in water and permeability in the intestine [50]. The molar refractivity of the compounds was calculated, and values between 40–130 are considered ideal [70]. The selected compound must also have a high gastrointestinal absorption and bioavailability score of > 0.3 (30%) [51]. Based on the calculation results (S2 Table), only ten compounds were docked: (1R,9S)-5-[(E)-2-(4-Chlorophenyl)vinyl]-11-(5-pyrimidinylcarbonyl)-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one, alpha-lapachone, trans-3-indoleacrylic acid, DL-tryptophan, Hainanmurpanin, Murraol, Murralongin, Murrangatin, L-phenylalanine, and 4-aminobenzoic acid.

Molecular docking

Ten compounds from the drug-likeness calculations and two target proteins (PPARG and EP300) were selected for molecular docking using AutoDock Vina. Redocking was performed between the proteins and native ligands in the crystal structure. The binding affinity result was -8.8 kcal/mol for PPARG and its native ligand BRL, while that between EP300 and protein 99E was -8.4 kcal/mol. The grid box used for redocking was the benchmark for the docking compounds from M. paniculata leaves.

Molecular docking results showed that all binding affinities obtained were ≤ -5.0 kcal/mol, indicating that the ligands strongly bind with protein targets [71]. The best binding results for both PPARG and EP300 proteins were obtained with the ligands (1R,9S)-5-[(E)-2-(4-Chlorophenyl)vinyl]-11-(5-pyrimidinylcarbonyl)-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one, alpha-lapachone, and trans-3-indoleacrylic acid. Binding with (1R,9S)-5-[(E)-2-(4-Chlorophenyl)vinyl]-11-(5-pyrimidinylcarbonyl)-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one produced the highest binding affinities of -8.8 and -8.7 for PPARG and EP300, respectively, followed by alpha-lapachone with a binding affinity of -7.8 and -7.9 for PPARG and EP300, respectively, and finally trans-3-indoleacrylic acid with -6.9 and -6.6 for PPARG and EP300, respectively. The binding-affinity results are presented in Table 2. The 2D and 3D visualization results between proteins and all compounds are shown in the S1 File (PPARG) and S2 File (EP300).

thumbnail
Table 2. The binding affinity results of the ligands and protein targets.

https://doi.org/10.1371/journal.pone.0305544.t002

Molecular dynamics simulations

In MD simulations, RMSD and RMSF calculations are commonly employed to assess stability and conformational changes in ligands and proteins [72]. In this study, the top 10 ligands identified from the docking studies underwent 100-ns MD simulations to elucidate their binding interactions and refine the binding poses acquired from the initial docking studies. Among the ligands bound to PPARG, trans-3-Indoleacrylic acid exhibited the most stable behavior, with an average RMSD of 0.99 Å (Fig 8A). However, it is noteworthy that despite its overall stability, trans-3-Indoleacrylic acid experienced a transient increase in RMSD, averaging 2.14 Å between 70.62 ns and 75.70 ns. The next two ligands with the lowest average RMSD values were 4-aminobenzoic acid and (1R,9S)-5-[(E)-2-(4-chlorophenyl)ethenyl]-11-(pyrimidine-5-carbonyl)-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one, with values of 1.94 Å and 2.83 Å, respectively. Remarkably, the average RMSD values of trans-3-Indoleacrylic acid and 4-aminobenzoic acid are even lower than that of the native ligand, BRL, which recorded a value of 2.02 Å, indicating fewer changes in the overall structure during the simulation period for both ligands. Unlike trans-3-Indoleacrylic acid, there were no significant spikes in the RMSD values of 4-aminobenzoic acid or (1R,9S)-5-[(E)-2-(4-chlorophenyl)ethenyl]-11-(pyrimidine-5-carbonyl)-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one. In the EP300-ligands complexes, convergence of the RMSD was observed after 60 ns, as the RMSD values exhibited significant fluctuations beforehand. (1R,9S)-5-[(E)-2-(4-chlorophenyl)ethenyl]-11-(pyrimidine-5-carbonyl)-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one showed the most stable simulation system, having the lowest average RMSD value of 3.33 Å, slightly lower than the second most stable ligand, alpha-lapachone with 3.57 Å (Fig 8B). However, both ligands still had lower average RMSD values than native ligand 99E, which was 2.70 Å. The next ligand with the lowest average RMSD value was murrangatin, but the difference between the two preceding ligands was significant, with a value of 8.94 Å. Collective RMSD graphs of all ligands compared with the native ligands can be observed in the S3 File (PPARG) and S4 File (EP300).

thumbnail
Fig 8.

RMSD of the three best ligands compared to native ligands in ligand-PPARG (A) and ligand-EP300 (B) structures.

https://doi.org/10.1371/journal.pone.0305544.g008

RMSF analysis was conducted for both PPARG and EP300. As shown in Fig 9A, the RMSF plot for BRL exhibited higher average values than the other top three ligands, averaging 0.305 Å, while (1R,9S)-5-[(E)-2-(4-Chlorophenyl)vinyl]-11-(5-pyrimidinylcarbonyl)-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one, 4-aminobenzoic acid, and trans-3-indoleacrylic acid averaged 0.165 Å, 0.224 Å, and 0.179 Å, respectively. This suggests that all the standard ligands demonstrated greater stability during complex formation than the PPARG-BRL complex. However, the RMSF of both PPARG and the complex comprising 4-aminobenzoic acid and (1R,9S)-5-[(E)-2-(4-chlorophenyl)ethenyl]-11-(pyrimidine-5-carbonyl)-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one increased significantly, particularly at the Leu270-Gln271 residues. This is because the side chain of Gln271 tended to rotate, transitioning from facing away from the ligand to moving closer and establishing better interactions with the ligand. This phenomenon enhances ligand stability by effectively closing the binding pocket. Unlike PPARG, the disparity in the average RMSF for the top three ligands was not significantly different from that for the 99E ligand (Fig 9B). The average RMSF for (1R,9S)-5-[(E)-2-(4-chlorophenyl)ethenyl]-11-(pyrimidine-5-carbonyl)-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one, alpha-lapachone, and murrangetin was 0.147 Å, 0.156 Å, and 0.154 Å, respectively, compared to the 99E ligand (0.155 Å). Additionally, the peak surge at Gln1082 for the EP300-ligand complexes was triggered by the presence of the ligand at its binding site, which is in close proximity to the aforementioned residue. Consequently, in the EP300-alpha-lapachone complex, this peak was observed because of the loss of the alpha helix structure at that residue, leading to its destabilization and an increase in its RMSF. The RMSF graphs of PPARG and EP300 for all ligands and native ligand-bound structures are shown in the S5 and S6 Files.

thumbnail
Fig 9.

RMSF of PPARG (a) and EP300 (b) in the three best ligands and native ligand-bound structures.

https://doi.org/10.1371/journal.pone.0305544.g009

Viability assay of the M. paniculata extract on 3T3-L1 preadipocyte cells

The cytotoxicity of M. paniculata ethanolic extract was evaluated at various concentrations to determine its safe concentrations. 3T3-L1 preadipocyte cells treated with extract at concentrations up to 125 μg/ml showed no differences in the percentage of cell viability compared to untreated cells (Fig 10), suggesting that M. paniculata extract is safe for 3T3-L1 preadipocyte cells up to a concentration of 125 μg/ml.

thumbnail
Fig 10. 3T3-L1 cell viability after treatment with M. paniculata ethanolic extract.

