Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Correction

Correction: Anti-inflammatory effects of cold atmospheric plasma irradiation on the THP-1 human acute monocytic leukemia cell line

  • Ito Hirasawa,
  • Haruka Odagiri,
  • Giri Park,
  • Rutvi Sanghavi,
  • Takaya Oshita,
  • Akiko Togi,
  • Katsunori Yoshikawa,
  • Koji Mizutani,
  • Yasuo Takeuchi,
  • Hiroaki Kobayashi,
  • Sayaka Katagiri,
  • Takanori Iwata,
  • Akira Aoki
  • Article
  • Metrics
  • Comments
  • Media Coverage

In the Table 1, the primer sequences of the forward (GCTGATGGCCCTAAACAGA) and reverse (GGTGGTCGGAGATTCGTAG) for IL6 are incorrect. The correct sequences for IL6 are as follows: forward (CCACTCACCTCTTCAGAACG) and reverse (CATCTTTGGAAGGTTCAGGTTG). Please see the correct Table 1 here.

thumbnail
Download:
Table 1. Primer sequences for RT-qPCR.

https://doi.org/10.1371/journal.pone.0299329.t001

Reference

  1. 1. Hirasawa I, Odagiri H, Park G, Sanghavi R, Oshita T, Togi A, et al. (2023) Anti-inflammatory effects of cold atmospheric plasma irradiation on the THP-1 human acute monocytic leukemia cell line. PLoS ONE 18(10): e0292267. pmid:37851686

Citation: Hirasawa I, Odagiri H, Park G, Sanghavi R, Oshita T, Togi A, et al. (2024) Correction: Anti-inflammatory effects of cold atmospheric plasma irradiation on the THP-1 human acute monocytic leukemia cell line. PLoS ONE 19(2): e0299329. https://doi.org/10.1371/journal.pone.0299329

Published: February 16, 2024

Copyright: © 2024 Hirasawa et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.