Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Halofuginone prevents outer retinal degeneration in a mouse model of light-induced retinopathy

  • Yukihiro Miwa ,

    Contributed equally to this work with: Yukihiro Miwa, Deokho Lee, Chiho Shoda

    Roles Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Software, Validation, Writing – review & editing

    Affiliations Laboratory of Photobiology, Keio University School of Medicine, Tokyo, Japan, Department of Ophthalmology, Keio University School of Medicine, Tokyo, Japan, Aichi Animal Eye Clinic, Aichi, Japan

    ⨯
  • Deokho Lee ,

    Contributed equally to this work with: Yukihiro Miwa, Deokho Lee, Chiho Shoda

    Roles Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Software, Validation, Visualization, Writing – original draft, Writing – review & editing

    Affiliations Laboratory of Photobiology, Keio University School of Medicine, Tokyo, Japan, Department of Ophthalmology, Keio University School of Medicine, Tokyo, Japan

    ⨯
  • Chiho Shoda ,

    Contributed equally to this work with: Yukihiro Miwa, Deokho Lee, Chiho Shoda

    Roles Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Writing – review & editing

    Affiliations Laboratory of Photobiology, Keio University School of Medicine, Tokyo, Japan, Department of Ophthalmology, Keio University School of Medicine, Tokyo, Japan, Department of Ophthalmology, Nihon University School of Medicine, Tokyo, Japan

    ⨯
  • Heonuk Jeong,

    Roles Methodology

    Affiliations Laboratory of Photobiology, Keio University School of Medicine, Tokyo, Japan, Department of Ophthalmology, Keio University School of Medicine, Tokyo, Japan

    ⨯
  • Kazuno Negishi,

    Roles Supervision, Writing – review & editing

    Affiliation Department of Ophthalmology, Keio University School of Medicine, Tokyo, Japan

    ⨯
  • Toshihide Kurihara

    Roles Conceptualization, Funding acquisition, Supervision, Writing – review & editing

    kurihara@z8.keio.jp

    Affiliations Laboratory of Photobiology, Keio University School of Medicine, Tokyo, Japan, Department of Ophthalmology, Keio University School of Medicine, Tokyo, Japan

    ⨯

Abstract

Photoreceptor cell death can cause progressive and irreversible visual impairments. Still, effective therapies on retinal neuroprotection are not available. Hypoxia-inducible factors (HIFs) are transcriptional factors which strongly regulate angiogenesis, erythropoiesis, intracellular metabolism, and programed cell death under a hypoxic or an abnormal metabolic oxidative stress condition. Therefore, we aimed to unravel that inhibition of HIFs could prevent disease progression in photoreceptor cell death, as recent studies showed that HIFs might be pathologic factors in retinal diseases. Adult male balb/cAJcl (8 weeks old; BALB/c) were used to investigate preventive effects of a novel HIF inhibitor halofuginone (HF) on a murine model of light-induced retinopathy. After intraperitoneal injections of phosphate-buffered saline (PBS) or HF (0.4 mg/kg in PBS) for 5 days, male BALB/c mice were subjected to a dark-adaption to being exposed to a white LED light source at an intensity of 3,000 lux for 1 hour in order to induce light-induced retinal damage. After extensive light exposure, retinal damage was evaluated using electroretinography (ERG), optical coherence tomography (OCT), and TUNEL assay. Light-induced retinal dysfunction was suppressed by HF administration. The amplitudes of scotopic a-wave and b-wave as well as that of photopic b-wave were preserved in the HF-administered retina. Outer retinal thinning after extensive light exposure was suppressed by HF administration. Based on the TUNEL assay, cell death in the outer retina was seen after light exposure. However, its cell death was not detected in the HF-administered retina. Halofuginone was found to exert preventive effects on light-induced outer retinal cell death.

Citation: Miwa Y, Lee D, Shoda C, Jeong H, Negishi K, Kurihara T (2024) Halofuginone prevents outer retinal degeneration in a mouse model of light-induced retinopathy. PLoS ONE 19(3): e0300045. https://doi.org/10.1371/journal.pone.0300045

Editor: Alexandre Hiroaki Kihara, Universidade Federal do ABC, BRAZIL

Received: December 20, 2023; Accepted: February 20, 2024; Published: March 27, 2024

Copyright: © 2024 Miwa et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the paper and its Supporting Information files.

Funding: Its work was supported by Grants-in-Aid for Scientific Research (KAKENHI, number 15 K10881, and 18 K09424) from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) to T.K. and (KAKENHI, number 20 K18393) from the MEXT to Y.M. and JST SPRING (number JPMJSP2123) to D.L. The funding organization had no role in the design or conduct of this research.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Age-related macular degeneration (AMD), a multifactorial and progressive degenerative disease, has been known to be the main cause of visual loss in many industrialized countries with aging. As reactive oxygen species could be accumulated in the retina, excessive light exposure is one of the pathologic risk factors to induce degeneration of photoreceptors under the AMD condition [1, 2]. In that reason, research scientists have focused on understanding the mechanism of light-induced retinopathy [3, 4]. To understand the pathologic mechanisms for photoreceptor damage, a murine light-induced retinopathy (LIR) model has been widely used [5–7]. Furthermore, the LIR model was applied to screen promising drug candidates in this aspect. A number of preclinical studies suggested that early treatment or pre-treatment of therapeutic agents to suppress oxidative stress in the retina could reduce photoreceptor damage [8–12]. However, promising therapeutic molecular targets remain unclear.

