https://orcid.org/0000-0001-8137-3404
Figures
Abstract
The genus Coridius Illiger, 1807 (Heteroptera: Dinidoridae) comprises a group of phytophagous terrestrial bugs consisting of 36 species distributed in the Afrotropical and Indo-Malayan regions. In several communities in northeastern India, insects are recognised as a delicacy, medicine, and a nutritional supplement, with Coridius being a popular delicacy. However, Coridius has received little taxonomic attention to date due to large intraspecific variations, inadequate taxonomic treatments, and the rarity of many species. To address this gap, an integrative taxonomy of the genus was performed. Two mitochondrial genes, viz., cytochrome oxidase subunit 1 (COI) and 16S rRNA, were sequenced to reconstruct the phylogenetic relationships within Coridius. We performed both maximum likelihood (ML) and Bayesian inference (BI) to develop a species tree, followed by the Bayesian implementation of the Poisson tree process (bPTP) and Assemble Species by Automatic Partitioning (ASAP) as an additional test to assess species boundaries and delimit operational taxonomic units. A linear discriminant analysis (LDA) of four key morphological characters was then performed to identify species groups. Overall, our analysis supported the establishment of three new species: Coridius adii sp. nov., Coridius esculentus sp. nov., and Coridius insperatus sp. nov., and revealed six distinct lineages within Coridius chinensis (Dallas, 1851). Linear discriminant analysis of morphological characters indicated the clustering of eight species. The species status of Coridius nigriventris (Westwood, 1837) stat. rev, formerly synonymized under Coridius nepalensis (Westwood, 1837), is reinstated in this study. Further, we revised the genus Coridius from India and rediscovered Coridius assamensis (Distant, 1902) and Coridius fuscus (Westwood, 1837) after 100 years.
Citation: Boyane SS, Sen S, Priyadarsanan DR, Thunga PK, Joshi NU, Ghate HV (2024) Integrative taxonomy of the genus Coridius Illiger, 1807 (Hemiptera: Heteroptera: Dinidoridae) reveals hidden diversity and three new species from North-East India. PLoS ONE 19(7): e0298176. https://doi.org/10.1371/journal.pone.0298176
Editor: Murtada D. Naser, University of Basrah, IRAQ
Received: July 26, 2023; Accepted: January 14, 2024; Published: July 31, 2024
Copyright: © 2024 Boyane et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: The dataset underlying the results described in the manuscript can be found in a publicly available repository on GenBank (https://www.ncbi.nlm.nih.gov/genbank/) with the following accession numbers: OM281737, OM305088, OM307607, OM310763, ON231399, OM283546-OM283548, OM305092-OM305094, OM310986-OM310987, OM310994-OM310996, OM311261-OM311269, OM319823-OM319826, OM321361, OM321363-OM321366, ON209538-ON209540, ON220867, ON220869-ON220870, ON222735-ON222736.
Funding: Priyadarsanan Dharma Rajan received the funding from the Department of Biotechnology, Government of India, through the major research project titled “Bio-resource and Sustainable livelihoods in North-East India” (BT/01/17/NE/TAX). The sponsors did not play any role in the this study.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Species serve as the fundamental units of biodiversity [1], and reliable species delimitation and classification can enhance inferences in biosystematics and various other scientific fields, including biogeography, epidemiology, and conservation biology [2, 3]. However, accurate species delimitation often poses several conceptual and empirical challenges to biologists, which are further augmented while dealing with i) cryptic species [4], ii) lineages exhibiting shallow divergence [5], and iii) taxonomically complex systems [6]. Consequently, setting criteria for species delimitation has invoked a series of debates among systematic biologists in recent decades [7, 8]. A well-established species delineation criterion should be repeatable, provide independent assessments of morphologically defined lineages, and uncover previously unknown species [9]. Monophyly is one accepted criterion for supporting separate species [10]. However, taxonomic issues may arise when molecular phylogenies and morphological classifications are incongruent. In such cases, combining information from multiple yet conventionally disparate datasets and methodological approaches has proven useful in delineating species boundaries with better accuracy [11, 12].
Integrative taxonomy, which combines diverse datasets such as morphological, ecological, and molecular data (nuclear and mitochondrial DNA), has gained significant attention among biologists [13, 14]. This approach serves as a powerful tool for delineating species boundaries and offers a practical solution to the “taxonomic impediment,” a major obstacle in biodiversity research [15–17]. It allows researchers to harness the combined strength of various data types, including genetics, morphology, biochemical, and ecological information, to more accurately infer species boundaries [3, 18]. This approach is particularly relevant when inferences based on morphology fail, especially when dealing with lineages that contain species complexes or cryptic species [19, 20]. Thus, the integration of multiple datasets allows a more comprehensive understanding of the complex evolutionary processes that give rise to unrecognized species [21], such as ecological speciation [22] and incomplete lineage sorting [5]. This approach moves taxonomy beyond species descriptions and provides a more nuanced understanding of phylogenetic relationships within and between taxa.
The genus Coridius belonging to the family Dinidoridae is distributed throughout the Afrotropical (22 species), Australasian (1 species), Indomalayan (16 species), and Palearctic (2 species) realms, with 9 species known from India [23, 24]. These are phytophagous insects, primarily feeding on plants of the Arecaceae, Cucurbitaceae, Fabaceae, and Moraceae [25]. Although the host plants of many Coridius species are known [25], the life cycle and ecology of most species remain underexplored.
The genus Coridius is economically important, as species of this genus are widely consumed by the native people of northeast India. Members of this genus are also known for their various therapeutic properties [26]. These insects are collected from the dry riverbeds (Fig 1A and 1B), where they diapause during the winter, and are sold in local markets. However, the impact of this widespread consumption of Coridius on its population is not very well understood, and a lack of baseline information on the ecology and evolution of this group further hinders the development of any bioprospecting and conservation strategies.
(A) Natural habitat of Coridius spp. in Arunachal Pradesh. (B) Coridius spp. in a dry riverbed. (C) & (D) Collection localities of Coridius spp. across India. The map was created using QGIS Geographic Information System v3.28 by S. S. Boyane and does not include any copyrighted material. The SRTM file used in the map was obtained from the USGS server (public domain).
Until 1980, a total of 37 species of Coridius were described [27] based on their morphological characteristics, including traits such as coloration and male genitalia. However, several of these species were later synonymized or reassigned to other genera. Due to the intricate taxonomic complexities in Coridius, identifying species boundaries based solely on morphological and anatomical characteristics may be inadequate and could lead to further confusion. Moreover, Coridius species show a range of host preferences and cryptic morphological differences, making it an ideal study system to apply integrative taxonomic methods and reassess species boundaries.
In this context, to address the taxonomic complexities within the genus Coridius, we have set three primary objectives. Firstly, we aim to conduct a comprehensive systematic revision of Coridius species found in India, focusing on the highly diverse northeast region with improved sampling. Secondly, we intend to identify key morphological characters to verify previous systematic treatments of the genus. Lastly, we attempt to develop a multilocus phylogeny and employ species delimitation analysis based on molecular data as an additional test to gain confidence in the recognized species groups.
Material and methods
Taxon sampling
We collected 150 specimens from October 2018 to January 2021 from 21 different locations across India (Fig 1C and 1D). The collected specimens were preserved in absolute alcohol for morphological and molecular studies.
Nomenclatural acts.
The electronic edition of this article conforms to the requirements of the amended International Code of Zoological Nomenclature, and hence the new names contained herein are available under that Code from the electronic edition of this article. This published work and the nomenclatural acts it contains have been registered in ZooBank, the online registration system for the ICZN. The ZooBank LSIDs (Life Science Identifiers) can be resolved, and the associated information viewed through any standard web browser by appending the LSID to the prefix “http://zoobank.org/”. The LSID for this publication is: urn:lsid:zoobank.org:pub: 3BCC7D9C-FC18-4A74-B923-4900C8CDAD41.
Biodiversity board permits. For this study, all required permits were obtained from the respective biodiversity boards in the respective regions. In Arunachal Pradesh, permit number SFRI/APBB/9/2011/4019, issued by the Arunachal Pradesh Biodiversity Board. In Nagaland, permit number NSBB/31/PABR/2016/652, granted by the Nagaland State Biodiversity Board. In Manipur, the necessary permissions were obtained from the Manipur Biodiversity Board, permit number 3/31/2013-17/APCCF/BIO & NTFP: 67.
Morphological analysis
The collected specimens were mounted and studied under Zeiss Stemi 305. Photographs and measurements of the specimens were taken using Keyence VHX6000 and processed using Adobe Photoshop 2024. The last two abdominal segments were detached and boiled with 10% KOH for 10 minutes to separate the pygophore. The pygophore was then dissected to separate the parameres. The dissected specimen was briefly rinsed with dilute acetic acid and distilled water, followed by 70% alcohol, and then mounted again.
Abbreviations used for morphological characters (Fig 2): aa = anterior aperture; ab = abdomen; ap = apical tip; an = antenna; I–V = antennal segments; bu = buccula; ca = calli; co = corium; cl = clavus; cly = clypeus; cn = connexivum; dr = dorsal rim; ey = eye; fl = fore leg; h = head; hl = hind leg; im = inner margin; lb = labium; lp = left paramere; m = membrane; mdp = mandibular plate; ml = mid leg; mtg = meta thoracic scent gland; oc = ocelli; om = outer margin; pn = pronotum; py = pygophore; rp = right paramere; sc = scutellum; sp = spiracle; s2—s7 = abdominal sternite II–VII. The terminology used herein generally follows that of [28].
(A) dorsal habitus. (Scale bar = 5 mm) (B) ventral habitus (without legs). (C) head, dorsal view (Scale bar = 1 mm). (D) pygophore, dorsal view (Scale bar = 1 mm). (E) paramere, dorsal view (Scale bar = 1 mm).
Measurements for all species are given in the S1 File.