Assays were conducted in three-independent experiments. Values are expressed as means ± SD. *p < 0.05, vs. Untreated.

https://doi.org/10.1371/journal.pone.0305544.g010

M. paniculata ethanolic extract decreased adipocyte differentiation in 3T3-L1 adipocyte cells

Adipogenesis leads to the accumulation of excess fat in adipocytes during the adipocyte differentiation process [73]. Several important factors involving the cascade of adipocyte differentiation have been discovered, including the transcription factors CCAAT/enhancer binding protein alpha (C/EBPα) and peroxisome proliferator-activated receptor gamma (PPARG) [74]. Activation of PPARG need coactivator recruitment including CREB-binding protein (CBP), histone acetyltransferas p300 (EP300) and PPAR-binding protein (PBO) to initiates adipogenesis programs [75]. In this study, we determined the gene expression of PPARG and EP300 in 3T3-L1 adipocytes after treatment with M. paniculata ethanolic extracts for 48 h to explore the effect of the extract on 3T3-L1 differentiation. Fig 11A and 11B show that adipocyte control cells expressed higher levels of PPARG and EP300 mRNA than the control cells significantly, suggesting that adding an induction agent stimulated the differentiation of 3T3-L1 preadipocytes into mature adipocytes. Treated 3T3-L1 mature adipocytes with M. paniculata ethanolic extract for 48 h showed reduced gene expression of PPARG starting at a concentration of 62.5 μg/ml relative to adipocyte cells (Fig 11A). In addition, M. paniculata ethanolic extract also decreased EP300 mRNA expression in 3T3-L1 adipocytes significantly compared to adipocyte cells at all concentration extracts except 7.8 μg/ml as shown in Fig 11B. This result suggested that M. paniculata ethanolic extracts could reduce differentiation of pre-adipocyte 3T3-L1 into mature adipocyte after incubation for 48h as indicated by the mRNA expression of PPARG and EP300 in 3T3-L1 mature adipocyte.

thumbnail
Fig 11. Adipocyte differentiation in 3T3-L1 cells after treatment with M. paniculata ethanolic extract for 48h at various concentrations.

(A) PPARG mRNA and (B) EP300 mRNA expression levels. GAPDH was used as a normalizer. Values are the mean ± standard deviation (SD). #p < 0.05, vs. Control; *p < 0.05 vs adipocyte control.

https://doi.org/10.1371/journal.pone.0305544.g011

Discussion

Research into herbal medicines has increased in recent years. Various approaches have been used to uncover herbal potential, including the network pharmacology approach. Network pharmacology predicts the interactions between target proteins and drugs and their relationship with diseases [23, 7679]. This study used a network pharmacology approach with the skyline query technique and the block-nested loop (BNL) algorithm to obtain the dominant protein in the protein network from obesity and M. paniculata compounds. Network pharmacology research with skyline queries has been conducted, but it uses the top-k algorithm [80, 81], therefore, BNL is a new approach. The results of skyline query analysis showed that EP300, PPARG, and PPARGC1A were dominant and, therefore, have potential as targets for treating obesity. Enrichment analysis was performed to determine the functionality of these potential targets in the form of gene ontologies and pathways. Gene ontologies show target roles in fat cell differentiation, glucose homeostasis, and regulation of adipose tissue development. These pathways are potential targets for obesity, thermogenesis, energy metabolism, and adipocytokine signaling.

Metabolite profiling using LC-MS was performed to obtain the active compounds from M. paniculata leaves. Of the sixteen potentially active compounds, ten were filtered and selected based on their drug-likeness and ADME. The ten filtered compounds and their target proteins (PPARG and EP300) were simulated using molecular docking and molecular dynamics simulations to identify the bonding between the compounds and proteins.

Molecular dynamics simulations revealed that the best RMSD values with PPARG were for trans-3-indoleacrylic acid, 4-aminobenzoic acid, and (1R,9S)-5-[(E)-2-(4-Chlorophenyl)vinyl]-11-(5-pyrimidinylcarbonyl)-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one, while (1R,9S)-5-[(E)-2-(4-Chlorophenyl)vinyl]-11-(5-pyrimidinylcarbonyl)-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one, alpha-lapachone, and murrangatin were the EP300-ligands with the best RMSD value. The binding visualization results of the molecular docking between proteins and ligands are shown in S1 and S2 Files.

We also investigated the inhibitory effect of M. paniculata extract on adipocyte differentiation in preadipocyte 3T3-L1 cells. Lipid formation and adipogenesis were determined based on the expression of adipogenesis-inducing genes PPARG and EP300. Cells were induced with a cocktail reagent for 12 days, and the expression of PPARG and EP300 mRNA was significantly enhanced relative to that in undifferentiated 3T3-L1 cells. Preadipocyte 3T3-L1 cells treated with M. paniculata ethanolic extract at 62.5 and 125 μg/ml for 48 h decreased the PPARG gene expression significantly compared to adipocyte cells. On the other hand, M. paniculata ethanolic extract at a concentration of 15.625 μg/ml reduced the expression of EP300 genes, meaning that M. paniculata ethanolic extract treatment prevented the lipid formation or adipogenesis in pre-adipocyte by downregulating the expression of PPARG and EP300 genes in mature 3T3-L1 adipocytes. These results suggest that the treatment of M. paniculata extract inhibited adipocyte maturation and enhanced intracellular lipid metabolism by reducing the expression of genes involved in lipogenesis. This process led to decreased lipid accumulation and formation, ultimately causing anti-obesity effects.

Obesity is an adipose tissue dysfunction and can disrupt health [5, 7, 82, 83]. This has caused obesity to become an epidemic [5], which has worsened over the last 50 years [82]. Causes of obesity include genetics, lack of physical activity, insomnia, endocrine disorders, medications, excess carbohydrates, and decreased energy metabolism [82]. Obesity caused diabetes mellitus [7, 84, 85], hypertension [8688], cardiovascular disease [83, 8991], and dyslipidemia [92, 93].

The type of adipose tissue that is often associated with obesity is WAT. WAT is classified into two main depots: visceral adipose tissue (VAT) and subcutaneous adipose tissue (SAT). WAT is associated with metabolic and endocrine functions and plays a role in regulating energy homeostasis and insulin sensitivity [94]. Dysfunction of WAT causes obesity and contributes to the development of metabolic dysregulation [95, 96]. Dysfunction occurs due to an imbalance between energy intake and expenditure [97, 98] which is characterized by loss of adipose tissue expansion capacity, increased adipocyte hypertrophy, and changes in the secretory profile of adipose cells (macrophage accumulation and inflammation) [95, 96]. In this study, 3T3-L1 pre-adipocyte cells were used. Basal bioenergetic and gene expression profiles of 3T3-L1 adipocytes showed typical WAT. Differentiation of 3T3-L1 into mature adipocyte is a model of white adipocytes formation that is often used for anti-obesity in vitro studies [99].

Research on inhibiting adipogenesis from 3T3-L1 cells has been carried out using olvanil. PPARG, PREF1, and FABP4 are used as markers related to adipocyte maturation. The results showed a decrease in PPARG and FABP4 gene expression, while there was an increase in PREF1 gene expression. The in vitro study results demonstrated the olvanil effect inhibiting adipogenesis, reducing lipid accumulation and triglycerides in 3T3-L1 adipocytes [100]. This is in accordance with the research carried out, namely that there was downregulated PPARG expression in 3T3-L1 adipocytes.

To understand the role of E300 in adipogenesis, a study was carried out observing the pattern of histone butyrylation in 3T3L1 cells during adipogenesis. EP300-catalyzed increases in histone butyrylation were found during adipogenesis, so EP300-specific inhibition of butyrylation may lead to repression of adipogenesis [101]. The results of this study explain that the reduction in EP300 gene expression can be targeted to inhibit adipogenesis and be used to treat obesity.