Hypoxia-inducible factors (HIFs) are transcriptional factors that strongly regulate hypoxia-responsive or metabolic stress-responsive genes against hypoxic or non-hypoxic oxidative stress [13–16]. While HIFs are rapidly degraded by the ubiquitin proteasome pathway with hydroxylation via prolyl hydroxylases (PHDs) under normoxia, HIFs can be stabilized with reductions of hydroxylation under hypoxia [13, 17]. Then, stabilized HIFs finally lead to the activation of HIF target gene expressions, including vascular endothelial cell growth factor (VEGF), BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 (BNIP3), adrenomedulin (ADM), angiopoietin-like 2 and 4 (ANGPTL2 and ANGPTL4), endothelin-1 (ET-1), heme oxygenease-1 (HO-1), nitric oxide synthase (NOS), or stromal derived growth factor-1 (SDF-1) [18–20]. Depending on the tissue condition, those gene expressions might be pathologic or protective to the retina. Oxidative stress could also increase HIF expression in ocular tissues, finally leading to the upregulation of various HIF target gene expressions [21]. Increased expressions in hypoxia-related genes were detectible in the aged human retina, which implies that photoreceptor cells might be related to the upregulation of hypoxia-induced HIF target genes in response to a mild but chronic hypoxic stress that may occur under aging process [22]. Many groups previously suggested that HIFs may be involved in retinal diseases and that the inhibition of HIFs may have therapeutic effects in various mouse models of neurodegenerative diseases [18, 22–25]. However, its effects have not been clearly examined in a murine model of LIR.

Halofuginone is an analog of febrifugine (an alkaloid originally isolated from Dichroa febrifugea). Halofuginone recently received much attention for its wide range of biological benefits in malaria, cancer, and fibrosis-associated immune diseases [26]. Anti-angiogenic effects of halofuginone were examined in an in vivo model of acute promyelocytic leukemia [27]. Furthermore, PCR analysis of bone marrow samples showed reductions in VEGF and HIF-1 gene expressions in halofuginone-treated mice [27]. Halofuginone has been reported to strongly suppress HIF expressions in the retina in vivo and in a retinal cell line [28, 29]. In that HIF inhibitory effects of halofuginone were examined in a mouse model of retinal ischemia/reperfusion injury model [28, 29], its HIF inhibitory activity has not been examined in the LIR model. Therefore, in this study, we aimed to investigate whether a HIF inhibitor halofuginone could prevent outer retinal degeneration in a murine model of LIR.

Materials and methods

Animals

Animals were purchased from CLEA Japan (Tokyo, Japan), and maintained in a temperature and cycle-controlled environment (24 ± 1°C; 12 h light-12 h dark). Supplies, such as food and water, were freely given to animals. Animal experiments were approved by the Ethics Committee on Animal Research of the Keio University School of Medicine (#16017). The ARVO Statement for the Use of Animals in Ophthalmic and Vision Research, and the international standards of animal care and use, Animal Research: Reporting in vivo Experiments guidelines were also followed in our current study.

During experiments in which signs including hunched posture, lethargy, lack of food intake or unexpected infection were detected in mice, a combination of 3x of medetomidine (7.5 μg/100 μL; Orion, Espoo, Finland), midazolam (40 μg/100 μL; Sandoz, Tokyo, Japan), and butorphanol tartrate (50 μg/100 μL; Meiji Seika Pharma, Tokyo, Japan) “MMB” was intraperitoneally administered to mice. Then, under deep anesthesia, mice were euthanized. Alleviation of suffering was not required, as there was no surgical operation to induce pain in mice in our experimental scheme.

Light-induced retinopathy

Male balb/cAJcl (8 weeks old; BALB/c) mice were subjected to a dark-adaption for at least 12 hours. The BALB/c mouse is not only generally and widely used in vision research, but also its mouse line was reported more susceptible to light damage in comparison to C57BL/6 mice [30–32]. Based on our previous research, we also found that BALB/c mice were susceptible to light damage in our system [33]. After dark-adaption, each mouse was placed in each cage and exposed to a white LED light source at an intensity of 3,000 lux in order to cause damage in the outer retina, as previously described [33]. After one hour of extensive light exposure, mice were back to their original cages. This light exposure was conducted in room temperature.

Halofuginone administration

BALB/c mice were randomly allocated into two experimental groups: one group received halofuginone (Cat number: 32481, Sigma; 0.4 mg/kg/day in phosphate-buffered saline [PBS]) via intraperitoneal injection, while the other group was provided with an equivalent volume of PBS as the HF’s control. Five consecutive injections of HF or PBS were performed before extensive light exposure at an intensity of 3,000 lux. Each fresh frozen stock of halofuginone was thawed on the day of use. The dosage was determined approximately based on the several previous HF literatures [28, 34–36]. The HF or PBS injection was at 24-hour intervals. On the day of light exposure, the injection was performed before 1 hour of light exposure.

Electroretinography (ERG) and optical coherence tomography (OCT)

Seven days after light exposure, ERG and OCT were conducted, as previously described [37]. For ERG, after a dark-adaption for more than 12 hours, a mixture of MMB was injected to mice for anesthesia with pupil dilation. After anesthesia, mice were placed inside a Ganzfeld dome and scotopic and photopic ERG waves were recorded using a PuREC ERG acquisition machine (MAYO, Inazawa, Japan). Light-emitting diode (LED) stimulators were used for light source. Standardized light intensities (scotopic: 0.5, 2, 10, 50 cd.s/m2; photopic: 4, 10, 20 cd.s/m2) were applied to obtain the amplitudes of scotopic a-wave and b-wave and photopic b-wave in mice. The active electrodes were placed on the eyes. A reference electrode was inserted to the mouth. A clipping ground electrode was placed to the tail. ERG responses were obtained from both eyes. All mice were kept warm during the ERG procedure by using heat pads. The amplitude of a-wave was determined from the baseline to the lowest point of a-wave and the amplitude of b-wave was set from the lowest point of a-wave to the peak of b-wave. Amplitudes of scotopic a-wave and b-wave and photopic b-wave are represented in absolute values.