We measured the head length (HL) and head width to the eye (HW) to calculate the HL/HW ratio; similarly, we measured the length of pronotum (PL) and maximum width of pronotum (PB) to calculate the PL/PB ratio; length of scutellum (SL) and maximum width of scutellum (SB) to calculate the SL/SB ratio; maximum breadth of the body (MB); and total body length (TBL). Linear Discriminant Analysis (LDA) was performed using the morphological characters of 10 species. Two species (C. adii sp. nov., and C. assamensis) were dropped from LDA due to insufficient samples. The LDA was performed using R v.4.1.3 packages ‘klaR’ [29], ‘psych’ [30], ‘MASS’ [31], and ‘ggord’ [32].
DNA extraction and sequencing
Total genomic DNA was extracted from sternal muscles using the QIAGEN DNeasy blood and tissue kit following the manufacturer’s protocol. We PCR amplified and sequenced two mitochondrial loci, Cytochrome C Oxidase Subunit 1 (COI F: 5’ GGTCAACAAATCATAAAGATATTGG 3’, COI R: 5’ AAACTTCAGGGTGACCAAAAAATCA 3’) [33] and 16S rRNA subunit (16s F: 5’ CGCCTGTTTATCAAAAACAT 3’, and 16S R: 5’ CCGGTCTGAACTCAGATCACGT 3’) [34]. The PCR conditions for amplifying the COI consisted of an initial denaturation at 95˚C for 5.00 min, followed by 40 cycles at 94˚C for 30 s, 46˚C for 1.00 min, and 72˚C for 1.45 min, and a final extension at 72˚C for 15.00 min. Similarly, for the 16S initial denaturation, the temperature was set at 95˚C for 5.00 min, followed by 40 cycles of denaturation at 95˚C for 30 sec, an annealing temperature at 53˚C for 1.00 min, and 72˚C for 1.30 min, followed by a final extension at 72˚C for 10 min. We could not sequence any nuclear genes due to the lack of a comprehensive dataset available in GenBank. All PCR products were purified and sequenced in the Barcode Biosciences laboratory (Bengaluru, India). The resulting DNA sequences were deposited in GenBank (see Table 1).
Sequence alignments
Sequences were obtained from 22 specimens consisting of eight species (Table 1). Additionally, we retrieved 19 sequences of Coridius and 20 sequences belonging to Pentatomoidea and Lygaeoidea and treated them as outgroups from the GenBank. The sequenced chromatograms were manually inspected for quality and aligned using the software program Geneious Version 2023.1.1. The gaps in sequences were treated as “missing”.
Phylogenetic analysis
The phylogenetic analysis was conducted based on a total of 61 sequences from 11 species of Coridius. The final combined alignment consists of 1002 nucleotides, of which 248 sites were parsimony informative. The best-fit nucleotide substitution model for Bayesian inference was selected for both genes based on the Bayesian information criterion (BIC) in PartitionFinder 2.0 [35] (Table 2). The HKY+I+G substitution model was assigned to the first codon position, and the TRN+G model was assigned to the second and third codon positions for COI. The HKY+I+G substitution model was assigned for the first, second, and third codon positions in 16s. We ran maximum-likelihood (ML) analyses in IQ-Tree Web Serve [36] with 1000 bootstrap replicates under the GTRGAMMA substitution model in the combined dataset. A Bayesian inference (BI) was performed in the software program MrBayes 3.2.1 [37]. Four independent chains of Markov chain Monte Carlo (MCMC) were performed for 50 million generations with a sampling frequency of 500. The convergence of MCMC chains was assessed in Tracer [38]. The first 25% of the runs were discarded, and the remaining trees were used to build a consensus tree and estimate Bayesian posterior probabilities (PP). We used FigTree 1.4.4 [39] to visualize and edit the phylogenetic trees.
Species delimitation.
Molecular species delimitation analyses were conducted using the Bayesian Poisson Tree Processes (bPTP) method through the online web server available at http://species.h-its.org/. The analyses consisted of 100,000 Markov Chain Monte Carlo (MCMC) generations with a thinning parameter set to 100 and a post-burn-in value of 0.1. Additionally, a single-rate PTP analysis was performed using the ML tree generated from IQTREE (https://mptp.h-its.org/#/tree), with the default p-value settings [40]. To further support our species delimitation method, we employed the Assemble Species by Automatic Partitioning (ASAP) analysis, utilizing the genetic distance matrix method [41]. This analysis was conducted through a web-based interface accessible at https://bioinfo.mnhn.fr/abi/public/asap/, after setting the default parameters. For this analysis, we selected the Kimura (K80) (TS/TV) 2.0 model. The best two ASAP scores resulting from this analysis have been referred to as ASAP 1 and ASAP 2.
Results
Linear Discriminant Analysis (LDA)
The first two linear discriminant axes for the LDA are presented in Fig 3. These axes cumulatively explain 94.16% of the total variance (76.42% and 17.74%, respectively). Based on prior knowledge, we assigned ten groups, out of which eight were distinctly clustered. These clusters include the species C. chinensis (Dallas, 1851), C. esculentus sp. nov., C. insperatus sp. nov., C. fuscus (Westwood, 1837), C. ianus (Fabricius, 1775), C. laosanus (Distant, 1921), C. nepalensis (Westwood, 1837), and C. sanguinolentus (Westwood, 1837). On the other hand, C. brunneus (Thunberg, 1783) and C. singhalanus (Distant, 1900) do not form distinct clusters, as they overlap with each other (Fig 3). Four characters that were morphologically significant in species differentiation were recognized by the LDA. These include the total body length (TBL), the maximum body breadth (MB), and the pronotum and scutellum’s length and breadth ratios (PL/PB and SL/SB, respectively). The scatter diagram, histogram of the distribution of a single variable, and correlation values for each variable are provided in S1 and S2 Figs.
The percentage separation achieved by the first two linear discriminant functions is 76.42% for axis 1 and 17.74% for axis 2, respectively. Because of the limited sample, C. adii sp. nov., and C. assamensis (Distant, 1902) were excluded from LDA.
Phylogenetic inference
Maximum Likelihood (ML) and Bayesian Inference (BI) tree analyses of two concatenated genes (COI and 16S) showed similar topologies with high support (maximum likelihood bootstrap support, MLBS) values and posterior probabilities (PP) (Fig 4). Lygaeidae was used as the root for the tree. The family-level relationship showed Urostylididae (PP: 1, MLBS: 95) as the sister taxa to all other Pentatomoidea in both analyses. Also, we found clear evidence of Tessaratomidae (PP: 1, MLBS: 99) being a sister taxon to Dinidoridae (PP: 0.99, MLBS: 96). Furthermore, the monophyly of Thyreocoridae (PP: 0.62/76), Cydnidae (PP: 0.94, MLBS: 87), and Pentatomidae (PP: 0.62, MLBS: 77) were consistent in both analyses. Finally, Pentatomidae (PP: 0.62, MLBS: 77) were recovered as the sister taxon to the group comprising Cydnidae, Thyreocoridae, Tessaratomidae, and Dinidoridae.
Support values above and below nodes: Bayesian posterior probabilities (top) with <0.90 denoted as (*), and maximum likelihood bootstrap values (bottom). On the right side of the figure, morpho-species assignments and the results of species delimitation tests are displayed: PTP (13 taxa grouping), bPTP (14 taxa grouping), ASAP 1 (14 taxa grouping, with an ASAP score of 9.5), and ASAP 2 (25 taxa grouping, with an ASAP score of 11.0). A white gap in the morphology column indicates the unavailability of voucher specimens. Parameres for C. adii sp. nov., C. chinensis complex, C. esculentus sp. nov., and C. insperatus sp. nov. are shown (for more information on parameres, refer to Figs 12 and 17).
The species-level relationship showed the monophyly of C. insperatus sp. nov. (PP: 1, MLBS: 100) and C. nepalensis (PP: 1, MLBS: 100) received strong support, indicating their distinct evolutionary lineages. Similarly, C. singhalanus (PP: 1, MLBS: 100) and C. brunneus (PP: 1, MLBS: 100) were supported as monophyletic groups. Moreover, C. adii sp. nov. (PP: 0.99, MLBS: 99) was found to be closely related as a sister group to C. singhalanus (PP: 1, MLBS: 98). In our analysis, we found that C. nigriventris is in a polytomy with one specimen of C. ianus. The most widespread species within this genus, Coridius chinensis, is paraphyletic, with at least six clades. Interestingly, C. esculentus sp. nov. was found to be grouped within a clade alongside C. chinensis but formed a distinct branch (PP: 0.82, MLBS: 52). This outcome was in accordance with our expectations, as C. chinensis and C. esculentus sp. nov. have similar coloration but differ significantly in anatomy (see the discussion section and Fig 4). Furthermore, our investigation revealed that the African species C. viduatus and C. ianus form a sister group (PP: 1, MLBS: 100), aligning with our expectations due to their striking morphological similarity (Fig 4).
Species delimitation and new lineages.
The estimated molecular operational taxonomic units (MOTUs) were not consistent among the methods: 13 for PTP, bPTP for 14, ASAP 1 for 14, and ASAP 2 for 25 (excluding out-groups) (Fig 4). The species status of C. insperatus sp. nov. was supported by the analysis. Coridius nepalensis and all undetermined species were treated as a single species in the analysis. In the analysis, PTP, bPTP, and ASAP 1 suggested grouping four species, namely C. singhalanus, C. adii sp. nov., C. assamensis, and C. chinensis, as a single species, whereas ASAP 2 proposed each of these species should be considered distinct species. Similarly, C. esculentus sp. nov. is found nested with four other individuals of C. chinensis, forming a well-supported clade in the phylogenetic analysis (PP: 0.99, MLBS: 95). Both ASAP 1 and ASAP 2 have recognized them as distinct species. Coridius nigriventris (JQ387600) clustered with C. ianus (KU043393) in ML and BI topologies, while the PTP and bPTP analyses suggest these to be two separate species.
Interestingly, our analysis showed that C. chinensis belongs to a taxonomic species complex forming six different lineages. The first lineage was composed of a single specimen found in Arunachal Pradesh. The second lineage included two specimens from Guizhou Province, China (KJ603304 and KJ603305) and one from Manipur, India. The third lineage consisted of a single specimen found in Nagaland. The fourth lineage was formed from two specimens from Manipur and three from China (JF700134, JF700135 and JF700136) with strong node support (PP: 0.99, MLBS: 98). The fifth lineage included three specimens from Nagaland (C. chinensis 4; C. chinensis 3; and C. chinensis 5) and C. chinensis (JQ387599) from China. The sixth lineage consisted of a single specimen from Kerala, India, C. chinensis (KU043392).