PPARG is a ligand-dependent transcription factor that plays a role in adipogenesis and insulin sensitivity [102104]. PPARG is a key factor in regulating the differentiation of WAT and BAT. PPARG activated and bind to retinoid X receptor (RXR) to form PPARG-RXR heterodimer [105]. PPARG-RXR heterodimers are useful in adipocyte differentiation and adaptive thermogenesis (Fig 12). Dysregulation of PPARG has the potential to cause obesity due to its important role in adipogenesis and adipocyte gene expression. Research on PPARG expression shows that PPARG mRNA expression is most abundant in the serum of obese, diabetic, and non-diabetic patients. PPARG mRNA expression was positively correlated with body mass, waist circumference, and waist-to-hip ratio of obese patients. Treating obesity and type 2 diabetes with PPARG and RXR antagonists can reduce triglyceride content in white adipose tissue, increasing fatty acid burning and energy expenditure [105].

thumbnail
Fig 12. PPARG signaling pathway based on KEGG pathway [106].

https://doi.org/10.1371/journal.pone.0305544.g012

PPARG, activated by ligands, can induce the formation of brown (beige) fat genes in WAT. The formation of the brown fat gene is influenced by the activity of the histone-lysine N-methyltransferase PRDM16 pathway, which is a factor controlling the development of classical brown fat [107109]. Brown and beige fat are adipose tissues that play a central role in the pathology of obesity, namely, in thermogenesis [110]. The process of heat production consumes a large amount of energy. Therefore, increasing BAT activity is an attractive strategy for fighting obesity. Previous research has shown that increased BAT activity improves the metabolic profile in obesity, whereas decreased BAT activity is associated with increased adiposity and the incidence of metabolic syndrome [111]. BAT and WAT differ in the number and density of mitochondria, number and size of lipid droplets, and expression levels of uncoupling protein-1 (UCP). Additionally, it plays a major role in thermogenesis (heat production). UCP-1 is mainly located in the inner mitochondria, where it converts chemical energy into heat energy. This functional property of the thermogenic adipocytes protects animals from hypothermia during hibernation [6].

Based on our results, the binding between PPARG and the native ligand occurs via a hydrogen bond at the amino acids Tyr473, Ser289, and His323; hydrophobic interactions at Arg288, Leu330, and Cys285; and pi-sulfur bonds at Cys285 and Met364. Previous research using the PPARG protein structure showed that the binding site between the PPARG protein and the ligand consists of a canonical orthosteric interaction with Tyr473, which is included in the activation function of helix 12, and an allosteric interaction with Arg288 [52]. Molecular docking of the active compound of M. paniculata showed hydrophobic interactions with Arg288 by several ligands, including (1R,9S)-5-[(E)-2-(4-chlorophenyl)ethenyl]-11-(pyrimidine-5-carbonyl)-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one, alpha-lapachone, DL-tryptophan, Hainanmurpanin, L-phenylalanine, Murrangatin, Murraol, and trans-3-indoleacrylic acid.

EP300 is a histone acetyltransferase (HAT) that encodes the proteins involved in transcriptional regulation [112]. EP300 influences the development of adipose tissue, promoting the expression of genes related to adipogenesis via histone acetylation [101]. EP300 is also a key mediator of cellular homeostasis [113], making it an essential therapeutic target for obesity. Obesity is a metabolic disorder affecting metabolic organs, including the liver, which regulates lipid and glucose homeostasis. Metabolic disorders are usually accompanied by an inflammatory response that can cause liver disease [114]. Based on a study conducted by Bricambert et al. (2010), EP300 is responsible for the development of hepatic steatosis in obesity and type 2 diabetes [115].

Histone acetyltransferases (HATs), also known as bromodomains, play a role in the acetylation of lysine residues in histone tails [116]. Two conserved amino acid residues in the binding pocket of the bromodomain, Asn and Tyr, interact to introduce lysine acetate [117]. The results of molecular docking showed that the binding of EP300 and the ligand consisted of hydrogen bonds (Pro1074 and Asn1132), hydrophobic interactions (Leu1084, Leu1083, Val1079, Val1138, and Val1128), and pi-donor hydrogen bonds (Asn1132 and Phe1075). Studies using the crystal structure of the protein have shown that XDM-CBP binds to the ligand at residues Arg1137, Pro1074, Asn 1132, Leu 1084, Val1079, Tyr1089, Gln1077, Phe1075, and Ile1086 [117]. Binding to the Asn1132 residue is observed in several active compounds, including (1R,9S)-5-[(E)-2-(4-chlorophenyl)ethenyl]-11-(pyrimidine-5-carbonyl)-7,11-diazatricyclo [7.3.1.02,7]trideca-2,4-dien-6-one, 4-aminobenzoic acid, DL-tryptophan, l-phenylalanine, murraol, and trans-3-indoleacrylic acid. Here, we used metabolite profiling, network pharmacology, and molecular docking approaches to target obesity-related proteins using M. paniculata active compounds.

Several studies have investigated the effects of EP300 on adipogenesis and lipid metabolism. For example, C646, a CBP/p300 inhibitor, has been shown to reduce adiposity in zebrafish larvae, block proliferation, cause cell cycle arrest, and stimulate differentiation of adipose-derived stem cells in goats [118]. A reduction in EP300 expression following the administration of C646 has been reported. We found that C646 suppressed IRS1/2 acetylation and triggered IRS1/2 membrane translocation, thus activating the insulin signaling pathway. C646 increases IR beta activity, binds IRS, and triggers IRS tyrosine phosphorylation. This regulation causes the activation of Pi3K-AKT signaling, suppresses glucose production in the liver, and improves hyperglycemia. These results demonstrate the importance of epigenetic factors in the pathology of metabolic disorders, including obesity and diabetes mellitus [119].

The results of this study also strengthen the findings regarding the role of epigenetics, especially EP300, in metabolic dysfunction related to adipogenesis. Various internal and external factors influence adipocyte function and differentiation. Individual genetic and environmental factors cause changes in the metabolism of the body, which in turn change the epigenetic profile, resulting in changes in gene expression and triggering obesity. Adipocyte function and differentiation are influenced by CBP/p300, a super-enhancer epigenomic regulator that controls chromatin landscaping during this process [120].

A HAT inhibitor, curcumin (diferuloylmethane), from Curcuma longa roots, has been shown to specifically inhibit HAT activity in CBP/E300. Administration of curcumin to mice fed with a high-fat diet (HFD) and induced diabetes improved the glycemic status and insulin sensitivity, reduced NF-kB in the liver, reduced macrophage infiltration into WAT, and increased adiponectin production [121]. Long-term administration of curcumin also causes HFD-induced obesity and insulin resistance in mice by suppressing inflammatory responses due to adiposity and hepatic lipogenesis [122].

M. paniculata is an herbal plant with potential as an anti-obesity drug [23, 123, 124]. M. paniculata leaf extract can reduce the levels of glutamic oxaloacetic transaminase (SGOT) and glutamic pyruvic transaminase (SGPT) enzyme activity in obese patients [125]. Infusion of M. paniculata leaves for 15 days also reduced the body mass index (BMI) of obese patients [14].

Five coumarins in M. paniculata, namely, mexoticin (1), omphalocarpin (2), murrangatin (3), kimcuongin (4), and murracarpin (5), were isolated and characterized. Their structures were determined using ESI-MS, HR-ESI-MS, and NMR (1D and 2D). The inhibitory effects of the coumarins on soluble epoxide hydrolases were also investigated. Among them, coumarins (2–4) exhibited inhibitory activity against soluble epoxide hydrolase, with IC50 values of 2.2 ± 4.7, 13.9 ± 6.5, and 3.2 ± 4.5 μM, respectively. Kinetic analysis of the five coumarins revealed a noncompetitive enzymatic mode for compounds 3 and 4 and a combination of competitive and noncompetitive enzymatic modes for coumarin 2. Molecular modeling studies indicated that coumarin kimcuongin (4) demonstrated the most favorable binding profile within the active sites of human soluble epoxide hydrolases [124]. Cholesterol-related disorders have been linked to soluble epoxide hydrolases that play a significant role in the metabolism of cholesterol precursor metabolism [123]. In the present study, murrangatin was detected in the leaves of M. paniculata.