For OCT, after mouse anesthesia with pupil dilation, mice were softly fixed on an OCT platform. After mice were fixed on the platform, retinal images at 200, 400, 600, and 800 μm from the optic nerve head in the superior and inferior areas were taken by the Envisu R4310 OCT camera (Leica, Wetzlar, Germany). Outer retinal thickness was obtained by general software provided from Envisu R4310 OCT.

TUNEL staining

TUNEL staining was performed as previously described [37]. After MMB injection, mice were euthanized. Eyeballs from mice were obtained and incubated in 4% paraformaldehyde (PFA) solution. The eyeballs fixed in 4% PFA solution were incubated in 30% sucrose solution and then subjected to sagittal-section by a general cryostat (CM3050S, Leica, Wetzlar, Germany). Then, the sectioned samples were subjected to TUNEL staining. We followed the general manufacturer’s instruction (written in the in situ Apoptosis Detection Kit, Cat #MK500, Takara Bio, Japan). After permeabilization, a reaction mixture containing TdT enzymes was applied to the sectioned samples. After 1 minute of 4’,6-diamidino-2-phenylindole (DAPI) incubation to the samples, the sectioned slides were mounted and examined via the LSM710 microscope (Carl Zeiss, Jena, Germany).

Western blot

For western blot, the samples of retinas or 661W cells were homogenized in lysis RIPA buffer (Thermo Fisher Scientific, Waltham MA, USA) containing protease inhibitor cocktails (Roche, Switzerland). After protein lysates were boiled, the protein concentration of the lysates was determined by a bicinchoninic acid assay kit (Pierce, Rockford, IL, USA). The samples were fractionated on 10% SDS-polyacrylamide gels, transferred to nitrocellulose membranes, and blocked with 5% nonfat dry milk. Antibodies used in this study are as follows: anti-HIF-1α (1:1000, Cat #36169, Cell Signaling Technology, Danvers, MA, USA), anti-BNIP3 (1:2000, ab109362, Abcam, England), and anti-β-ACTIN (1:5000, #3700, Cell Signaling Technology, MA, USA). After incubation with primary antibodies in a 4-degree freezer overnight, membranes were washed with tris-buffered saline with 0.1% Tween (TBST) three times. Then, membranes were incubated with horseradish peroxidase-conjugated secondary antibody solutions (1:5000, GE Healthcare, Princeton, NJ, USA) for 2 hours at room temperature. After TBST washing three times, signals were detected using an ECL kit (Ez WestLumi plus, ATTO, Tokyo, Japan). Protein bands were visualized using chemiluminescence (ImageQuant LAS 4000 mini, GE Healthcare, Chicago, IL, USA) and quantified using NIH ImageJ software (National Institutes of Health, Bethesda, MD, USA).

Quantitative PCR

For quantitative PCR, total RNA samples were extracted using a commercial kit (the RNeasy Plus Mini Kit, Qiagen, Venlo, The Netherlands), and its concentration was quantified using a spectrophotometer (NanoDrop 2000c, Thermo Scientific, Waltham, MA, USA), as previously described [38]. Then, total RNA samples were converted to cDNA samples using a commercial Kit (the ReverTra Ace qPCR RT Master Mix with gDNA Remover, TOYOBO, Osaka, Japan). Quantitative PCR was performed with a SYBR green master mix commercial kit (THUNDERBIRD SYBR qPCR Mix, TOYOBO, Osaka, Japan) using a PCR system (the Step One Plus Real-Time PCR system, Applied Biosystems, Waltham, MA, USA). The fold difference in different transcripts was calculated by the ΔΔCt protocol [39]. Hprt was used as a reference gene. Primers used in our current study as follows: Hprt (Forward: TCAGTCAACGGGGGACATAAA; Reverse: GGGGCTGTACTGCTTAACCAG), Hif-1α (Forward: GGTTCCAGCAGACCCAGTTA; Reverse: AGGCTCCTTGGATGAGCTTT), Bnip3 (Forward: GCTCCCAGACACCACAAGAT; Reverse: TGAGAGTAGCTGTGCGCTTC). The retinal samples were prepared 3, 6, 9, 12, and 24 hours after light exposure.

Luciferase assay

Luciferase assay was conducted, as previously indicated [38]. A murine cone photoreceptor cell line (661W cells) was transfected with the HIF-luciferase reporter gene construct (Cignal Lenti HIF Reporter, Qiagen, Venlo, Netherlands) to monitor the HIF transcriptional activity. The HIF-luciferase construct encodes the firefly luciferase gene under the control of hypoxia response element which closely binds to HIFs. These cells were co-transfected with the CMV-renilla luciferase construct as an internal control for general cellular conditions. Cobalt chloride (CoCl2, 200 μM, cobalt (II) chloride hexahydrate, Wako, Japan) was treated to the cells in order to induce HIF activation for 24 hours before measuring the luminescence. To evaluate suppressive effects of HF on HIF activation, HF was added to the cells at the same time as CoCl2 was added to the cells. The luminescence was measured with the Dual-Luciferase Reporter Assay System (Promega, Fitchburg, WI, USA).

Statistical analysis

All data’ values were depicted as mean ± standard deviation. Statistical significance was determined by using a two-way Student’s t-test or a one- or two-way ANOVA followed by a Bonferroni post hoc test depending on the presented data, and P < 0.05 was considered statistically significant.

Results

HIF-1α expression increases in a murine model of light-induced retinopathy

Previous studies demonstrated that HIF-1α expression increased in the retina by various stimuli [18], and its induction could be linked to one of the pathologic processes for disease progression [18, 25]. We examined whether HIF-1α could be induced in our murine model of light-induced retinopathy (Fig 1). The expressions of Hif-1α and its downstream gene Bnip3 increased in the retina after extensive light exposure (Fig 1A). When it comes to Hif-1α, its mRNA expression started to increase 3 hours after the exposure. Then, its expression was maintained for 24 hours. Bnip3 mRNA expression started to increase 9 hours after the exposure and its increase was maintained detected for 12 hours. Next, we examined the protein levels of HIF-1α and BNIP3 in the retina after extensive light exposure (Fig 1B). HIF-1α and BNIP3 expressions significantly increased 24 hours after the exposure.

thumbnail
Download:
Fig 1. Changes in hypoxia-inducible factor-1α (HIF-1α) and BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 (BNIP3) expressions in a murine model of light-induced retinopathy.