Taxonomic treatment
Family Dinidoridae Stål, 1870
Subfamily Dinidorinae
Tribe Dinidorini
Genus Coridius Illiger, 1807
Coridius llliger, 1807: 361; Schumacher, 1924: 335; Bergroth, 1927: 7; Yang, 1940: 6–10; Hoffmann, 1948: 21, 22; Stichel, 1962: 725; Nuamah, 1982: 24, 25; Durai, 1987: 185–190; Rolston et al., 1996: 31–33, 97; Lis, 1996: 51–54, Figs 1–8; Ahmad et al., 1997: 305–320, Figs 1–4; Kocorek, 2003: 51–55, Figs 1–5. Type species: Cimex ianus Fabricius, 1775 by monotypy.
Aspongopus Laporte, 1832: 58; Burmeister, 1835: 347, 351; Spinola, 1837: 304, 305; Amyot & Serville, 1843: XXIX, 173; Herrich-Schäffer, 1844: 77; Agassiz, 1846: 3; Spinola, 1850: 33; Dallas, 1851: 318, 348; Herrich-Schäffer, 1851: 282; Fieber, 1860: 79; 1861: 330; Stål, 1865: 81, 212; Mulsant & Rey, 1866: 234; 1867: 157; Stål, 1867: 522; Vollenhoven, 1868: 38; Walker, 1868: 480; Stål, 1872: 40; Puton, 1886: 15; Atkinson, 1889: 87; Lethierry & Severin, 1893: 236; Distant, 1902: 279, 281; Oshanin, 1906: 161; Bergroth, 1908: 188; Kirkaldy, 1909: 255; Schouteden, 1909: 71; Oshanin, 1912: 19; Jeannel, 1913: 100; Kirkaldy, 1913: 84; Schouteden, 1913: 6, 7; Hesse, 1925: 41; Tang, 1935: 335; Cachan, 1952: 294; Villiers, 1952: 86; Priesner & Alfieri, 1953: 12; Cobben, 1968: 112, Figs 114A, 114B; Hsiao et al., 1977: 69, 70. Type species: Cimex janus Fabricius, 1775, by monotypy. Synonymized by Schumacher, 1924: 335.
Spongopodium Spinola, 1837: 305; Agassiz, 1846: 18; Spinola, 1850: 33. Type species: Cimex obscurus Fabricius, 1794, by monotypy. Synonymized by Stål, 1865: 212.
Amacosia Spinola, 1850: 78. Type species Amacosia delegorguei Spinola, 1850 by monotypy. Synonymized by Walker, 1864: 480.
Aspongobus [sic] Dohrn, 1859: 21.
Peltagopus Signoret, 1861: 936. Type species: Peltagopus flavomarginatus Signoret 1861 by monotypy. Synonymized by Stål, 1865: 212.
Aspongopus (Aspongopus) Stål, 1870: 81; Schouteden, 1913: 7.
Synonymy used here and henceforth is based on Lis [24], Durai [27], and Rolston et al. [42].
Diagnosis.
Head small, triangular, broader than long, mandibular plates longer than clypeus, rounded, and meeting or not in front of clypeus. Ocelli prominent, placed closer to eyes than to each other. Eyes globular, pedunculate. Labium four segmented, reaching about middle of meso-sternum, first and second segment mostly sub-equal, third and fourth smaller and sub-equal. Bucullae prominent, raised above the level of labium. Antennae four or five segmented, first segment surpassing apex of head, second and third subequal or sometimes second longer or shorter than third, fourth generally long with setae on both sides, fifth cylindrical, and finely setose. In some species second, third and fourth antennal segments grooved and flattened.
Pronotum declivous, trapezoidal. Lateral margins straight or rounded, sometimes slightly raised or carinate; dorsally rugulose punctate. Calli rugulose and smooth. Anterior margin concave behind head. Anterior angles slightly broader than width at eye. Humeral angles rounded, slightly truncate. Posterior margin moderately straight over scutellum.
Scutellum broader than long, longer than clavus, lateral margin distinctly sinuate, and its apical region broadly rounded.
Hemelytra longer than abdomen. Clavus narrow, short, corium broad. Membrane long and broad with numerous longitudinal veins.
Pro-sternum deeply sulcate mesially, its lateral area distinctly raised or flat, posterior margin slightly sinuate in lateral region. Pro-coxal area distinctly raised, pro-coxae very close together. Meso-sternum smooth on disk with median groove and longitudinal rugae. Meta-sternum very narrow between coxae. Metathoracic scent gland situated close to metacoxae, more ventral in position with narrow peritreme and well-developed evaporatoria.
Coxae close together in a linear series. Femora slightly curved or straight with spines underneath in distal half, tibiae distinctly sulcate and with spines distally. First segment of tarsus more setose, second and third with very sparse, long setae. Claws divergent, pulvilli distinct, well developed. Hind tibia in females slightly dilated and with oval tympanal organ.
Abdomen broad, connexivum moderately or well exposed. Segmental sutures sinuate, seventh sternum longest. Spiracles black, situated closer to anterior margin than lateral margin of segment. Spiracle of first visible abdominal segment partially or totally covered by metasepimeron. Trichobothria distributed in pairs posterior to pseudosutures and spiracle.
Pygophore visible from dorsal as well as from ventral sides, basally convex, flat in distal half, ventral surface rugulose; ventral rim rounded or notched medially or sometimes raised or concave or straight; dorsal rim moderately concave or straight. Parameres short or slender, apical tip rounded or blunt or pointed.
Coridius insperatus Boyane, Ghate & Priyadarsanan, sp. nov. urn:lsid:zoobank.org:act:69C0D1FA-D2E0-4CD6-A1B3 9CAEE189EA15 (Figs 5A, 6A, 9A, 10A, 11A and 12A).
Dorsal habitus of Coridius spp. (A) C. insperatus sp. nov., (B) C. adii sp. nov., (C) C. esculentus sp. nov., (D) C. nepalensis. (E) C. singhalanus. (F) C. brunneus. (G) C. assamensis (antennae mutilated). (H) C. ianus. (I) C. fuscus. (Scale bar = 5 mm).
(A) C. insperatus sp. nov., (B) C. adii sp. nov., (C) C. esculentus sp. nov., (D) C. nepalensis. (E) C. singhalanus. (F) C. brunneus. (G) C. assamensis (antennae mutilated). (H) C. ianus. (I) C. fuscus. (Scale bar = 5 mm).
Etymology. The species name is the Latin adjective insperatus (meaning ‘unexpected’ in Latin) because it is an unexpected member of the genus Coridius with four segmented antennae.
Material examined: Holotype male. INDIA: Arunachal Pradesh, Nirjuli, leg. Anil Talang, 1.i.2019, 27.128°N, 93.742°E, 139 m.
Paratypes. Same collecting data as holotype: 1 F.—INDIA: Arunachal Pradesh, Tippi, leg. Thejavikho Chase, 30.xi.2020, 27.026°N, 92.610°E, 179 m: 1 F.—INDIA: Arunachal Pradesh, Tutting, leg. Gumnya Ete, 13.xii.2019, 28.982°N, 94.905°E, 485 m: 1 F.—INDIA Arunachal Pradesh, Yingkiong, leg. Gumnya Ete, 12.xii.2019, 28.635°N, 95.024°E, 275 m: 1M.
Diagnosis. Overall colour yellowish brown. Pronotum ventrally pale yellowish brown, lateral margins black. Legs yellowish brown, femora slightly darker. Antennae with first segment basally ochraceous, distally dark brown, second and third black, fourth ochraceous except a minute region at base and apex which are black. Pronotum with a levigate pale line from posterior region of calli to posterior pronotal margin (Fig 5A). Spiracles black, encircled by a pale ring.
Description. Overall structure, Body finely punctate; pronotum with a few transverse rugae in posterior two thirds; region around calli smooth, shining, with sparse punctures. Scutellum rugulose punctate in basal two third, apical region granulated. Prosternum with a distinct elevated smooth region on either side of median groove, laterally rugulose and coarsely punctate. Meso- and meta-sterna smooth medially, rugulose and coarsely punctate in pleural regions. Body nearly smooth medially on abdominal sternites, very finely punctate laterally. Legs laterally compressed; tibiae distinctly sulcate and spinose dorsally and ventrally, more compressed than femora; femora with ventral spines; first segment of tarsus densely setose, second and third with very sparse, long setae; claws widely separated, dark brown to black in distal half; pulvilli distinct, well developed (Figs 5A and 6A).
Head transverse, two times wider than longer at eyes, mandibular plates much longer than clypeus, parallel sided, rounded anteriorly and reaching in front of clypeus (Fig 9A). Dorsal surface of mandibular plates with irregular folds and scattered punctures. Vertex coarsely punctate medially, with longitudinal rugae and grooves near eyes. Eyes large, globular and pedunculate. Ocelli well developed, slightly elevated. Interocellar distance 1.51 times distance between eyes and ocelli. Antennae four segmented, first segment cylindrical with few setae, surpassing apex of head, second and third distinctly laterally compressed, second segment with many setae and longitudinal grooves in basal one fourth with fine spine like setae on the sides, third segment finely rugulose, with spine-like setae on both sides, slightly dilated in basal half while fourth segment rounded, gradually tapering, finely punctate and covered with numerous small and sparse, long setae.
Labium four segmented, reaching middle of meso-sternum; first and second segments sub-equal, third (0.81 mm) and fourth (0.64 mm) smaller. Bucculae prominent, raised above the level of labium.