Apart from murrangatin, trans-3-indoleacrylic acid is a potential compound from M. paniculata with low binding affinity and RMSD values, as shown in the simulation results (Table 2 and Fig 8). Trans-3-indoleacrylic acid is a metabolite of tryptophan secreted by gut microbiota [126, 127]. Studies have reported that trans-3-indoleacrylic acid (indole-3-acrylic acid) levels are negatively correlated with body weight in mice supplemented with inulin by regulating the gut microbiota [127]. In addition, trans-3-indoleacrylic acid enhances anti-inflammatory responses [126]. Obesity is associated with inflammation, and gut microbial dysbiosis is closely related to obesity [128130].

Conclusion

In this study, we demonstrated the potential of Murraya paniculata in the treatment and management of obesity based on network pharmacology using the skyline query technique and the block-nested loop (BNL) algorithm. We integrated network pharmacology, metabolite profiling, molecular docking, molecular dynamics simulations, and in vitro tests to identify the possible mechanisms of action of these compounds. Integration analysis using a skyline query revealed three main targets, EP300, PPARG, and PPARGC1A, which are potential targets for fighting obesity. We revealed ten potential compounds of M. paniculata and performed molecular docking and molecular dynamics simulations. The results of our molecular docking study showed good binding between proteins and ligands, and molecular dynamics evidence showed the stability of trans-3-indoleacrylic acid, 4-aminobenzoic acid, and (1R,9S)-5-[(E)-2-(4-chlorophenyl)ethenyl]-11-(pyrimidine-5-carbonyl)-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one for PPARG, and (1R,9S)-5- [E-2-(4-chlorophenyl)ethenyl]-11-(pyrimidine-5-carbonyl)-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4- dien-6-one, alpha-lapachone, and murrangatin for EP300. The in vitro tests results confirmed that M. paniculata induced decrease in PPARG and EP300 mRNA expression in 3T3-L1 preadipocytes. This demonstrates the potential of M. paniculata to be developed as an alternative therapy for obesity. In addition, to our study showing the potency of M. paniculata in treating obesity, further research is needed to confirm the results using the standard analog drugs PPARG and EP300 and to measure lipid accumulation and expression in brown adipose tissue via in vitro assay.

Supporting information

S1 Table. Prediction results of active compounds in M. paniculata leaves using LC-MS.

https://doi.org/10.1371/journal.pone.0305544.s001

(PDF)

S2 Table. Results of drug-likeness of the compounds using SwissADME.

https://doi.org/10.1371/journal.pone.0305544.s002

(PDF)

S3 Table. Gene ontology: Biological processes of PPARG, EP300, ad PPARGC1A.

https://doi.org/10.1371/journal.pone.0305544.s003

(PDF)

S4 Table. Gene ontology: Cellular components of PPARG, EP300, ad PPARGC1A.

https://doi.org/10.1371/journal.pone.0305544.s004

(PDF)

S5 Table. Gene ontology: Molecular functions of PPARG, EP300, ad PPARGC1A.

https://doi.org/10.1371/journal.pone.0305544.s005

(PDF)

S6 Table. BioPlanet pathway of PPARG, EP300, ad PPARGC1A.

https://doi.org/10.1371/journal.pone.0305544.s006

(PDF)

S7 Table. KEGG pathway of PPARG, EP300, ad PPARGC1A.

https://doi.org/10.1371/journal.pone.0305544.s007

(PDF)

S8 Table. Reactome pathway of PPARG, EP300, ad PPARGC1A.

https://doi.org/10.1371/journal.pone.0305544.s008

(PDF)

S9 Table. Dataset of targets from OMIM and STITCH, and Murraya paniculata compounds from IJAH analytics.

https://doi.org/10.1371/journal.pone.0305544.s009

(PDF)

S1 File. Binding results of molecular docking between PPARG (7AWC) and ligands.

(A) Native ligand BRL, (B) (1R,9S)-5-[(E)-2-(4-chlorophenyl)ethenyl]-11-(pyrimidine-5-carbonyl)-7,11-diazatricyclo [7.3.1.02,7]trideca-2,4-dien-6-one, (C) 4-Aminobenzoic acid, (D) alpha-Lapachone, (E) DL-Tryptophan, (F) Hainanmurpanin, (G) L-Phenylalanine, (H) Murralongin, (I) Murrangatin, (J) Murraol, and (K) trans-3-Indoleacrylic acid.

https://doi.org/10.1371/journal.pone.0305544.s010

(PDF)

S2 File. Binding results of molecular docking between EP300 (5NU5) and ligands.

(A) Native ligand 99E, (B) (1R,9S)-5-[(E)-2-(4-chlorophenyl)ethenyl]-11-(pyrimidine-5-carbonyl)-7,11-diazatricyclo [7.3.1.02,7]trideca-2,4-dien-6-one, (C) 4-Aminobenzoic acid, (D) alpha-Lapachone, (E) DL-Tryptophan, (F) Hainanmurpanin, (G) L-Phenylalanine, (H) Murralongin, (I) Murrangatin, (J) Murraol, and (K) trans-3-Indoleacrylic acid.

https://doi.org/10.1371/journal.pone.0305544.s011

(PDF)

S3 File. The RMSD graphs of all ligands compared to the native ligands of PPARG.

https://doi.org/10.1371/journal.pone.0305544.s012

(PDF)

S4 File. The RMSD graphs of all ligands compared to the native ligands of EP300.

https://doi.org/10.1371/journal.pone.0305544.s013

(PDF)

S5 File. The RMSF graphs of PPARG in all ligand and native ligand-bound structures.

https://doi.org/10.1371/journal.pone.0305544.s014

(PDF)

S6 File. The RMSF graphs of EP300 in all ligand and native ligand-bound structures.

https://doi.org/10.1371/journal.pone.0305544.s015

(PDF)

Acknowledgments

We thank the Tropical Biopharmaca Research Center, IPB University, for supporting this research.