(A) Quantitative analyses showed that retinal Hif-1α and Bnip3 mRNA expressions increased after extensive light exposure. Graphs were illustrated as mean ± standard deviation. The data were analyzed using two-way Student’s t-test. N = 4 per group. h: hour(s). (B) Images and Quantitative analyses showed that the protein expressions of HIF-1α and BNIP3 (multiple bands in the black parentheses) increased after extensive light exposure. Graphs were shown as mean ± standard deviation. The data were analyzed using two-way Student’s t-test. N = 4 per group. LIR: light-induced retinopathy. *P < 0.05, **P < 0.01, ***P < 0.001.

https://doi.org/10.1371/journal.pone.0300045.g001

A HIF inhibitor halofuginone treatment prevents retinal dysfunction in a murine model of light-induced retinopathy

We examined whether a HIF inhibitor halofuginone could show preventive effects on retinal function in our murine model of light-induced retinopathy (Fig 2). The amplitudes of scotopic a-wave and b-wave were significantly reduced 7 days after extensive light exposure (Fig 2A and 2B). We found that halofuginone treatment significantly suppressed their reductions (Fig 2A and 2B). We also found the similar preventive effect of halofuginone under the photopic ERG condition (Fig 2C and 2D).

thumbnail
Download:
Fig 2. Retinal functional alterations by halofuginone treatment in a murine model of light induced retinopathy.

(A and B) Images and quantitative analyses showed that the amplitudes of scotopic a- and b-waves were reduced after extensive light exposure and their reductions were suppressed by halofuginone treatment (flash intensities, 0.5, 2, 10 and 50 cd.s/m2). Graphs were shown as mean ± standard deviation. The data were analyzed using one-way ANOVA followed by a Bonferroni post-hoc test. N = 6–7 per group. (C and D) Images and quantitative analyses showed that the amplitude of photopic b-wave was reduced after extensive light exposure and its reductions were suppressed by halofuginone treatment (flash intensities, 4, 10 and 20 cd.s/m2). Graphs were shown as mean ± standard deviation. The data were analyzed using one-way ANOVA followed by a Bonferroni post-hoc test. N = 6–7 per group. LIR: light-induced retinopathy. HF: halofuginone. Cont: control (naïve mice). *P < 0.05, **P < 0.01, ***P < 0.001, #P < 0.05, ##P < 0.01. Triangles were used to mark scotopic a-wave and b-wave, and photopic b-wave.

https://doi.org/10.1371/journal.pone.0300045.g002

A HIF inhibitor halofuginone treatment prevents histopathological retinal damage in a murine model of light-induced retinopathy

We examined whether a HIF inhibitor halofuginone could show preventive effects on histopathological retinal damage in our murine model of light-induced retinopathy (Fig 3). As murine models of light-induced retinopathy generally show outer retinal thinning [6], we also reproduced this finding in our model 7 days after extensive light exposure (Fig 3A–3C). Under this pathologic condition, halofuginone treatment dramatically suppressed its thinning 7 days after the exposure.

thumbnail
Download:
Fig 3. Histological alterations by halofuginone treatment in a murine model of light induced retinopathy.

(A and B) Retinal images of the optical coherence tomography (OCT) and quantitative analyses showed that halofuginone treatment suppressed outer retinal thinning in light-induced retinopathy, analyzed at 200, 400, 600, and 800 μm (dot marks were displayed at each point with a 200 μm interval) from optic nerve head (ONH, 0). N = 4 per group. The data were analyzed using two-way ANOVA followed by a Bonferroni post hoc test. Graphs were shown as mean  ±  standard deviation. (C) The enlarged representative retinal image of OCT to detect the outer nuclear layer. RNFL/GCL: the retinal nerve fiber layer and ganglion cell layer. IPL: the inner plexiform layer. INL: the inner nuclear layer. OPL: the outer plexiform layer. ONL: the outer nuclear layer. IS/OS: the junction between the photoreceptor outer and inner segments. RPE: the retinal pigment epithelium. (D) The TUNEL assay image showed that halofuginone treatment protected against outer retinal cell death (marked with white asterisks) in light-induced retinopathy. ONL: the outer nuclear layer. LIR: light-induced retinopathy. HF: halofuginone. ***P < 0.001, ###P < 0.001.

https://doi.org/10.1371/journal.pone.0300045.g003

Previous studies demonstrated that light-induced cell death could be detected at the early time point after light exposure in models of light-induced retinal damage [40–43]. Along with this notion, we used the TUNEL assay to examine cell death in the outer retina (Fig 3D). TUNEL-positive cells were detectable in the outer retina 24 hours after extensive light exposure. And its cell death was not induced in the halofuginone-administered retina.