Pronotum rugulose punctate, calli less punctate, somewhat shining. Anterior margin of pronotum concave behind head, slightly truncate medially behind eyes. Width at anterior angles of pronotum only slightly wider than width at eyes. Lateral margins straight, slightly raised. Humeral angles rounded, posterior margin straight. Prosternum deeply sulcate in middle, its sides distinctly raised. Posterior margin of pro-sternum slightly sinuate in lateral parts. Pro-coxal area distinctly raised, pleural area coarsely punctate and rugulose, closer to coxae. Mesosternum smooth medially with shallow groove in anterior three fourth and slightly deeper groove in distal one fourth, especially near meso coxae. Pleural area coarsely punctate and rugulose. Metasternum very narrow between coxae, metasternum not covering spiracle of first visible abdominal segment posteriorly, leaving it partly exposed.
Scutellum triangular, median region elevated, lateral margins distinctly sinuate in the middle, apical region broadly rounded. Apical area finely punctate and rugulose, with coarse punctures. Median levigate line in basal half continuing pronotal levigate line.
Hemelytra. Clavus narrow, short, corium very broad, very finely and closely punctate and rugulose, punctures at margins slightly coarse. Membrane long and broad with numerous longitudinal veins and three basal cells. Hemelytra longer than abdomen. Extreme basal region of corium upturned forming shallow groove, its margin black, similar to that of pronotum, remaining margin of corium flat.
Abdomen broad, with sinuate intersegmental sutures sinuate, seventh sternum longest. Spiracles situated closer to anterior margin than to lateral margin of segment. Trichobothria distinct, a pair situated posteriorly to pseudosuture, which is posterior to spiracle.
Male genitalia. Pygophore 0.91 times wider than long, somewhat rectangular, and sclerotized. Basally convex, flat in distal half, ventral surface rugulose and ventral margin with fine black denticulation, with sparse setae. Ventral rim with rugae and numerous long ochraceous setae (Fig 10A), ventrally convex and smooth (Fig 11A). Parameres sclerotized, short, medially rounded and apically narrowing, apical tip with rugae and setae (Fig 12A).
Geographical distribution. Presently known only from Arunachal Pradesh, India.
Remarks. Coridius insperatus sp. nov., is a very distinct species compared to other congeneric species. It can be easily distinguished by its four segmented antennae and cupreous dorsal colouration, while all other species in the genus are dark brown, yellow to black dorsally, and have five segmented antennae. In the family Dinidoridae, the genus Amberiana Distant, 1911, has one species with four segmented antennae (A. major Schouteden, 1912), while other species (A. montana Distant, 1911) have five segmented antennae [23, 24].
This species is edible and consumed by the Nyishi and Adi tribes of Arunachal Pradesh. In addition, we found that this species is sold in the Nirjuli local market (Dist. Itanagar, Arunachal Pradesh) during the winter season (October–January).
Coridius adii Boyane, Ghate & Priyadarsanan, sp. nov. urn:lsid:zoobank.org:act:2A940B0F-7D83-4975-83EE-04718495F7C9 (Figs 5B, 6B, 9B, 10B, 11B and 12B).
Etymology. This species is dedicated to the Adi tribe, one of the populous groups of Arunachal Pradesh, inhabiting mainly along the Siang valley, who consume this species for food.
Material examined: Holotype male. INDIA: Arunachal Pradesh, Rani Village, Pasighat, leg. Swapnil Boyane, 1.x.2018, 27.9653°N, 95.316°E, 139 m. Female unknown.
Diagnosis. Overall pale brown to dark brown with irregular patches of yellow on pronotum, and corium. Lateral margins of pronotum black, pronotum with a levigate pale line from posterior region of calli to mid-point of its length. First four segments of antennae black, minute regions at base and apex are ochraceous, fifth ochraceous except a minute region at base and apex which are brown (Figs 5B and 6B). Connexival segments with yellow spot in between segmentation; ventrally, dark brown. Labium pale brown. Pleural area and area near spiracles dark brown or blackish brown. All legs yellowish brown, femora slightly darker, claws dark brown to black in distal half.
Description. Overall structure. Body finely punctate, region around calli smooth, shining; scutellum punctate rugulose, its apical region somewhat rounded. Prosternum with smooth flat region on either side of the median groove, laterally rugulose and coarsely punctate. Meso and metasternum smooth.
Head transverse, 1.92 times wider than long, mandibular plates longer than clypeus, rounded anteriorly and meeting in front of clypeus (Fig 9B), dorsally with irregular folds and scattered punctures and very sparse golden setae. Eyes globular and pedunculate. Ocelli prominent, interocellar distance 2.16 times distance between eyes and ocelli. Antennae five segmented, first segment (0.87 mm) cylindrical with sparse setae surpassing apex of head, second (1.59 mm) and third (1.64 mm) subequal, compressed; second, third and fourth segments with longitudinal grooves and fine spine-like setae on the sides, fourth segment slightly dilated in basal half, fifth finely covered with numerous small and sparse long setae, pointed at the tip.
Labium four segmented, reaching anterior third of mesosternum. First (0.94 mm) and second (1.04 mm) segments subequal, third (0.80 mm) and fourth (0.72 mm) smaller, sub-equal. Bucculae prominent, raised above the level of labium.
Pronotum declivous, rugulose, punctate, somewhat shining. Anterior margin of pronotum concave behind head. Lateral margins almost straight, slightly raised. Humeral angles rounded, posterior margin of pronotum straight. Prosternum sulcate in the middle, its lateral area flat. Meso and metasternum smooth on disk with a shallow, rugulose median groove.
Scutellum 0.95 times longer than broad, apex broadly rounded, finely punctate, and longitudinally rugulose.
Hemelytra shorter than abdomen, clavus narrow, short, corium broad, finely, and closely punctate, rugulose. Membrane long and broad with numerous longitudinal veins. Legs laterally compressed; femora with spines ventrally, tibiae distinctly sulcate and spined ventrally as well as dorsally; first segment of tarsus densely setose, second and third with very sparse long setae; claws widely separated, pulvilli distinct, well developed.
Abdomen broad, seventh sternum longest. Spiracles black, closer to anterior margin than lateral margin of respective segment. Trichobothria distinct with a pair situated behind the pseudosuture, posterior to spiracle.
Male genitalia. Pygophore longer than broad, sclerotized, basally convex, flat in distal half. Ventral rim slightly notched, irregular and without setae (Fig 10B), ventrally convex, smooth (Fig 11B). Parameres broad, medially rounded, irregular on outer margin and apically narrowing with numerous long setae (Fig 12B).
Geographical distribution. India. This species is known only from its type locality (Pasighat: Arunachal Pradesh).
Coridius esculentus Boyane, Ghate & Priyadarsanan sp. nov. urn:lsid:zoobank.org:act:47A61F00-13F6-42C2-A9AF-A1C1BB853657 (Figs 5C, 6C, 9C, 10C, 11C and 12C).
Etymology. The species name ‘esculentus’ is the Latin adjective for edible, denoting its delicacy.
Material examined: Holotype male. INDIA: Arunachal Pradesh, Nimte, leg. Nikhil Joshi, 19.x.2018, 27.231°N, 93.552°E, 775 m.
Paratypes. Same collecting data as holotype; 3 M, 7 F.
Diagnosis. Dorsally bronzy black, antennae black, except fifth segment which is ochraceous with black base. Legs dark brown, mid- and hindcoxae are pale brown. Lateral margins of connexivum black. Ventrally rostrum, pleural area and last two segments of abdomen are blackish brown. Mid- and hind-coxae pale brown. Second to fourth abdominal segments brown (Figs 5C and 6C).
Description. Head transverse, 1.32 times wider than longer. Lateral margins in front of eye distinctly sinuate so that apex of head looks rounded (Fig 9C). Mandibular plates longer than clypeus, coarsely punctate. Clypeus transversely ridged. Eyes moderately large, pedunculate. Ocelli prominently closer to eyes than to each other; interocellar distance 1.61 times distance between eyes and ocelli. Antennae with scattered black setae especially on second to fourth segments and a few on fifth. First segment slightly surpassing apex of head, rounded, second, third and fourth laterally compressed, flattened with medial depression; fourth longest, slightly dilated beyond middle, fifth segment fusiform. Labium four segmented, first segment reaching base of head, second segment longest reaching base of fore coxae, third and fourth segment equal in length with fine setae.
Pronotum rhomboidal; anterior margin medially rounded behind head, anterior angles obtuse, lateral margins straight, raised as carinae; surface evenly punctate and rugulose; callus smooth, rugulose without punctures. Humeral angles rounded, faintly raised dorsally. Prosternum deeply punctate mesially. Mesosternum medially sulcate with two broad shining smooth patches on either side of midline. Metasternum narrow with a medial sulcus between metacoxae.
Scutellum punctate, apex broadly rounded.
Hemelytra. Clavus broad at base, narrowed distally and shorter than scutellum; corium broad, finely rugulose punctate. Membrane broad, with a series of basal cells and many parallel longitudinal veins. Hemelytra surpasses abdominal apex.
Legs. Femora laterally compressed. Tibiae sulcate with numerous spines. Tarsi well developed, first and third segments equal with long setae, middle shortest; first segment with dense setae underneath, claws and pulvilli well developed; claws divergent.
Abdomen very finely rugulose, though appear smooth, slightly punctate medially. Seventh sternum longest, posterior third rugulose, covering convex ventral portion of pygophore. Exposed portion of pygophore finely rugulose. Spiracles prominent. Trichobothria as usual for the genus with a pair posterior to spiracles.
Male genitalia. Pygophore black, posterior half more sclerotized than anterior, moderately convex ventrally (Fig 11C). Ventral rim slightly convex, denticulate (Fig 10C), dorsal rim rounded, with punctures. Parameres short, highly sclerotized, rugose, broad and apically rounded, outer margin slightly serrated and setose apically, inner margin straight (Fig 12C) and without a basal lobe.
Geographical distribution. Presently known only from Arunachal Pradesh, India.
Remarks. This species is a delicacy among the ethnic communities. Consumption in large quantities can be neurotoxic, and the person becomes photophobic, such as wanting to hide under the carpet or cot; or, as the people believe, ‘they begin to act like the bug, which hides under the stones or goes into cracks. If medical treatment is not sought, this behaviour can remain for a longer period, like for many months or even longer (personal communication with native people). The chemicals secreted by the bugs through the metathoracic glands might be the reason for intoxication.
Coridius laosanus (Distant, 1921) (Figs 7A and 7F, 8A, 9J).