References

  1. 1. World Health Organization. Obesity and overweight. 2020.
  2. 2. Tam CS, Lecoultre V, Ravussin E. Brown adipose tissue: Mechanisms and potential therapeutic targets. Circulation. 2012;125: 2782–2791. pmid:22665886
  3. 3. McMillan AC, White MD. Induction of thermogenesis in brown and beige adipose tissues: Molecular markers, mild cold exposure and novel therapies. Curr Opin Endocrinol Diabetes Obes. 2015;22: 347–352. pmid:26313896
  4. 4. Szentirmai E, Kapas L. The role of the brown adipose tissue in β3-adrenergic receptor activation-induced sleep, metabolic and feeding responses. Sci Rep. 2017;7: 1–14. pmid:28424466
  5. 5. Guerreiro VA, Carvalho D, Freitas P. Obesity, Adipose Tissue, and Inflammation Answered in Questions. Journal of Obesity. Hindawi Limited; 2022. pmid:35321537
  6. 6. Wang S, Pan MH, Hung WL, Tung YC, Ho CT. From white to beige adipocytes: Therapeutic potential of dietary molecules against obesity and their molecular mechanisms. Food and Function. The Royal Society of Chemistry; 2019. pp. 1263–1279. pmid:30735224
  7. 7. Chait A, den Hartigh LJ. Adipose Tissue Distribution, Inflammation and Its Metabolic Consequences, Including Diabetes and Cardiovascular Disease. Frontiers in Cardiovascular Medicine. Frontiers Media S.A.; 2020. p. 522637. pmid:32158768
  8. 8. Cheng L, Wang J, Dai H, Duan Y, An Y, Shi L, et al. Brown and beige adipose tissue: a novel therapeutic strategy for obesity and type 2 diabetes mellitus. Adipocyte. 2021;10: 48. pmid:33403891
  9. 9. Longo M, Zatterale F, Naderi J, Parrillo L, Formisano P, Raciti GA, et al. Adipose Tissue Dysfunction as Determinant of Obesity-Associated Metabolic Complications. Int J Mol Sci. 2019;20. pmid:31085992
  10. 10. Koenen M, Hill MA, Cohen P, Sowers JR. Obesity, Adipose Tissue and Vascular Dysfunction. Circ Res. 2021;128: 951–968. pmid:33793327
  11. 11. Murraya paniculata (L.) Jack | Plants of the World Online | Kew Science. [cited 4 Dec 2023]. Available: https://powo.science.kew.org/taxon/urn:lsid:ipni.org:names:774441-1
  12. 12. Suwandi DW, Bahari J, Subarnas A. Aktivitas Antiobesitas Ekstrak Etanol Daun Kemuning (Murraya paniculata (L.) Jack) pada Tikus Betina Galur Wistar. J Sains dan Kesehat. 2023;5: 275–282.
  13. 13. Iswantini DYAH Silitonga RF, Martatilofa E Darusman LK. Zingiber cassumunar, Guazuma ulmifolia, and Murraya paniculata Extracts as Antiobesity: In Vitro Inhibitory Effect on Pancreatic Lipase Activity. HAYATI J Biosci. 2011;18: 6–10.
  14. 14. Sukohar A, Busman H, Kurniawaty E, Pangestu Catur MMS. Effect of Consumption Kemunings Leaf (Murraya Paniculata (L.) Jack) Infuse To Reduce Body Mass Index, Waist Circumference and Pelvis Circumference on Obese Patients. Int J Res Ayurveda Pharm. 2017;8: 75–78.
  15. 15. Narkhede MB, Ajmire P V, Wagh AE. Evaluation of antinociceptive and anti-inflammatory activity of ethanol extract of murraya paniculata leaves in experimental rodents. Int J Pharm Pharm Sci. 2012;4: 247–250. Available: https://www.researchgate.net/publication/280643990
  16. 16. Sharker SM, Shahid IJ, Hasanuzzaman M. Antinociceptive and bioactivity of leaves of Murraya paniculata (L.) Jack, Rutaceae. Rev Bras Farmacogn. 2009;19: 746–748.
  17. 17. Kumar Podder M, Das BN, Saha A, Ahmed M. Analgesic activity of bark of Murraya paniculata. Int J Med Med Sci. 2011;3: 105–108. Available: http://www.academicjournals.org/ijmms
  18. 18. Rahman MA, Hasanuzzaman M, Uddin N, Shahid IZ. Antidiarrhoeal and anti-inflammatory activities of Murraya paniculata (L.) Jack. Pharmacologyonline. 2010;3: 768–776.
  19. 19. Amanda KA, Mustofa S, Hamidi Nasution S. Potensi Ekstrak Kemuning (Murraya paniculata (L.) Jack) sebagai Antioksidan Review Efek Antioksidan pada Kemuning (Murraya paniculata (L.) Jack). Majority. 2019;8: 265–266.
  20. 20. Sonter S, Mishra S, Dwivedi MK, Singh PK. Chemical profiling, in vitro antioxidant, membrane stabilizing and antimicrobial properties of wild growing Murraya paniculata from Amarkantak (M.P.). Sci Rep. 2021;11: 9691. pmid:33963198
  21. 21. Jack L, Rohman A. Daya antioksidan ekstrak etanol Daun Kemu- ning (Murraya paniculata (L) Jack) secara in vitro Antioxidant potency of ethanolic extract of Kemuning. Maj Farm Indones. 2005;16: 136–140.
  22. 22. Wiyogo IO, Endraswari PD, Setiawati Y. Antibacterial Activity of Ethanol Extract of Kemuning (Murraya Paniculata) Against Klebsiella pneumoniae ESBL by In Vitro Test. Indones J Trop Infect Dis. 2021;9: 101.
  23. 23. da Silva FFA, Fernandes CC, Santiago MB, Martins CHG, Vieira TM, Crotti AEM, et al. Chemical composition and in vitro antibacterial activity of essential oils from murraya paniculata (L.) jack (rutaceae) ripe and unripe fruits against bacterial genera mycobacterium and streptococcus. Brazilian J Pharm Sci. 2020;56: 1–9.
  24. 24. Gautam MK, Gangwar M, Nath G, Rao C V., Goel RK. In-vitro antibacterial activity on human pathogens and total phenolic, flavonoid contents of Murraya paniculata Linn. leaves. Asian Pac J Trop Biomed. 2012;2: S1660–S1663.
  25. 25. Gautam MK, Gupta A, Rao C V, Goel RK. Antihyperglycemic and antioxidant potential of Murraya paniculata Linn. Leaves: a preclinical study. J Pharm Res. 2012;5: 1334–1337.
  26. 26. Liang H, Zhao M, Tu P, Jiang Y. Polymethoxylated flavonoids from Murraya paniculata (L.) Jack. Biochem Syst Ecol. 2020;93: 104162.
  27. 27. Zhang JY, Li N, Che YY, Zhang Y, Liang SX, Zhao MB, et al. Characterization of seventy polymethoxylated flavonoids (PMFs) in the leaves of Murraya paniculata by on-line high-performance liquid chromatography coupled to photodiode array detection and electrospray tandem mass spectrometry. J Pharm Biomed Anal. 2011;56: 950–961. pmid:21885228
  28. 28. Sangkaew A, Samritsakulchai N, Sanachai K, Rungrotmongkol T, Chavasiri W, Yompakdee C. Two Flavonoid-based compounds from murraya paniculata as novel human carbonic anhydrase isozyme II inhibitors detected by a resazurin yeast-based assay. J Microbiol Biotechnol. 2020;30: 552–560. pmid:31893608
  29. 29. Kinoshita T, Firman K. Highly oxygenated flavonoids from Murraya paniculata. Phytochemistry. 1996;42: 1207–1210.
  30. 30. Wu J, Liu K, Shi X. The anti-inflammatory activity of several flavonoids isolated from Murraya paniculata on murine macrophage cell line and gastric epithelial cell (GES-1). Pharm Biol. 2016;54: 868–881. pmid:26710980
  31. 31. Teshima N, Yamada H, Ju-Ichi M, Uji T, Kinoshita T, Ito C. Coumarins from Murraya paniculata var. zollingeri Endemic to the Timor Islands. Nat Prod Commun. 2015;10: 309–312. pmid:25920269
  32. 32. Aziz SSSA, Sukari MA, Rahmani M, Kitajima M, Aimi N, Ahpandi NJ. Koumarin daripada Murraya Paniculata (Rutaceae). Malaysian J Anal Sci. 2010;14: 1–5.
  33. 33. Wu TS. Coumarins from the leaves of Murraya paniculata. Phytochemistry. 1988;27: 2357–2358.