A HIF inhibitor halofuginone treatment reduces HIF-1α expression in a murine cone photoreceptor cell line

To explain whether a HIF inhibitor halofuginone could show suppressive effects on HIF induction in photoreceptors, we applied 661W cells (a murine photoreceptor cell line) to our system. Previously, we found that CoCl2-induced HIF activity could be reduced by halofuginone treatment, analyzed by the luciferase assay [28]. In our current system, we further examined which concentrations of halofuginone could effectively reduce CoCl2-induced HIF activity (Fig 4A). Although suppressive effects of halofuginone on HIF activity were well-confirmed, halofuginone had a narrow therapeutic window (20 to 200 nM). 200 nM halofuginone was strongly effective, while 20 nM halofuginone partially reduced CoCl2-induced HIF activity. Based on the western blot analysis, the protein expressions of HIF-1α and its downstream gene BNIP3 were dose-dependently reduced by halofuginone treatment (Fig 4B). Under this condition, 200 nM halofuginone was only effective to clearly reduce HIF-1α and BNIP3 expressions. When it comes to qPCR, Bnip3 mRNA expression was reduced by halofuginone treatment (200 nM), while Hif-1α mRNA expression was not changed (Fig 4C). This indicates that halofuginone may suppress HIF-1α stabilization at the protein level rather than at the mRNA level. Furthermore, a high dose of halofuginone might be effective to suppress HIF activity.

thumbnail
Download:
Fig 4. Changes in hypoxia-inducible factor-1α (HIF-1α) and BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 (BNIP3) expressions by halofuginone treatment in a 661W photoreceptor cell line.

(A) A quantitative analysis of the HIF-reporter luciferase assay using 661W cells showed that CoCl2-induced HIF activity was suppressed by halofuginone treatment. The data were analyzed using one-way ANOVA followed by a Bonferroni post-hoc test. N = 3–9 per group. (B) A western blot image showed that halofuginone treatment reduced CoCl2-induced HIF-1α and BNIP3 protein expressions in 661W cells. (C) A quantitative analysis showed that CoCl2-induced Bnip3 mRNA expression was reduced by halofuginone treatment in 661W cells while Hif-1α mRNA expression was not changed. The data were analyzed using one-way ANOVA followed by a Bonferroni post-hoc test. N = 3–6 per group. HF: halofuginone. **P < 0.01, ***P < 0.001, ###P < 0.001.

https://doi.org/10.1371/journal.pone.0300045.g004

Discussions

The current study demonstrated that retinal HIF expression increased in a mouse model of light-induced retinopathy, and a HIF inhibitor halofuginone could exert preventive effects on outer retinal degeneration in the model. Furthermore, HIF expression could be reduced by halofuginone treatment in 661W under CoCl2-induced pseudohypoxic condition. Although halofuginone treatment has been suggested as a promising therapeutic in retinal degeneration (especially, the inner retina) [28], as far as we know, our current data first expanded the preventive role of halofuginone on outer retinal degeneration in a murine model of light-induced retinopathy.

HIF-1α expression increased in the retina after light exposure, and light-induced retinal dysfunction and outer retinal damage were reduced by the treatment of the HIF inhibitor halofuginone. In our previous study, Hif-1α knock-out could reduce apoptosis in 661W cells under an oxidative stress condition [29]. Light-induced retinal degeneration has been linked with oxidative stress in the retina [44]. Increases in photoreceptor cell death in human retinal organoids were seen in response to oxidative stress [21]. Under this condition, HIF-1 expression increased in the organoids [21]. During chronic HIF activation, deficits in mitochondrial tricarboxylic acid cycle (TCA cycle) or oxidative phosphorylation (OXPHOS) could be related to the progression of rod photoreceptor degeneration [45]. Even though whether light-induced oxidative stress directly causes increases in HIF-1α expression or vice versa has not been clearly understood, based on our previous and present data, we speculated that the inhibition in HIF-1α expression could decrease cell death in the outer retina or retinal dysfunction. However, a recent study showed that photoreceptor cell death could be promoted by HIF inhibition using digoxin (another HIF inhibitor) treatment in a NaIO3-induced mouse model for ocular oxidative stress [21]. Treatment durations, concentrations, or methods of HIF inhibitor drugs are needed to be clearly confirmed, which will be further studied.

BNIP3, one of the mitochondrial proteins, is involved in mitochondrial dysfunctions. BNIP3 has been reported involved in the activation of cell death interacting with BCL-2, BCL-XL, BAK, or BAX [46, 47]. Thereafter, BNIP3 was found as one of the downstream target genes for HIF-1 [29, 48–50]. In this aspect, we previously demonstrated that the HIF-1α/BNIP3 pathway could be one of the promising therapeutic targets in retinal degeneration in a murine model of retinal ischemia/reperfusion injury and unilateral common carotid artery occlusion, or a 661W photoreceptor cell line [28, 29, 51]. Hif-1α or Bnip3 knock-out reduced apoptosis in 661W cells under an HIF-induced oxidative stress condition. In our current study, halofuginone treatment suppressed the expressions in HIF-1α as well as BNIP3 in 661W cells. Furthermore, we found that pathologic HIF-1α and BNIP3 expressions in the retina increased by extensive light exposure. Taken together, although more studies are needed, the HIF-1α/BNIP3 pathway could be considered as a therapeutic target in outer retinal degeneration.

Halofuginone has been reported to be effective against a variety of diseases, including parasitic diseases, fibrosis, cancer, and autoimmune diseases in many animal species [52, 53]. There have also been reports of its use in animals [54]. Although repositioning halofuginone therapy to the treatment for photoreceptor cell death in animals or humans needs more considerations in terms of the drug dosage (a range of its effective concentration to suppress HIF activity was narrow) and administration time-points and methods, the further study with halofuginone therapy may reduce barriers to the current clinical therapy limits.

In summary, we preliminarily attempted to apply a promising halofuginone therapy to a murine model of light-induced retinopathy. As the outcomes, retinal functional deficits and outer retinal thinning were suppressed by halofuginone treatment. Furthermore, pathologic HIF-1α and cell death-related BNIP3 inductions could be directly reduced by halofuginone treatment in photoreceptor cells. Although more understandings on the mechanism of action of the HIF inhibition therapy in outer retinal degeneration are required, we shortly suggest that halofuginone can be one of the promising HIF inhibiting therapeutics for preventing the progression of outer retinal cell death-related ocular diseases.