(A) C. laosanus. (B) C. sanguinolentus (Paralectotype). (C) C. nigriventris (Lectotype). (D) C. singhalanus (Lectotype). (E) C. chinensis (Paralectotype). (F) C. laosanus (Lectotype). (G) Antenna of C. esculentus sp. nov., (H) Antenna of C. chinensis.
(A) C. laosanus. (B) C. sanguinolentus (Paralectotype). (C) C. nigriventris (Lectotype).
(A) C. insperatus sp. nov., (B) C. adii sp. nov., (C) C. esculentus sp. nov., (D) C. nepalensis. (E) C. singhalanus. (F) C. brunneus. (G) C. assamensis. (H) C. ianus. (I) C. fuscus. (J) C. laosanus. (K) C. chinensis. (Scale bar = 1 mm).
Aspongopus laosanus Distant, 1921: 167; Hoffmann, 1935: 119.
Coridius laosanus Yang, 1940: 7; Durai, 1987: 188, 199, 200, Figs 184, 185; Lis, 1990: 141; 1992: 38; Kocorek, 2003: 51, 55.
Material examined (images): Lectotype male: Aspongopus laosanus Distant, R. Kumar det. 1973, LECTOTYPE // Type H. T. // Haut Mekong: Muong Sing, 6. VI. 1919., R. V. de Salvaza. // Aspongopus laosanus type Dist.
Material examined. NE LAOS: Houaphanh Province, Mt. Phu Pane, 27.12°N, 103.58°E, 22. V. 2011, 1200–1600 m. Donated by Dr. Marcos Roca-Cusachs.
Diagnosis. Head, antennae, and rostrum black; pronotum blackish brown with reddish orange stripe along lateral margins; connexivum completely reddish orange; scutellum concolorous with pronotum disk; corium black with basal third reddish orange; costal margin extending along connexivum and membrane black (Fig 7A). Legs blackish brown. Venter blackish brown, with reddish orange stripe along lateral margins.
Head wider than long, mandibular plates longer than clypeus, rounded anteriorly and meeting in front of clypeus (Fig 9J). Eyes globular, pedunculate. Ocelli well developed, closer to the eyes than to each other; interocellar distance 1.75 times distance of between eyes and ocelli (Fig 9J). Labium four segmented, reaching anterior margin of meso coxae. First segment extending beyond head.
Geographical distribution. China, India, Laos, Thailand, and Vietnam [24, 27, 42].
Remarks. This species was described from Laos and is known only from its type locality. Lis [24] mentioned that this species is present in India without any further information. In their world catalogue, Rolston et. al., [42] also mentioned China and Vietnam. Later, Kocorek [43] reported this species for the first time from Thailand. The specimens used here were donated by Marcos Roca-Cusachs, which were collected from the Laos and are identical to the holotype, as observed from images (Fig 7A and 7F).
Coridius sanguinolentus (Westwood, 1837) (Figs 7B and 8B) (Paralectoype images).
Aspongopus sanguinolentus Westwood, 1837: 26; Dallas, 1851: 350; Walker, 1868: 483; Stål, 1870: 85; Atkinson, 1889: 89, 90; Lethierry & Severin, 1893: 238; Distant, 1901: 819; 1902: 284; Kirkaldy, 19090: 257; Hoffmann, 1932a: 9; 1932b: 140; Wu, 1933: 216; Chatterjee, 1934: 27; Hoffmann, 1935: 120; Yang, 1962: 46, 49, pl. 4, Fig 32; Zhang, 1985: 54, pl. 47, Fig 159; Hua, 1989: 43.
Aspongobus [sic] sanguinolentus Dohrn, 1859: 21.
Aspongopus circumcinctus Walker, 1868: 483; Atkinson, 1889: 91; Lethierry & Severin, 1893: 236; Distant, 1900: 233; 1901: 104. Synonymized by Distant, 1902: 284.
Aspongopus (Aspongopus) sanguinolentus Schouteden, 1913: 9; Tang, 1935: 356.
Coridius sanguinolentus Yang, 1940: 10, 22, 23, Fig 7; Hoffmann, 1948: 23; Stichel, 1962a: 725; 1962b: 205; Durai, 1986: 6; 1987: 188, 206, Figs 212, 213; Lis, 1990: 115, 142.
Material examined (images): Paralectotype Female: INDONESIA: Java. Labels: TYPE HEM.: No 117 ½, Aspongopus sanguinolentus Westwood, HOPE DEPT.OXFORD // “TYPE., WESTW." (HOPE), C. Hemipt. 1837, Part I, page 26, Distant, P.Z.S., 1900, p. 807–825, // aspongopus sanguinolentus Westw // Type // Aspongopus sanguinolentus Westw., R. Kumar 1973, PARALECTOTYPE.
Diagnosis. Entirely reddish brown with connexivum and a broad lateral abdominal patch reddish-ochraceous (Fig 8B). Head triangular, mandibular plates longer than clypeus. Ocelli reddish brown. Antennae black, five segmented, first segment surpassing apex of head, second and third subequal, fourth longest. Pronotum declivous, lateral margins rounded raised and reddish in color, anterior margin concave, posterior margin straight. Scutellum broad, apically rounded. Femora inwardly curved with spines.
Geographical distribution: China, India (Assam and Uttarakhand), Indonesia, Myanmar, Vietnam [24, 27, 42].
Coridius nigriventris (Westwood, 1837) (Figs 7C and 8C) (Lectotype images).
Aspongopus nigriventris Westwood, 1837: 26; Dallas, 1851: 349; Vollenhoven, 1868: 39; Walker, 1868: 482; Stål, 1870: 85; Distant, 1879: 45; Atkinson, 1889: 89; Kirby, 1892: 88; Lethierry & Severin, 1893: 237; Breddin, 1900: 331, 332; Distant, 1901: 819; 1902: 284; Kirkaldy, 1909: 256; Schumacher, 1917: 446; Distant, 1921: 166; Hoffmann, 1935: 120; Villiers, 1952: 85; Yang, 1962: 48; Hsiao et al., 1977: 70, pl. 8, Fig 122; Datta et al., 1985: 5, Fig 8; Zhang & Lin, 1988: 85; Hua, 1989: 43.
Aspongobus [sic] nigriventris Dohrn, 1859: 21.
Aspongopus (Aspongopus) nigriventris Schouteden, 1913: 8.
Coridius nigriventris Yang, 1940: 7, 10, 21, 22, Fig 6; Hoffmann, 1948: 23; Schaefer & Ahmad, 1987: 30; Zhang & Lin, 1987: 76.
Coridius nepalensis Durai, 1987: 198; Rolston et al., 1996: 42, 43, 100.
Material examined (images): Lectotype female. INDIA: Labels: TYPE WESTW. (HOPE), C. Hemipt. 1837, Part I, page 26, Distant, P.Z.S., 1900, p. 807–825 // Type // nigriventris, West // Ind. Orient. // aspongopus nigriventris Westw. // TYPE HEM: No. 116, Aspongopus nigriventris, Westwood, HOPE DEPT. OXFORD // Aspongopus nigriventris Westwood, R. Kumar 1973, LECTOTYPE.
Diagnosis. Entire body blackish brown except coria and ocelli which are paler. Connexivum without yellow spots in between segmentation. Body oval, lateral margin of pronotum rounded; anterior margin slightly concave and posterior margin rounded; lateral margins raised and brown in colour. Antennae five segmented, first segment surpasses apex of head, second 0.84 times longer than third, fourth longest and laterally compressed. Femora slightly curved inwards. First segment of tarsus densely setose, second and third with very sparse long golden setae.
Geographical distribution. India (Kerala and Maharashtra) [42].
Remarks. This species was described as Aspongopus nigriventris (= Coridius nigriventris) by Westwood in 1837 from India. The exact type locality was not mentioned in the original description. Durai synonymized this species with C. nepalensis in 1987, considering the similarity of the aedeagus with the latter. However, in this study, we used the sequence deposited as C. nigriventris (accession #JQ387600) in GenBank for molecular analysis. We found that C. nigriventris and C. nepalensis form separate lineages (see Fig 4). Additionally, upon comparing type images, we noted some morphological differences. Therefore, we reinstate the status of C. nigriventris as a valid species.
Coridius nepalensis (Westwood, 1837) (Figs 5D, 6D, 9D, 10D, 11D and 12D).
(A) C. insperatus sp. nov., (B) C. adii sp. nov., (C) C. esculentus sp. nov., (D) C. nepalensis. (E) C. singhalanus. (F). C. brunneus (G) C. assamensis. (H) C. ianus. (I) C. fuscus. (Scale bar = 1 mm).
(A) C. insperatus sp. nov., (B) C. adii sp. nov., (C) C. esculentus sp. nov., (D) C. nepalensis. (E) C. singhalanus. (F) C. brunneus. (G) C. assamensis. (H) C. ianus. (I) C. fuscus. (Scale bar = 1 mm).
(A) C. insperatus sp. nov., (B) C. adii sp. nov., (C) C. esculentus sp. nov., (D) C. nepalensis. (E) C. singhalanus. (F) C. brunneus. (G) C. assamensis. (H) C. ianus. (I) C. fuscus. (Scale bar = 1 mm).
Aspongopus nepalensis Westwood, 1837: 26; Dallas, 1851: 349; Walker, 1868: 483; Stål, 1870: 85; Distant, 1879: 45; Atkinson, 1889: 90; Lethierry & Severin, 1893: 237; Waterhouse, 1900a: 251; 1900b: 9; Distant, 1901a: 819; 1901b: 104; 1902: 283; Kirkaldy, 1909: 256; Maxwell-Lefroy, 1909: 678; Strickland, 1932: 873–875; Miller, 1956: 38.
Aspongobus [sic] nepalensis Dohrn, 1859: 21.
Coridius nepalensis Yang, 1940: 7, 8; Durai, 1987: 190, 198, 265; Lis, 1990: 114, 141; 1992: 37; Rolston et al., 1996: 42, 43, 99; Ahmad et al., 1997: 307, 310, 319.
Material examined. INDIA: Arunachal Pradesh, Tippi, leg. Thejavikho Chase, 30.xi.2020, 27.026°N, 92.610°E, 179 m: 2 M, 2 F.