  34. 34. Putri A. Larvicidal activity of kemuning leaf extract (Murraya paniculata (L.) Jack) against dengue hemorrhagic fever vector. J Major. 2015;4.
  35. 35. Ekowati J, Tejo BA, Maulana S, Kusuma WA, Fatriani R, Ramadhanti NS, et al. Potential Utilization of Phenolic Acid Compounds as Anti-Inflammatory Agents through TNF-α Convertase Inhibition Mechanisms: A Network Pharmacology, Docking, and Molecular Dynamics Approach. ACS Omega. 2023;8: 46851–46868. pmid:38107968
  36. 36. Umar AH, Ratnadewi D, Rafi M, Sulistyaningsih YC, Hamim H, Kusuma WA. Drug candidates and potential targets of Curculigo spp. compounds for treating diabetes mellitus based on network pharmacology, molecular docking and molecular dynamics simulation. J Biomol Struct Dyn. 2023;41: 8544–8560. pmid:36300505
  37. 37. Online Mendelian Inheritance in Man O. McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, MD). [cited 10 Jan 2023]. Available: https://www.omim.org/
  38. 38. Harris CR, Millman KJ, van der Walt SJ, Gommers R, Virtanen P, Cournapeau D, et al. Array programming with NumPy. Nature. CreateSpace; 2020. pp. 357–362. pmid:32939066
  39. 39. Kusuma WA, Dewanto V, et al. IJAH Webserver. 2017 [cited 5 Dec 2023]. Available: https://ijah.apps.cs.ipb.ac.id/
  40. 40. Kuhn M, von Mering C, Campillos M, Jensen LJ, Bork P. STITCH: Interaction networks of chemicals and proteins. Nucleic Acids Res. 2008;36: D684–D688. pmid:18084021
  41. 41. Szklarczyk D, Gable AL, Nastou KC, Lyon D, Kirsch R, Pyysalo S, et al. The STRING database in 2021: Customizable protein-protein networks, and functional characterization of user-uploaded gene/measurement sets. Nucleic Acids Res. 2021;49: D605–D612. pmid:33237311
  42. 42. Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, et al. Cytoscape: A Software Environment for Integrated Models of Biomolecular Interaction Networks. Genome Res. 2003;13: 2498–2504. pmid:14597658
  43. 43. Carbon S, Dietze H, Lewis SE, Mungall CJ, Munoz-Torres MC, Basu S, et al. Expansion of the gene ontology knowledgebase and resources: The gene ontology consortium. Nucleic Acids Res. 2017;45: D331–D338. pmid:27899567
  44. 44. Gillespie M, Jassal B, Stephan R, Milacic M, Rothfels K, Senff-Ribeiro A, et al. The reactome pathway knowledgebase 2022. Nucleic Acids Res. 2022;50: D687–D692. pmid:34788843
  45. 45. Huang R, Grishagin I, Wang Y, Zhao T, Greene J, Obenauer JC, et al. The NCATS BioPlanet–An integrated platform for exploring the universe of cellular signaling pathways for toxicology, systems biology, and chemical genomics. Front Pharmacol. 2019;10. pmid:31133849
  46. 46. Kanehisa M, Furumichi M, Sato Y, Kawashima M, Ishiguro-Watanabe M. KEGG for taxonomy-based analysis of pathways and genomes. Nucleic Acids Res. 2022; 1–6. pmid:36300620
  47. 47. Chen EY, Tan CM, Kou Y, Duan Q, Wang Z, Meirelles G V., et al. Enrichr: Interactive and collaborative HTML5 gene list enrichment analysis tool. BMC Bioinformatics. 2013;14. pmid:23586463
  48. 48. SRplot—Science and Research online plot. [cited 2 Feb 2023]. Available: http://www.bioinformatics.com.cn/srplot
  49. 49. Daina A, Michielin O, Zoete V. SwissADME: A free web tool to evaluate pharmacokinetics, drug-likeness and medicinal chemistry friendliness of small molecules. Sci Rep. 2017;7: 1–13. pmid:28256516
  50. 50. Lipinski CA. Lead- and drug-like compounds: The rule-of-five revolution. Drug Discov Today Technol. 2004;1: 337–341. pmid:24981612
  51. 51. Hu X, Shao P, Liu X, Han L, Gui L, Cai Z, et al. Study on the Anti-Inflammatory Effect and Mechanism of Yuxuebi Tablet Based on Network Pharmacology. ACS Omega. 2022. pmid:36120030
  52. 52. Willems S, Gellrich L, Chaikuad A, Kluge S, Werz O, Heering J, et al. Endogenous vitamin E metabolites mediate allosteric PPARγ activation with unprecedented co-regulatory interactions. Cell Chem Biol. 2021;28: 1489–1500.e8. pmid:33989565
  53. 53. Hügle M, Lucas X, Ostrovskyi D, Regenass P, Gerhardt S, Einsle O, et al. Beyond the BET Family: Targeting CBP/p300 with 4-Acyl Pyrroles. Angew Chemie—Int Ed. 2017;56: 12476–12480. pmid:28766825
  54. 54. Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, et al. The Protein Data Bank. Nucleic Acids Research. 2000. pp. 235–242. pmid:10592235
  55. 55. Kim S, Chen J, Cheng T, Gindulyte A, He J, He S, et al. PubChem 2023 update. Nucleic Acids Res. 2023;51: D1373–D1380. pmid:36305812
  56. 56. Hanwell MD, Curtis DE, Lonie DC, Vandermeerschd T, Zurek E, Hutchison GR. Avogadro: An advanced semantic chemical editor, visualization, and analysis platform. J Cheminform. 2012;4: 1–17. pmid:22889332
  57. 57. Morris GM, Ruth H, Lindstrom W, Sanner MF, Belew RK, Goodsell DS, et al. Software news and updates AutoDock4 and AutoDockTools4: Automated docking with selective receptor flexibility. J Comput Chem. 2009;30: 2785–2791. pmid:19399780
  58. 58. Eberhardt J, Santos-Martins D, Tillack AF, Forli S. AutoDock Vina 1.2.0: New Docking Methods, Expanded Force Field, and Python Bindings. J Chem Inf Model. 2021;61: 3891–3898. pmid:34278794
  59. 59. Trott O, Olson AJ. AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J Comput Chem. 2010;31: 455–461. pmid:19499576
  60. 60. The PyMOL Molecular Graphics System. PyMOL | pymol.org. [cited 7 Nov 2023]. Available: https://pymol.org/2/
  61. 61. BIOVIA Dassault Systèmes. BIOVIA Discovery Studio. 2021 [cited 7 Nov 2023]. Available: https://www.3ds.com/biovia
  62. 62. Van Der Spoel D, Lindahl E, Hess B, Groenhof G, Mark AE, Berendsen HJC. GROMACS: Fast, flexible, and free. Journal of Computational Chemistry. 2005. pp. 1701–1718. pmid:16211538
  63. 63. Kohnke B, Kutzner C, Grubmüller H. A GPU-Accelerated Fast Multipole Method for GROMACS: Performance and Accuracy. J Chem Theory Comput. 2020;16: 6938–6949. pmid:33084336
  64. 64. Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC, et al. UCSF Chimera—A visualization system for exploratory research and analysis. J Comput Chem. 2004;25: 1605–1612. pmid:15264254
  65. 65. Frisch MJ, Trucks GW, Schlegel HB, Scuseria GE, Robb MA, Cheeseman JR, et al. Gaussian 03, Revision C.02. Wallingford, CT: Gaussian Inc.; 2004.
  66. 66. Lindorff-Larsen K, Best RB, DePristo MA, Dobson CM, Vendruscolo M. Simultaneous determination of protein structure and dynamics. Nature. 2005;433: 128–132. pmid:15650731
  67. 67. Twentyman PR, Luscombe M. A study of some variables in a tetrazolium dye (MTT) based assay for cell growth and chemosensitivity. Br J Cancer. 1987;56: 279–85. Available: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2002206&tool=pmcentrez&rendertype=abstract pmid:3663476
  68. 68. Kusumastuti SA, Nugrahaningsih DAA, Wahyuningsih MSH. Centella asiatica (L.) extract attenuates inflammation and improve insulin sensitivity in a coculture of lipopolysaccharide (LPS)-induced 3T3-L1 adipocytes and RAW 264.7 macrophages. Drug Discov Ther. 2019;13: 261–267. pmid:31723097