Supporting information

S1 Raw images. Uncropped western blot images are attached in this file.

https://doi.org/10.1371/journal.pone.0300045.s001

(PDF)

S1 Appendix. Datasets are attached in this file.

https://doi.org/10.1371/journal.pone.0300045.s002

(XLSX)

Acknowledgments

We thank K. Kurosaki and A. Kawabata for critical discussions.

References

  1. 1. Ruan Y, Jiang S, Gericke A. Age-Related Macular Degeneration: Role of Oxidative Stress and Blood Vessels. International journal of molecular sciences. 2021;22(3). Epub 2021/02/03. pmid:33525498; PubMed Central PMCID: PMC7866075.
  2. 2. Contín MA, Benedetto MM, Quinteros-Quintana ML, Guido ME. Light pollution: the possible consequences of excessive illumination on retina. Eye (London, England). 2016;30(2):255–63. Epub 2015/11/07. pmid:26541085; PubMed Central PMCID: PMC4763120.
  3. 3. van Lookeren Campagne M, LeCouter J, Yaspan BL, Ye W. Mechanisms of age-related macular degeneration and therapeutic opportunities. The Journal of pathology. 2014;232(2):151–64. Epub 2013/10/10. pmid:24105633.
  4. 4. Keenan TDL, Cukras CA, Chew EY. Age-Related Macular Degeneration: Epidemiology and Clinical Aspects. Advances in experimental medicine and biology. 2021;1256:1–31. Epub 2021/04/14. pmid:33847996.
  5. 5. Grimm C, Remé CE. Light damage as a model of retinal degeneration. Methods in molecular biology (Clifton, NJ). 2013;935:87–97. Epub 2012/11/15. pmid:23150362.
  6. 6. Chistyakov DV, Baksheeva VE, Tiulina VV, Goriainov SV, Azbukina NV, Gancharova OS, et al. Mechanisms and Treatment of Light-Induced Retinal Degeneration-Associated Inflammation: Insights from Biochemical Profiling of the Aqueous Humor. International journal of molecular sciences. 2020;21(3). Epub 2020/01/25. pmid:31973128; PubMed Central PMCID: PMC7038222.
  7. 7. Polosa A, Bessaklia H, Lachapelle P. Strain Differences in Light-Induced Retinopathy. PloS one. 2016;11(6):e0158082. Epub 2016/06/30. pmid:27355622; PubMed Central PMCID: PMC4927188.
  8. 8. Shibagaki K, Okamoto K, Katsuta O, Nakamura M. Beneficial protective effect of pramipexole on light-induced retinal damage in mice. Experimental eye research. 2015;139:64–72. Epub 2015/07/28. pmid:26213307.
  9. 9. Tanaka M, Inoue Y, Yoshino Y, Kuse Y, Tanida N, Takahashi K, et al. Ropinirole Prevents Light-Induced Retinal Photoreceptor Damage in Mice. BPB Reports. 2021;4(1):1–5.
  10. 10. Zhang C, Lei B, Lam TT, Yang F, Sinha D, Tso MO. Neuroprotection of photoreceptors by minocycline in light-induced retinal degeneration. Investigative ophthalmology & visual science. 2004;45(8):2753–9. Epub 2004/07/28. pmid:15277501.
  11. 11. Chen X, Amorim JA, Moustafa GA, Lee JJ, Yu Z, Ishihara K, et al. Neuroprotective effects and mechanisms of action of nicotinamide mononucleotide (NMN) in a photoreceptor degenerative model of retinal detachment. Aging. 2020;12(24):24504–21. Epub 2020/12/30. pmid:33373320; PubMed Central PMCID: PMC7803565.
  12. 12. Pardue MT, Allen RS. Neuroprotective strategies for retinal disease. Progress in retinal and eye research. 2018;65:50–76. Epub 2018/02/27. pmid:29481975; PubMed Central PMCID: PMC6081194.
  13. 13. Taylor CT, Scholz CC. The effect of HIF on metabolism and immunity. Nature reviews Nephrology. 2022;18(9):573–87. Epub 2022/06/22. pmid:35726016; PubMed Central PMCID: PMC9208707 interests.
  14. 14. Pugh CW, Ratcliffe PJ. Regulation of angiogenesis by hypoxia: role of the HIF system. Nature medicine. 2003;9(6):677–84. Epub 2003/06/05. pmid:12778166.
  15. 15. Kung-Chun Chiu D, Pui-Wah Tse A, Law CT, Ming-Jing Xu I, Lee D, Chen M, et al. Hypoxia regulates the mitochondrial activity of hepatocellular carcinoma cells through HIF/HEY1/PINK1 pathway. Cell death & disease. 2019;10(12):934. Epub 2019/12/11. pmid:31819034; PubMed Central PMCID: PMC6901483.
  16. 16. Zheng X, Narayanan S, Xu C, Eliasson Angelstig S, Grünler J, Zhao A, et al. Repression of hypoxia-inducible factor-1 contributes to increased mitochondrial reactive oxygen species production in diabetes. eLife. 2022;11. Epub 2022/02/16. pmid:35164902; PubMed Central PMCID: PMC8846593.
  17. 17. Watts ER, Walmsley SR. Inflammation and Hypoxia: HIF and PHD Isoform Selectivity. Trends in molecular medicine. 2019;25(1):33–46. Epub 2018/11/18. pmid:30442494.
  18. 18. Lee D, Miwa Y, Kunimi H, Ibuki M, Shoda C, Nakai A, et al. HIF Inhibition Therapy in Ocular Diseases. The Keio journal of medicine. 2022;71(1):1–12. Epub 2021/04/13. pmid:33840673.
  19. 19. Kim AH, Kolesnikova M, Ngo WK, Tsang SH. Effects of medications on hypoxia-inducible factor in the retina: A review. Clinical & experimental ophthalmology. 2023;51(3):205–16. Epub 2023/01/04. pmid:36594241.