Diagnosis. Dorsally brown to dark brown, ventrally pale brown except abdominal sternites, seventh abdominal segment dark brown. Antennae black except fifth segment, which is pale ochraceous with fuscous apex. Lateral margins of pronotum black; area near metathoracic scent gland dark brown; legs concolorous with body (Figs 5D and 6D).
Head two times wider at eyes than longer, equal to the width of anterior pronotal margin. Mandibular plates smooth, much longer than clypeus and meeting in front of it, lateral margins sinuate, and head rounded at apex; clypeus faintly ridged mesially (Fig 9D). Eyes moderately large, pedunculate. Ocelli prominent, rounded, interocellar distance 1.97 times distance between eyes and ocelli. Antennae five segmented, all segments with fine sparse setae, fifth segment pilose. First segment surpassing apex of head, second segment 0.71 times shorter than third, fourth segment longest, fifth segment fusiform in shape. Labium four segmented, reaching to mid coxa; first segment reaching to base of head, second longest, third and fourth together equal to second.
Pronotum slightly declivous, deeply punctate, and medially transversely rugulose, anterior margin concave behind head, anterior angles obtuse, lateral margins appear carinated, posterior margin straight; calli prominent without rugae. Prosternum sulcate in the middle and laterally rugulose. Meso and meta sternum narrow with shallow groove.
Scutellum sparsely punctate and rugulose, apex tongue shaped.
Hemelytra. Corium finely rugulose, membrane broad with many veins.
Legs. Coxae rounded; femora flattened and slightly curved inside with short, stout, sparsely distributed setae; tibiae sulcate with numerous short spines like setae on both sides; tarsi with golden pubescence underneath, claws divergent.
Abdomen finely rugulose, glossy, without setae, seventh segment longest, proximal third with transverse rugae, distal two thirds smooth. Trichobothria situated posteriorly to spiracles.
Male genitalia. Exposed region of pygophore declivous basally, flat in distal half and with very sparse long setae. Elongate, somewhat squarish and sclerotized; ventral rim not rounded and with numerous long brown setae (Fig 10D); ventrally convex, punctate and without setae (Fig 11D). Parameres short, sclerotized, medially rounded, and broad and apically narrowing; outer margin irregular and appears denticulate and setose apically; inner margin sometimes a little concave (Fig 12D).
Geographical distribution. Bangladesh, India (Assam, and Arunachal Pradesh), Indonesia, Nepal, and Vietnam [24, 27, 42].
Remarks. C. nepalensis is found under stones in dry riverbeds. This species is commonly consumed by the Nyishi tribe and is harvested from the Dibang River’s riverbeds (Loklung village in Lower Dibang Valley, Arunachal Pradesh).
Coridius singhalanus (Distant, 1900) (Figs 5E, 6E, 7D, 9E, 10E, 11E and 12E).
Aspongopus singhalanus Distant, 1900: 222; 1902: 283; Bergroth, 1908: 188.
Kirkaldy, 1909: 257; Gravely, 1915: 509.
Coridius singhalanus Durai, 1986: 6; Mathew, 1986: 43; Durai, 1987: 196; Lis, 1990: 113, 142; 1992: 37; Rolston et al., 1996: 48, 100; Ahmad et al., 1997: 307, 319.
Material examined (images): Lectotype male: Aspongopus singhalanus Distant, designated by Durai (1987: 197) (Fig 7D).
INDIA Assam, Sivsagar, leg. Anandita, 28.vii.2020, 26.982°N, 94.642°E, 100 m: 2 M, 3 F.
Diagnosis. Overall yellowish dorsally except head. Legs, membrane and connexivum fuscous. Lateral margins of mandibular plates, area near ocelli and eyes black; first four antennal segments black, fifth ochraceous with fuscous base and apex. Ocelli, callar region and base of the first antennal segment pale in colour. Basal fourth of clavus fuscous. Lateral margin of connexivum black, pale ventrally; rostrum, sternal area, coxae and pygophore ventrally pale; rest of body dark brown (Figs 5E and 6E).
Head transverse: mandibular plates longer than clypeus, meeting in front of it and apex rounded, lateral margins sinuate (Fig 9E), with sparse punctures; callar area distinct without punctures. Eyes pedunculate. Ocelli well developed, rounded, closer to eye than to each other. Antennae five segmented, first segment surpassing apex of head, second and third sub equal in length, fourth longest; second, third and fourth segments sulcate and laterally compressed, fifth finely setose and fusiform. Labium four segmented, reaching middle of mesosternum; first and second labial segments equal in length, third and fourth short. Bucculae prominent.
Male genitalia. Pygophore proximally narrow and distally broad, sclerotized; ventral rim of the pygophore slightly depressed with setae (Fig 10E); moderately convex ventrally, with punctures and without setae (Fig 11E). Parameres sclerotized with rugose, medially broad and rounded, apex blunt, outer margin serrated and setose apically, inner margin moderately concave (Fig 12E).
Geographical distribution: India (Assam and Arunachal Pradesh), Indonesia, and Sri Lanka [24, 27, 42, 44].
Remarks: Presence of this species in India was mentioned by Lis [24] without giving any illustrations.
Coridius brunneus (Thunberg, 1783) (Figs 5F, 6F, 9F, 10F, 11F and 12F).
Cimex brunneus Thunberg, 17 83: 45.
Cimex obscurus Fabricius, 1794: 107. Synonymized by Durai, 1987: 195.
Cimex obscurior Turton, 1802: 642.
Edessa obscura Fabricius, 1803: 151, Wolff, 1811: 173, Fig 17.
Edessa (Dinidor) obscura Latreille, 1829: 195.
Aspongopus obscurus Burmeister, 1835: 352; Westwood, 1837: 6; Herrich-Schäffer, 1844: 80; Dallas, 1851: 349; Herrich-Schäffer, 1851: 307; Stål, 1868: 38; Vollenhoven, 1868: 38; Walker, 1868: 482; Atkinson, 1889: 88; Sharp, 1890: 404; Kirby, 1892: 88; Lethierry & Severin, 1893: 238; Breddin, 1899: 168; 1901: 14, 63; Distant, 1902: 283; Maxwell-Lefroy, 1909: 313; Behura et al., 1972: 88, 104; Behura et al., 1977: 113–128; Hsiao et al., 1977: 70, pl. 8, Fig 125; Verma et al., 1979: 873–878.
Spongopodium obscurus Spinola, 1837: 305, 306.
Aspongopus ochreus Westwood, 1837: 6, 25; Vollenhoven, 1868: 38, 39; Walker, 1868: 483; Stål, 1870: 85; Distant, 1879: 45, 52; Atkinson, 1889: 89; Lethierry & Severin, 1893: 238; Distant, 1901: 819; 1902: 283; Kirkaldy, 1909: 257. Synonymized by Lis, 1990: 113.
Aspongobus [sic] ochreus Dohrn, 1859: 21.
Aspongobus [sic] obscurus Dohrn, 1859: 21.
Dinidor obscura Carpenter & Westwood, 1863: 564
Aspongopus brunneus Mayr, 1866: 69; Distant, 1879: 45, 52; Atkinson, 1889: 87; Lethierry & Severin, 1893: 236; Distant, 1901: 104; 1902: 282, 283; Kirkaldy, 1909: 255; Maxwell-Lefroy, 1909: 678; Distant, 1921: 166; Fletcher, 1921: 189, 190; Misra, 1923: 301; China, 1928: 195, 196; Hoffmann, 1935: 118; Yang, 1962: 47, 48; Zhang & Lin, 1988: 84; Zheng & Jin, 1990: 142.
Aspongopus (Aspongopus) brunneus Stål, 1870: 82; Schouteden, 1913: 7.
Aspongopus (Aspongopus) obscurus Stål, 1868: 82.
Aspongopus orientalis Kirkaldy, 1909: 257; Manna, 1951: 40, 41, 44, Figs 20a-h.
Aspongopus (Aspongopus) ochreus Schouteden, 1913: 8.
Aspongopus (Aspongopus) orientalis Schouteden, 1913: 8, pl. 1, Fig 3.
Coridius ochreus Yang, 1940: 8; Durai, 1986: 6; 1987: 190, 196, Figs 171–172; Ahmad et al., 1997: 307, 319.
Coridius orientalis Nuamah, 1982: 16.
Coridius brunneus Durai, 1986: 5; 1987: 109, 195, 196, Figs 161–170; Schaefer & Ahmad, 1987: 30; Zhang & Lin, 1987: 76; Lis, 1990: 113, 140; 1992: 37; Rolston et al., 1996: 33–35, 98; Ahmad et al., 1997: 308, 315, 319, 320.
Coridius obscurus Senrayan & Annadurai, 1991: 237–243, Figs a-c.
Material examined. INDIA: Maharashtra, Pune, leg. Swapnil Boyane, 12.i.2019, 18.653°N, 73.909°E, 550 m: 1 F.—INDIA: Maharashtra: Khopoli, leg. Hemant Ghate, 23.x.2015, 18.793°N, 73.334°E, 69 m: 1 M.
Diagnosis. Overall body yellowish brown to dark brown; pale yellow ventrally, brown in areas near coxae and sternum rest dark brown. Lateral margins of pronotum not black. Antennae with first segment basally ochraceous, distally dark brown, second and third black, fourth ochraceous except a minute region at base and apex which are black (Figs 5F and 6F). Legs brown to blackish brown, tibia slightly darker.
Redescription. Overall body sparsely finely punctate, almost smooth medially underneath, and very finely punctate laterally. Abdomen finely rugulose and punctate.
Head rounded at apex, with mandibular plates much longer than clypeus (Fig 9F); eyes large, bulbous, silvery in colour. Ocelli yellowish brown placed closer to eye than to each other. Labium four segmented reaching middle of mesosternum. Antennae five segmented, first segment reaching apex of head, fifth segment blackish brown.