  69. 69. Sanjaya YA, Tola PS, Rahmawati R. Ultrasound-assisted Extraction as a Potential Method to Enhanced Extraction of Bioactive Compound. 2022;2022: 191–198.
  70. 70. Ghose AK, Viswanadhan VN, Wendoloski JJ. A knowledge-based approach in designing combinatorial or medicinal chemistry libraries for drug discovery. 1. A qualitative and quantitative characterization of known drug databases. J Comb Chem. 1999;1: 55–68. pmid:10746014
  71. 71. Jin J, Chen B, Zhan X, Zhou Z, Liu H, Dong Y. Network pharmacology and molecular docking study on the mechanism of colorectal cancer treatment using Xiao-Chai-Hu-Tang. PLoS One. 2021;16. pmid:34125845
  72. 72. Ejaz SA, Aziz M, Zafar Z, Akhtar N, Ogaly HA. Revisiting the inhibitory potential of protein kinase inhibitors against NEK7 protein via comprehensive computational investigations. Sci Rep. 2023;13. pmid:36922575
  73. 73. Park M, Han J, Lee HJ. Anti-adipogenic effect of neferine in 3t3-l1 cells and primary white adipocytes. Nutrients. 2020;12: 1–12. pmid:32580414
  74. 74. Erickson RL, Hemati N, Ross SE, MacDougald OA. p300 Coactivates the Adipogenic Transcription Factor CCAAT/ Enhancer-binding Protein α. J Biol Chem. 2001;276: 16348–16355. pmid:11340085
  75. 75. Ma X, Wang D, Zhao W, Xu L. Deciphering the roles of PPARγ in adipocytes via dynamic change of transcription complex. Front Endocrinol (Lausanne). 2018;9: 1–10. pmid:30186237
  76. 76. Wu Y, Zhu Y, Xie N, Wang H, Wang F, Zhou J, et al. A network pharmacology approach to explore active compounds and pharmacological mechanisms of a patented Chinese herbal medicine in the treatment of endometriosis. PLoS One. 2022;17: 1–17. pmid:35130311
  77. 77. Song S, Zhou J, Li Y, Liu J, Li J, Shu P. Network pharmacology and experimental verification based research into the effect and mechanism of Aucklandiae Radix–Amomi Fructus against gastric cancer. Sci Rep. 2022;12: 1–30. pmid:35672352
  78. 78. Ma J, Li Y, Ji X, Wang A, Lan Y, Ma L. Integrating network pharmacology and experimental verification to explore the mechanisms of salidroside against myocardial fibrosis. Biochem Biophys Res Commun. 2023;677: 38–44. pmid:37544102
  79. 79. Zhang X, Shen T, Zhou X, Tang X, Gao R, Xu L, et al. Network pharmacology based virtual screening of active constituents of Prunella vulgaris L. and the molecular mechanism against breast cancer. Sci Rep. 2020;10: 1–13. pmid:32978480
  80. 80. Diansyah MR, Kusuma WA, Annisa A. Identification of significant protein in protein-protein interaction of Alzheimer disease using top-k representative skyline query. J Teknol dan Sist Komput. 2021;9: 126–132.
  81. 81. Diansyah MR, Annisa, Kusuma WA. Analysis using top-k skyline query of protein-protein interaction reveals alpha-synuclein as the most important protein in Parkinson s disease. Indones J Biotechnol. 2021;26: 197–205.
  82. 82. Panuganti KK, Nguyen M, Kshirsagar RK. Obesity. StatPearls. StatPearls Publishing; 2023. Available: https://www.ncbi.nlm.nih.gov/books/NBK459357/
  83. 83. Fuster JJ, Ouchi N, Gokce N, Walsh K. Obesity-induced changes in adipose tissue microenvironment and their impact on cardiovascular disease. Circulation Research. Lippincott Williams & Wilkins Hagerstown, MD; 2016. pp. 1786–1807. pmid:27230642
  84. 84. Yashi K, Daley SF. Obesity and Type 2 Diabetes. Handbook of Obesity—Volume 1: Epidemiology, Etiology, and Physiopathology, Fourth Edition. StatPearls Publishing; 2023. pp. 496–502. https://doi.org/10.1201/9781003437673-57
  85. 85. Al-Goblan AS, Al-Alfi MA, Khan MZ. Mechanism linking diabetes mellitus and obesity. Diabetes, Metab Syndr Obes. 2014;7: 587–591. pmid:25506234
  86. 86. Shariq OA, Mckenzie TJ. Obesity-related hypertension: A review of pathophysiology, management, and the role of metabolic surgery. Gland Surg. 2020;9: 80–93. pmid:32206601
  87. 87. Leggio M, Lombardi M, Caldarone E, Severi P, D’emidio S, Armeni M, et al. The relationship between obesity and hypertension: An updated comprehensive overview on vicious twins. Hypertension Research. Nature Publishing Group; 2017. pp. 947–963. pmid:28978986
  88. 88. Jiang SZ, Lu W, Zong XF, Ruan HY, Liu Y. Obesity and hypertension. Experimental and Therapeutic Medicine. Spandidos Publications; 2016. pp. 2395–2399. https://doi.org/10.3892/etm.2016.3667 pmid:27703502
  89. 89. Volpe M, Gallo G. Obesity and cardiovascular disease: An executive document on pathophysiological and clinical links promoted by the Italian Society of Cardiovascular Prevention (SIPREC). Front Cardiovasc Med. 2023;10: 1136340. pmid:36993998
  90. 90. Lopez-Jimenez F, Almahmeed W, Bays H, Cuevas A, Di Angelantonio E, le Roux CW, et al. Obesity and cardiovascular disease: mechanistic insights and management strategies. A joint position paper by the World Heart Federation and World Obesity Federation. Eur J Prev Cardiol. 2022;29: 2218–2237. pmid:36007112
  91. 91. Powell-Wiley TM, Poirier P, Burke LE, Després JP, Gordon-Larsen P, Lavie CJ, et al. Obesity and Cardiovascular Disease A Scientific Statement From the American Heart Association. Circulation. Lippincott Williams & Wilkins Hagerstown, MD; 2021. pp. E984–E1010. https://doi.org/10.1161/CIR.0000000000000973 pmid:33882682
  92. 92. Vekic J, Zeljkovic A, Stefanovic A, Jelic-Ivanovic Z, Spasojevic-Kalimanovska V. Obesity and dyslipidemia. Metabolism: Clinical and Experimental. MDText.com, Inc.; 2019. pp. 71–81. pmid:30447223
  93. 93. Klop B, Elte JWF, Cabezas MC. Dyslipidemia in Obesity: Mechanisms and Potential Targets. Nutrients. Multidisciplinary Digital Publishing Institute (MDPI); 2013. pp. 1218–1240. https://doi.org/10.3390/nu5041218 pmid:23584084
  94. 94. Pellegrinelli V, Carobbio S, Vidal-Puig A. Adipose tissue plasticity: how fat depots respond differently to pathophysiological cues. Diabetologia. 2016;59: 1075–1088. pmid:27039901
  95. 95. Santillana N, Astudillo-Guerrero C, D’Espessailles A, Cruz G. White Adipose Tissue Dysfunction: Pathophysiology and Emergent Measurements. Nutr 2023, Vol 15, Page 1722. 2023;15: 1722. pmid:37049561
  96. 96. Reyes-Farias M, Fos-Domenech J, Serra D, Herrero L, Sánchez-Infantes D. White adipose tissue dysfunction in obesity and aging. Biochem Pharmacol. 2021;192: 114723. pmid:34364887
  97. 97. Cuthbertson DJ, Steele T, Wilding JP, Halford JC, Harrold JA, Hamer M, et al. What have human experimental overfeeding studies taught us about adipose tissue expansion and susceptibility to obesity and metabolic complications? Int J Obes (Lond). 2017;41: 853–865. pmid:28077863
  98. 98. Schlögl M, Piaggi P, Pannacciuli N, Bonfiglio SM, Krakoff J, Thearle MS. Energy Expenditure Responses to Fasting and Overfeeding Identify Phenotypes Associated With Weight Change. Diabetes. 2015;64: 3680–3689. pmid:26185280