  20. 20. Arjamaa O, Nikinmaa M. Oxygen-dependent diseases in the retina: role of hypoxia-inducible factors. Experimental eye research. 2006;83(3):473–83. Epub 2006/06/06. pmid:16750526.
  21. 21. Babapoor-Farrokhran S, Qin Y, Flores-Bellver M, Niu Y, Bhutto IA, Aparicio-Domingo S, et al. Pathologic vs. protective roles of hypoxia-inducible factor 1 in RPE and photoreceptors in wet vs. dry age-related macular degeneration. Proceedings of the National Academy of Sciences of the United States of America. 2023;120(50):e2302845120. Epub 2023/12/06. pmid:38055741; PubMed Central PMCID: PMC10723156.
  22. 22. Barben M, Ail D, Storti F, Klee K, Schori C, Samardzija M, et al. Hif1a inactivation rescues photoreceptor degeneration induced by a chronic hypoxia-like stress. Cell death and differentiation. 2018;25(12):2071–85. Epub 2018/04/19. pmid:29666476; PubMed Central PMCID: PMC6261999.
  23. 23. Zhang J, Qin Y, Martinez M, Flores-Bellver M, Rodrigues M, Dinabandhu A, et al. HIF-1α and HIF-2α redundantly promote retinal neovascularization in patients with ischemic retinal disease. The Journal of clinical investigation. 2021;131(12). Epub 2021/06/16. pmid:34128478; PubMed Central PMCID: PMC8203455.
  24. 24. Burtscher J, Mallet RT, Burtscher M, Millet GP. Hypoxia and brain aging: Neurodegeneration or neuroprotection? Ageing research reviews. 2021;68:101343. Epub 2021/04/17. pmid:33862277.
  25. 25. Kurihara T, Westenskow PD, Friedlander M. Hypoxia-inducible factor (HIF)/vascular endothelial growth factor (VEGF) signaling in the retina. Advances in experimental medicine and biology. 2014;801:275–81. Epub 2014/03/26. pmid:24664708.
  26. 26. Pines M, Spector I. Halofuginone—the multifaceted molecule. Molecules (Basel, Switzerland). 2015;20(1):573–94. Epub 2015/01/09. pmid:25569515; PubMed Central PMCID: PMC6272571.
  27. 27. Assis PA, De Figueiredo-Pontes LL, Lima AS, Leão V, Cândido LA, Pintão CT, et al. Halofuginone inhibits phosphorylation of SMAD-2 reducing angiogenesis and leukemia burden in an acute promyelocytic leukemia mouse model. Journal of experimental & clinical cancer research: CR. 2015;34(1):65. Epub 2015/06/24. pmid:26099922; PubMed Central PMCID: PMC4486128.
  28. 28. Kunimi H, Miwa Y, Inoue H, Tsubota K, Kurihara T. A Novel HIF Inhibitor Halofuginone Prevents Neurodegeneration in a Murine Model of Retinal Ischemia-Reperfusion. International journal of molecular sciences. 2019;20(13). Epub 2019/07/03. pmid:31261724; PubMed Central PMCID: PMC6651456.
  29. 29. Kunimi H, Lee D, Ibuki M, Katada Y, Negishi K, Tsubota K, et al. Inhibition of the HIF-1α/BNIP3 pathway has a retinal neuroprotective effect. FASEB journal: official publication of the Federation of American Societies for Experimental Biology. 2021;35(8):e21829. Epub 2021/07/28. pmid:34314069.
  30. 30. Bell BA, Kaul C, Bonilha VL, Rayborn ME, Shadrach K, Hollyfield JG. The BALB/c mouse: Effect of standard vivarium lighting on retinal pathology during aging. Experimental eye research. 2015;135:192–205. Epub 2015/04/22. pmid:25895728; PubMed Central PMCID: PMC4446204.
  31. 31. LaVail MM, Gorrin GM, Repaci MA, Thomas LA, Ginsberg HM. Genetic regulation of light damage to photoreceptors. Investigative ophthalmology & visual science. 1987;28(7):1043–8. Epub 1987/07/01. pmid:3596986.
  32. 32. Lyubarsky AL, Savchenko AB, Morocco SB, Daniele LL, Redmond TM, Pugh EN Jr., Mole quantity of RPE65 and its productivity in the generation of 11-cis-retinal from retinyl esters in the living mouse eye. Biochemistry. 2005;44(29):9880–8. Epub 2005/07/20. pmid:16026160.
  33. 33. Ibuki M, Lee D, Shinojima A, Miwa Y, Tsubota K, Kurihara T. Rice Bran and Vitamin B6 Suppress Pathological Neovascularization in a Murine Model of Age-Related Macular Degeneration as Novel HIF Inhibitors. International journal of molecular sciences. 2020;21(23). Epub 2020/12/02. pmid:33255657; PubMed Central PMCID: PMC7728083.
  34. 34. Jain PP, Zhao T, Xiong M, Song S, Lai N, Zheng Q, et al. Halofuginone, a promising drug for treatment of pulmonary hypertension. British journal of pharmacology. 2021;178(17):3373–94. Epub 2021/03/12. pmid:33694155; PubMed Central PMCID: PMC9792225.
  35. 35. Koohestani F, Qiang W, MacNeill AL, Druschitz SA, Serna VA, Adur M, et al. Halofuginone suppresses growth of human uterine leiomyoma cells in a mouse xenograft model. Human reproduction (Oxford, England). 2016;31(7):1540–51. Epub 2016/05/01. pmid:27130615; PubMed Central PMCID: PMC4901881.