Pronotum glossy and finely punctate, anterior border deeply concave, lateral margins curved, posterior margin straight; calli smooth, shining with sparse punctures. Pro-sternum with a distinct elevated smooth region on either side of the median groove, laterally rugulose and coarsely punctate. Meso and meta sternum smooth medially, rugulose and coarsely punctate in pleural regions. Femora with spines and setae underneath, tibae distinctly sulcate and spined ventrally as well as dorsally, first segment of tarsus densely setose, second and third with very sparse long setae; claws widely separated, pulvilli distinct, well developed.
Scutellum long, rugulose punctate in basal two third; reaching half-length of abdomen, apex rounded.
Male genitalia. Pygophore proximally narrow and distally slightly broad, sclerotized ventrally convex, with deep punctures (Fig 11F); ventral rim rounded with sparse setae (Fig 10F), parameres curved, highly sclerotized with rugae, outwardly remarkably rounded and its tip narrowed, serrated, and setose apically, inner margin moderately concave (Fig 12F).
Geographical distribution: Asutralia, Borneo, China, India, Indonesia, Malaysia, Myanmar, Sri Lanka [24, 27, 42, 44].
Coridius assamensis (Distant, 1902) (Figs 5G, 6G, 9G, 10G, 11G and 12G).
Aspongopus assamensis Distant, 1902: 285; Bergroth, 1908: 188; Kirkaldy, 1909: 255, Chen, 1983: 45, 46; Datta et al., 1985: 4, Fig 7; Chen & Yang, 1988: 90.
Aspongopus (Aspongopus) assamensis Schouteden, 1913: 7.
Coridius assamensis (Distant), Durai, 1987: 190, 198, 199, Figs 182–183; Lis, 1990: 114, 140; 1992: 37; Rolston et al., 1996: 33, 98; Ahmad et al., 1997: 307; 319; Kocorek, 2003: 51, 55.
Material examined. Lectotype male (Images): Aspongopus assamensis Dist., R. Kumar det. 1973, LECTOTYPE // Distant Coll. 1911–383. // assamensis Dist // LECTOTYPE.
INDIA: Arunachal Pradesh, Loklung, leg. Gumnya Ete, 2.i.2019, 27.960°N, 95.566°E,139 m: 1 M.
Diagnosis. Entire body including antennae piceous. Eyes and ocelli dark brown (Figs 5G and 6G). Metathoracic scent glands opening area matte black.
Redescription. Head 1.86 times wider than longer, deeply punctate, mandibular plates almost two times longer than clypeus and meeting in front of it; apex of head rounded, lateral margin deeply sinuated (Fig 9G), lateral border of mandibular plates and area in front of ocelli smooth. Eyes, large, pedunculate. Ocelli rounded; interocular distance almost twice distance between ocelli and eyes. Antennae five segmented, first segment passing apex of head, second segment 0.70 times longer than third, fourth segment longest, fifth segment 0.44 times smaller than fourth. All segments with sparsely distributed setae, second, third and fourth segments compressed, fifth fusiform.
Pronotum declivous, trapezoid, with densely packed deep punctures, lateral margins smooth and raised as carina; anterior margin concave behind head, anterior angles blunt; posterior angles obtuse, posterior margin of pronotum more or less straight; calli prominent, smooth and without punctures.
Scutellum with punctures like pronotal, apex flat and tongue shaped.
Hemelytra. Clavus short, narrow; corium with fine punctures, rugulos. Membrane darker than corium and with many longitudinal veins. Hemelytra surpassing apex of abdomen.
Legs. Coxae rounded; femora slightly inwardly curved, laterally compressed with a series of small stout spinules and sparse long setae; tibiae almost straight and with numerous series of spines on both sides; tarsus with long golden pubescence underneath, pretarsus with few long setae; claws well developed and divergent.
Abdomen very finely rugulose, median region slightly less rugulose and smooth, seventh sternum longest, rugulose in posterior third, setose at posterior border; Connexivum exposed with pale yellow patch in between segmentation. Spiracles rounded, prominent, closer to anterior border than to lateral border of respective segment. Trichobothria paired, posterior to spiracles.
Male genitalia. Pygophore, squarish, exposed portion finely rugulose; moderately convex ventrally, with punctures and few sparse setae (Fig 11G). Ventral rim rounded with numerous long brown setae (Fig 10G). Parameres glossy, highly sclerotized with rugae, short, medially broad, and rounded, apically narrowing. Outer margin of paramere serrated and setose apically, inner margin more or less straight (Fig 12G).
Geographical distribution: China, India (Assam and Arunachal Pradesh), Nepal, and Vietnam [24, 27, 44].
Remarks: C. assamensis is often collected from the riverbeds in Dibang valley and consumed by the indigenous communities especially by the Nyishi tribe.
Coridius ianus (Fabricius, 1775) (Figs 5H, 6H, 9H, 10H, 11H and 12H).
Cimex ianus Fabricius, 1775: 714; 1781: 357; 1787: 295.
Cimex janus Fuessly, 1778: 163; Goeze, 1778: 247; Gmelin, 1790: 2152.
Cimex surinamensis Goeze, 1778: 232; Gmelin, 1790: 2134. Synonymized by Atkinson, 1889.
Cimex afer Drury, 1782: 66, 67, pl. 46, Fig 7. Synonymized by Fabricius, 1794: 107.
Cimex danus [sic] Fabricius, 1794: 107; Wolff, 1800: 13, pl. 2, Fig 1313.
Cimex surinamensis Gmelin, 1789: 2134. Synonymized by Atkinson, 1889: 88.
Edessa ianus Fabricius, 1803: 151.
Coridius ianus llliger, 1807: 361.
Pentatoma janus Lepeletier & Serville, 1825: 56.
Aspongopus janus Laporte, 1833: 58; Burmeister, 1835: 352; Westwood, 1837: 6; Amyot & Serville, 1843: 173, 174; Herrich-Schäffer, 1844: 78, Fig 747; Dallas, 1851:348; Dohrn, 1860: 401; Mayr, 1866: 70; Walker, 1868: 482; Distant, 1879: 45; Atkinson, 1889: 88, 89; Kirby, 1892: 88; Lethierry & Severin, 1893: 237; Distant, 8331901a: 823; 1902b: 104; 1902: 281, 282, Fig 179; Maxwell-Lefroy, 1909: 313; Mann, 1911: 1166, 1167, 2 Figs; Fletcher, 1917: 57, 289; 1921: 189; Singh-Pruthi, 1925: 148, pl. 9, Fig 27; Ayyar, 1933: 17, Fig 14; Chatterjee, 1934: 27; Kathuria et al., 1975: 31–33; Behura & Das, 1977: 49–60; Behura et al., 1978: 55–66; Dhiman, 1981: 180, 181; Singh & Narain, 1984: 259–267; Mishra & Sharma, 1990: 480, 481; Sharma, 1990: 1329, 1330.
Aspongopus vicinus Westwood, 1837: 25. Synonymized by Dallas, 1851: 348.
Aspongobus [sic] janus Dohrn, 1859: 21.
Aspangopus [sic] janus Motschoulsky, 1863: 76.
Aspongopus (Aspongopus) janus Stål, 1870: 82, 83; Schouteden, 1913: 8, pl. 1, Fig 8.
Aspongopus ianus Breddin, 1909: 282; Kirkaldy, 1909: 380; Maxwell-Lefroy, 1909: 678, pl. 74, Fig 3; Manna, 1951: 39, 40, 44, Figs 19 a-i.
Coridius janus Schumacher, 1924: 335, 336; Scudder, 1959: 413; Kumar, 1962: 48, 51, 53–56, Figs 25–27, 46, 47, 72–74, 88; Rastogi & Kumari, 1962: 69–77; Gentry, 1965: 147, 154, 162, Fig 32; Ahmad & Abbasi, 1971: 37–49, Figs 1–14; Ahmad et al., 1971: 1–16; Naqvi et al., 1973: 209–221; Ahmad et al., 1974: 175–188, Figs 1–5; Ahmad & Afzal, 1977: 1–4, Figs 1–4; Kaushik et al., 1977: 244–250; Kaushik i, 1979: 211–219; Ahmad, 1980: 135; Nuamah, 1982: 16, 25; Schaefer & Ahmad, 1987: 30; Afzal & Sahibzada, 1988: 254; Satapathy & Patnaik, 1991: 56, 59, 60, Tables 1 and 2, Fig 1G–1L.
Coridius ianus Durai, 1987: 187, 216–218; Lis, 1990: 122, 141, Fig 23; 1991: 84, 87, Fig 4; 1992: 38; Rolston et al., 1996: 40, 41, 99; Ahmad et al., 1997: 305–307, 310–313, 318, 319, Figs 2A–2G.
Material examined. INDIA: Arunachal Pradesh, Rani Village, Pasighat, leg. Nikhil Joshi, 1.x.2018, 27.9653°N, 95.316°E, 139 m: 1M.
Diagnosis. Head, antennae, callar region, anterior half of scutellum, membrane, and legs black; pronotum, clavus, corium, connexivum and posterior half of scutellum orange or red; abdomen blackish ventrally. Hemelytra, corium similar to pronotum but membrane black. Prosternal groove yellow. Legs dark brown to blackish. Abdomen ventrally almost sanguineous to black with a narrow lateral border which is pale brown (Figs 5H and 6H).
Head. Mandibular plates longer than clypeus, apex rounded (Fig 9H). Eyes large, bulbous. Ocelli placed closer to eye than to each other. Labium short, reaching base of procoxae. Antennae five segmented, first antennal segment reaching apex of head. Pronotum glossy, finely punctate; pronotum with concave anterior margin, sinuate lateral margins, straight posterior margin.
Scutellum long, its sides gently sinuate, apex rounded,
Male genitalia. Pygophore with ventral rim concave with sparse setae; dorsal bridge straight with long ochraceous setae (Fig 10H); ventrally moderately convex, with deep punctures (Fig 11H). Parameres curved, highly sclerotized with rugae, tip blunt; outer margin serrated and setose apically; inner margin moderately concave (Fig 12H).
Geographical distribution. Bangladesh, Borneo, India, Indonesia, Madagascar, Mynmar, Pakistan, Phillippienes, Sri Lanka, and Thailand [24, 27, 42, 44].
Remarks. This species is widely distributed in Indo-Malayan region.