  99. 99. Morrison S, McGee SL. 3T3-L1 adipocytes display phenotypic characteristics of multiple adipocyte lineages. Adipocyte. 2015;4: 295. pmid:26451286
  100. 100. Curiel-Pedraza DA, Villaseñor-Tapia EC, Márquez-Aguirre AL, Morales-Martínez CE, Diaz-Vidal T, Basulto-Padilla GC, et al. Olvanil inhibits adipocyte differentiation in 3T3-L1 cells, reduces fat accumulation and improves lipidic profile on mice with diet-induced obesity. Food Chem Adv. 2023;3: 100438.
  101. 101. Bhattacharya A, Chatterjee S, Bhaduri U, Singh AK, Vasudevan M, Sashidhara K V., et al. Butyrylation Meets Adipogenesis-Probed by a p300-Catalyzed Acylation-Specific Small Molecule Inhibitor: Implication in Anti-obesity Therapy. J Med Chem. 2022;65: 12273–12291. pmid:36074919
  102. 102. Darwish NM, Gouda W, Almutairi SM, Elshikh MS, Morcos GNB. PPARG expression patterns and correlations in obesity. J King Saud Univ—Sci. 2022;34: 102116.
  103. 103. Lefterova MI, Haakonsson AK, Lazar MA, Mandrup S. PPARγ and the global map of adipogenesis and beyond. Trends in Endocrinology and Metabolism. NIH Public Access; 2014. pp. 293–302. https://doi.org/10.1016/j.tem.2014.04.001 pmid:24793638
  104. 104. Samarasinghe SP, Sutanto MM, Danos AM, Johnson DN, Brady MJ, Cohen RN. Altering PPARγ Ligand Selectivity Impairs Adipogenesis by Thiazolidinediones But Not Hormonal Inducers. Obesity (Silver Spring). 2009;17: 965. pmid:19165156
  105. 105. Yamauchi T, Waki H, Kamon J, Murakami K, Motojima K, Komeda K, et al. Inhibition of RXR and PPARγ ameliorates diet-induced obesity and type 2 diabetes. J Clin Invest. 2001;108: 1001. pmid:11581301
  106. 106. KEGG PATHWAY : PPAR signaling pathway—Homo sapiens (human). 2012 [cited 3 Apr 2024] p. 3320. Available: https://www.kegg.jp/pathway/hsa03320+H02106
  107. 107. Ohno H, Shinoda K, Spiegelman BM, Kajimura S. PPARγ agonists induce a white-to-brown fat conversion through stabilization of PRDM16 protein. Cell Metab. 2012;15: 395–404. pmid:22405074
  108. 108. Nedergaard J, Petrovic N, Lindgren EM, Jacobsson A, Cannon B. PPARγ in the control of brown adipocyte differentiation. Biochimica et Biophysica Acta—Molecular Basis of Disease. 2005. pp. 293–304. pmid:15949696
  109. 109. Gross B, Pawlak M, Lefebvre P, Staels B. PPARs in obesity-induced T2DM, dyslipidaemia and NAFLD. Nature Reviews Endocrinology. Nature Publishing Group; 2017. pp. 36–49. pmid:27636730
  110. 110. Qiu J, Zhang Z, Wang S, Chen Y, Liu C, Xu S, et al. Transferrin Receptor Functionally Marks Thermogenic Adipocytes. Front Cell Dev Biol. 2020;8: 1–17. pmid:33251209
  111. 111. Karlina R, Lutter D, Miok V, Fischer D, Altun I, Schöttl T, et al. Identification and characterization of distinct brown adipocyte subtypes in C57BL/6J mice. Life Sci Alliance. 2021;4: 1–19. pmid:33257475
  112. 112. Gayther SA, Batley SJ, Linger L, Bannister A, Thorpe K, Chin SF, et al. Mutations truncating the EP300 acetylase in human cancers. Nat Genet. 2000;24: 300–303. pmid:10700188
  113. 113. Wang X, Yan J. Directional divergence of Ep300 duplicates in teleosts and its implications. BMC Evol Biol. 2020;20. pmid:33129255
  114. 114. Yao W, Wang T, Huang F. P300/CBP as a Key Nutritional Sensor for Hepatic Energy Homeostasis and Liver Fibrosis. BioMed Research International. Hindawi Limited; 2018. pmid:29862292
  115. 115. Bricambert J, Miranda J, Benhamed F, Girard J, Postic C, Dentin R. Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice. J Clin Invest. 2010;120: 4316–4331. pmid:21084751
  116. 116. Ali I, Conrad RJ, Verdin E, Ott M. Lysine Acetylation Goes Global: From Epigenetics to Metabolism and Therapeutics. Chemical Reviews. 2018. pp. 1216–1252. pmid:29405707
  117. 117. Clegg MA, Tomkinson NCO, Prinjha RK, Humphreys PG. Advancements in the Development of non-BET Bromodomain Chemical Probes. ChemMedChem. 2019. pp. 362–385. pmid:30624862
  118. 118. Zhao J, Zhou A, Qi W. The Potential to Fight Obesity with Adipogenesis Modulating Compounds. Int J Mol Sci. 2022;23. pmid:35216415
  119. 119. Peng J, Ramatchandirin B, Wang Y, Pearah A, Namachivayam K, Wolf RM, et al. The P300 acetyltransferase inhibitor C646 promotes membrane translocation of insulin receptor protein substrate and interaction with the insulin receptor. J Biol Chem. 2022;298: 101621. pmid:35074429
  120. 120. Pant R, Firmal P, Shah VK, Alam A, Chattopadhyay S. Epigenetic Regulation of Adipogenesis in Development of Metabolic Syndrome. Front Cell Dev Biol. 2021;8: 619888. pmid:33511131
  121. 121. Weisberg SP, Leibel R, Tortoriello D V. Dietary curcumin significantly improves obesity-associated inflammation and diabetes in mouse models of diabesity. Endocrinology. 2008;149: 3549–3558. pmid:18403477
  122. 122. Shao W, Yu Z, Chiang Y, Yang Y, Chai T, Foltz W, et al. Curcumin prevents high fat diet induced insulin resistance and obesity via attenuating lipogenesis in liver and inflammatory pathway in adipocytes. PLoS One. 2012;7: 1–13. pmid:22253696
  123. 123. Domingues MF, Callai-Silva N, Piovesan AR, Carlini CR. Soluble Epoxide Hydrolase and Brain Cholesterol Metabolism. Frontiers in Molecular Neuroscience. Front Mol Neurosci; 2020. pmid:32063836
  124. 124. Khanh P, Spiga O, Trezza A, Kim Y, Cuong N. Coumarins Isolated from Murraya paniculata in Vietnam and Their Inhibitory Effects against Enzyme Soluble Epoxide Hydrolase (sEH). Planta Medica Int Open. 2017;3: e68–e71.
  125. 125. Sukohar A, Pasya AV, Soleha TU, Sangging PRA. The effect of kemuning leaves (Murraya paniculata (L.) Jack) infusion on SGOT and SGPT enzym activities in obese patients. Biomed Pharmacol J. 2017;10: 953–958.
  126. 126. Wlodarska M, Luo C, Kolde R, D’Hennezel E, Annand JW, Heim CE, et al. Indoleacrylic Acid Produced by Commensal Peptostreptococcus Species Suppresses Inflammation. Cell Host Microbe. 2017;22: 25–37.e6. pmid:28704649
  127. 127. Wu Z, Du Z, Tian Y, Liu M, Zhu K, Zhao Y, et al. Inulin accelerates weight loss in obese mice by regulating gut microbiota and serum metabolites. Front Nutr. 2022;9. pmid:36245535
  128. 128. Cussotto S, Delgado I, Anesi A, Dexpert S, Aubert A, Beau C, et al. Tryptophan Metabolic Pathways Are Altered in Obesity and Are Associated With Systemic Inflammation. Front Immunol. 2020;11: 557. pmid:32351500
  129. 129. Smith A, Gu Q, Amos-Abanyie EK, Tolley E, Lu L, Lyn-Cook B, et al. Abstract 3022: Tryptophan metabolism is associated with obesity and triple negative breast cancer risk in black and white women. Cancer Res. 2022;82: 3022–3022.
  130. 130. Lasselin J, Magne E, Beau C, Ledaguenel P, Dexpert S, Aubert A, et al. Adipose inflammation in obesity: Relationship with circulating levels of inflammatory markers and association with surgery-induced weight loss. J Clin Endocrinol Metab. 2014;99. pmid:24243638