  36. 36. Ertuğrul EE, Cincik H, Dogru S, Cekin E, Berber U, Gungor A, et al. Effects of halofuginone on fibrosis formation secondary to experimentally induced subglottic trauma. The Laryngoscope. 2007;117(2):299–302. Epub 2007/02/06. pmid:17277625.
  37. 37. Lee D, Jeong H, Miwa Y, Shinojima A, Katada Y, Tsubota K, et al. Retinal dysfunction induced in a mouse model of unilateral common carotid artery occlusion. PeerJ. 2021;9:e11665. Epub 2021/07/06. pmid:34221738; PubMed Central PMCID: PMC8223895.
  38. 38. Lee D, Miwa Y, Wu J, Shoda C, Jeong H, Kawagishi H, et al. A Fairy Chemical Suppresses Retinal Angiogenesis as a HIF Inhibitor. Biomolecules. 2020;10(10). Epub 2020/10/07. pmid:33020402; PubMed Central PMCID: PMC7599576.
  39. 39. Rao X, Huang X, Zhou Z, Lin X. An improvement of the 2ˆ(-delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostatistics, bioinformatics and biomathematics. 2013;3(3):71–85. Epub 2013/08/01. pmid:25558171; PubMed Central PMCID: PMC4280562.
  40. 40. Nakanishi T, Shimazawa M, Sugitani S, Kudo T, Imai S, Inokuchi Y, et al. Role of endoplasmic reticulum stress in light-induced photoreceptor degeneration in mice. Journal of neurochemistry. 2013;125(1):111–24. Epub 2012/12/12. pmid:23216380.
  41. 41. Donovan M, Carmody RJ, Cotter TG. Light-induced photoreceptor apoptosis in vivo requires neuronal nitric-oxide synthase and guanylate cyclase activity and is caspase-3-independent. The Journal of biological chemistry. 2001;276(25):23000–8. Epub 2001/03/30. pmid:11278285.
  42. 42. Belmonte MA, Santos MF, Kihara AH, Yan CY, Hamassaki DE. Light-Induced photoreceptor degeneration in the mouse involves activation of the small GTPase Rac1. Investigative ophthalmology & visual science. 2006;47(3):1193–200. Epub 2006/03/01. pmid:16505058.
  43. 43. Guzmán Mendoza NA, Homma K, Osada H, Toda E, Ban N, Nagai N, et al. Neuroprotective Effect of 4-Phenylbutyric Acid against Photo-Stress in the Retina. Antioxidants (Basel, Switzerland). 2021;10(7). Epub 2021/08/07. pmid:34356380; PubMed Central PMCID: PMC8301054.
  44. 44. Ozawa Y. Oxidative stress in the light-exposed retina and its implication in age-related macular degeneration. Redox biology. 2020;37:101779. Epub 2020/11/12. pmid:33172789; PubMed Central PMCID: PMC7767731.
  45. 45. Todorova V, Stauffacher MF, Ravotto L, Nötzli S, Karademir D, Ebner LJA, et al. Deficits in mitochondrial TCA cycle and OXPHOS precede rod photoreceptor degeneration during chronic HIF activation. Molecular neurodegeneration. 2023;18(1):15. Epub 2023/03/08. pmid:36882871; PubMed Central PMCID: PMC9990367.
  46. 46. Kubli DA, Ycaza JE, Gustafsson AB. Bnip3 mediates mitochondrial dysfunction and cell death through Bax and Bak. The Biochemical journal. 2007;405(3):407–15. Epub 2007/04/24. pmid:17447897; PubMed Central PMCID: PMC2267317.
  47. 47. Ray R, Chen G, Vande Velde C, Cizeau J, Park JH, Reed JC, et al. BNIP3 heterodimerizes with Bcl-2/Bcl-X(L) and induces cell death independent of a Bcl-2 homology 3 (BH3) domain at both mitochondrial and nonmitochondrial sites. The Journal of biological chemistry. 2000;275(2):1439–48. Epub 2000/01/08. pmid:10625696.
  48. 48. Guo K, Searfoss G, Krolikowski D, Pagnoni M, Franks C, Clark K, et al. Hypoxia induces the expression of the pro-apoptotic gene BNIP3. Cell death and differentiation. 2001;8(4):367–76. Epub 2001/09/11. pmid:11550088.
  49. 49. Zhang Y, Liu D, Hu H, Zhang P, Xie R, Cui W. HIF-1α/BNIP3 signaling pathway-induced-autophagy plays protective role during myocardial ischemia-reperfusion injury. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie. 2019;120:109464. Epub 2019/10/08. pmid:31590128.
  50. 50. Lee JW, Ko J, Ju C, Eltzschig HK. Hypoxia signaling in human diseases and therapeutic targets. Experimental & molecular medicine. 2019;51(6):1–13. Epub 2019/06/22. pmid:31221962; PubMed Central PMCID: PMC6586801.
  51. 51. Lee D, Tomita Y, Miwa Y, Jeong H, Mori K, Tsubota K, et al. Fenofibrate Protects against Retinal Dysfunction in a Murine Model of Common Carotid Artery Occlusion-Induced Ocular Ischemia. Pharmaceuticals (Basel, Switzerland). 2021;14(3). Epub 2021/04/04. pmid:33799938; PubMed Central PMCID: PMC7999063.
  52. 52. Gill J, Sharma A. Prospects of halofuginone as an antiprotozoal drug scaffold. Drug discovery today. 2022;27(9):2586–92. Epub 2022/06/01. pmid:35636724.
  53. 53. Shahiduzzaman M, Daugschies A. Therapy and prevention of cryptosporidiosis in animals. Veterinary parasitology. 2012;188(3–4):203–14. Epub 2012/04/24. pmid:22521978.
  54. 54. Eliashar R, Ochana M, Maly B, Pines M, Sichel JY, Nagler A. Halofuginone prevents subglottic stenosis in a canine model. The Annals of otology, rhinology, and laryngology. 2006;115(5):382–6. Epub 2006/06/03. pmid:16739671.