Coridius fuscus (Westwood, 1837) (Figs 5I, 6I, 9I, 10I, 11I and 12I).
Aspongopus fuscus Westwood, 1837: 26; Dallas, 1851: 349; Vollenhoven, 1868: 39; Walker, 1868: 483; Stål, 1870: 85; Stål, 1871: 609, 645; Atkinson, 1889: 90; Lethierry & Severin, 1893: 237; Breddin, 1900: 332; Distant, 1900: 221; 1901a: 819; 1901b: 104; 1902: 284, 285; Kirkaldy, 1909: 256; Distant, 1921: 166; Lehmann, 1923: 182; hina, 1928: 195; Hoffmann, 1931: 144; 1932: 1013; Schouteden, 1933: 53; Wu, 1933: 215, 216; Cheo, 1935: 28; Hoffmann, 1935: 119; Yang, 1962: 47, 48; Chang, 1974: 356; Hsiao et al., 1977: 70, pl. 9, Fig 124; Hua, 1989: 43.
Aspongopus marginalis Dallas, 1851: 350; Walker, 1868: 483; Stål, 1870: 85; Atkinson, 1889: 90, 91; Lethierry & Severin, 1893: 237. Synonymized by Distant, 1900: 221.
Aspongobus [sic] fuscus Dohrn, 1859: 21.
Aspongobus [sic] marginalis Dohr, 1859: 21.
Aspongopus (Aspongopus) fuscus Schouteden, 1913: 8; Tang, 1935: 356.
Coridius fuscus Yang, 1940: 8, 10, 19–21, Fig 5; Hoffmann, 1948: 22, 23; Stichel, 1962a: 725; 1962b: 205; Sienkiewicz, 1964: 112; Durai, 1986: 4, 5; 1987: 188, 202, 203, Figs 197–200; Schaefer & Ahmad, 1987: 30; Lis, 1990: 114, 115, 141; 1992: 38; Rolston et al., 1996: 39, 40, 99.
Material examined. INDIA: Maharashtra, Raigad, leg. Hemant Ghate, 1.x.2011, 18.771°N, 73.365°E, 70 m: 1 M.—INDIA: Maharashtra: Pune, leg. Hemant Ghate, 21.xi.2011, 18.709°N, 73.460°E, 670 m: 1 M—INDIA: Maharashtra, Pune, leg. Hemant Ghate, 18.709°N, 73.474°E, 747 m: 1 F.
Diagnosis. Dorsally dark brown except lateral margins of pronotum, corium and connexivum, which are completely ochraceous. Antennae black with tip of apical segment brown. Clavus and corium a little paler than body. Ocelli and first three segments of labium brown.
Redescription. Head 2.47 times of wider than longer, mandibular plates longer than clypeus, rounded anteriorly and meeting in front of the clypeus (Fig 9I). Eyes globular, pedunculate. Ocelli well developed. Labium four segmented, reaching middle of meso-sternum; first and third segment sub-equal, second longest and fourth smaller. Buccula prominent. Antennae five segmented, first segment cylindrical, surpassing apex of head, second and third distinctly compressed, subequal, fourth slightly dilated apically with short setae, fifth fusiform.
Pronotum dorsally finely punctate, calli less punctate, rugulose, appears smooth. Anterior margin of pronotum concave, lateral margin moderately straight, slightly raised. Humeral angles rounded. Pro-sternum sulcate in the middle, lateral area flat. Mesosternum and metasternum smooth on disk with a shallow median groove. Femora laterally flattened and spined; all tibiae sulcate with more prominent and numerous spines on both sides; all tarsi with first and third segments sub-equal, median shortest; first segment of tarsus with dense setae underneath, claws and pulvulli well developed, claws divergent.
Scutellum 0.95 times wider than long, apex rounded, with sparse punctures, deeply punctate basally with many longitudinal rugae.
Male genitalia. Pygophore slightly broad, ventral rim moderately straight (Fig 10I), ventrally medially raised (Fig 11I). Parameres highly sclerotized with rugae, outer margin globular and its tip narrowed, setose, inner margin straight (Fig 11I).
Geographical distribution. Cambodia, China, Indonesia, India, Laos, Malaysia, Myanmar, Philippines, Singapore, Sri Lanka, Thailand, and Vietnam. This species is reported from two extreme points of India, Nagaland (Eastern Himalayas) and Maharashtra (Western Ghats) [27, 44].
Remarks. This is a rediscovery of Coridius fuscus (Westwood, 1837) in India, 120 years after its last report by Disant (1902). Aspongopus (= Coridius) fuscus (Westwood, 1837) and the Indo-Burmese species Aspongopus (= Coridius) sanguinolentus (Westwood, 1837) are two very similar species, but the former is somewhat elongate and the latter is larger. In a recent revision of Coridius (Durai [27]), the distribution of C. fuscus is mentioned as Cambodia, Indonesia, Laos, Malaysia, Myanmar, and Vietnam. Some morphological differences are also noted in the redescription. According to the descriptions by Distant [44], the connexivum of C. fuscus is completely ochraceous without any bands, but according to Durai [27], the connexivum has black bands in the intersegments. All specimens collected during this study also agree with Distant [44]. However, the shape of the dissected pygophore in our collections matches well with the drawings provided by Durai [27]. This suggests that there is a possibility that C. fuscus has two color morphs. We are providing illustrations of this species for the first time, with notes on the male genitalia.
Coridius chinensis (Dallas, 1851) (Figs 7E, 9K, 13–17).
Variation within C. chinensis complex. (Scale bar = 5 mm).
Variation within C. chinensis complex. (Scale bar = 5 mm).
(Scale bar = 1 mm).
(Scale bar = 1 mm).
(Scale bar = 1 mm).
Aspongopus chinensis Dallas, 1851: 349; Walker, 1868: 483; Stål, 1870: 85; Horváth, 1879: 145; Lethierry & Severin, 1893: 236; Distant, 1902: 285; 1903: 238; Oshanin, 1906: 162; Kirkaldy, 1909: 255; Oshanin, 1912: 19; Matsumura, 1913: 7; Paiva, 1919: 355; Distant, 1921: 166; Esaki, 1926: 152; Matsumura, 1930: 113, pl. 11, Fig 26; 1931: 1177; Hoffmann, 1932: 9; Strickland, 1932: 873, 874, 876; Lindberg, 1934: 14; Yang, 1934: 70–72, Fig 10; Hoffmann, 1935: 119, 176; Miller, 1956: 38; Takara, 1957: 33; Yang, 1962: 46, 47, pl. 8, Fig 67; Chang, 1974: 356; Hsiao et al., 1977: 70, pl. 8, Fig 123; Zhang, 1985: 53, 54, pl. 11, Fig 25; Zhang & Lin, 1988: 84, 85; Hua, 1989: 43; Zheng & Jin, 1990: 142.
Aspongobus [sic] chinensis Dohrn, 1859: 21.
Aspongopus ochreus Shiraki, 1910: 111, pl. 40, Fig 14.
Aspongopus (Aspongopus) chinensis Schouteden, 1913: 7; Tang, 1935: 355, 356.
Cyclopelta parva Shiraki, 1913: 207.
Coridius chinensis Yang, 1940: 7, 10–19, Figs 1–4; Hoffmann, 1948: 22; Stichel, 1962a: 725; 1962b: 205; Durai, 1986: 5; 1987: 190, 197, Figs 176–181, 265; Schaefer, 1987: 161; Zhang & Lin, 1987: 76; Hirashima, 1989: 183; Lis, 1990: 114, 141; 1991: 84, 87, 89, Fig 5; 1992: 37; Rolston et al., 1996: 35, 36, 98; Ahmad et al., 1997: 305, 307–310, 319 Figs 1A–1D.
Material examined: Paralectotype Female: CHINA: Labels: // Type // ASPONGOPUS CHINENSIS, 5113, des. J. Lis, PARALECTOTYPE.
INDIA: Nagaland, Viswema, leg. Aavika Dhanda, 27.iv.2019, 25.565°N, 94.147°E, 1650 m: 1 M, 1 F.—INDIA: Nagaland, Wokha, leg. Ajano Tsanglao, 20.ii.2019, 26.089°N, 94.196°E, 900 m: 1 F.—INDIA: Manipur, Chandel, leg. Barkha Subba, 6.ii.2019, 24.318°N, 94.044°E, 960 m: 1 F.—INDIA: Arunachal Pradesh: Yingkiong, leg. Gumnya Ete, 10.xii.2019, 28.632°N, 95.017°E, 275 m: 2 F.—INDIA: Manipur, Ukhrul, leg. Swapnil Boyane, 1, ii.2019, 25.095°N, 94.361°E, 775 m: 1 M, 1 F.—INDIA: Nagaland, Khonoma, leg. Ajano Tsanglao, 26.iv.2019, 25.651°N, 94.022°E, 1517 m: 1 F.
Diagnosis. Dorsally dark brown or black with greenish tinge (in alcohol), antennae black except fifth segment which is ochraceous, but it is one fourth base and apex black; legs dark brown or castaneous, Ventral coloration similar to dorsal side with distinct green tinge at least in artificial light (Figs 13 and 14).
Redescription. Head transverse, 0.41 times wider than longer, almost of same width as anterior pronotal angles; lateral margins of head in front of eyes distinctly sinuate, so that head apex looks rounded at apex. Mandibular plates longer than clypeus, meeting in front of it (Fig 9K), transversely rugulose, coarsely punctate. Clypeus transversely ridged. Eyes moderately large, pedunculate. Ocelli are prominently closer to eyes than to each other; area between eyes and ocelli coarsely punctate on the disk, slightly less coarsely punctate in front of ocelli. Antennae with scattered black setae especially on second to fourth segments, first segment slightly surpassing apex of head, cylindrical, second and third flattened with fine rugae, fourth also flattened and slightly dilated beyond middle, fifth ochraceous and densely setose with dense, short and sparse, long setae. Labium four segmented, first segment reaching base of head, fourth segment reaching about middle of mesosternum.
Pronotum moderately sloping, rhomboidal; anterior margin gently rounded behind head, anterior angles obtuse, lateral margins straight, raised as carinae; surface coarsely punctate and rugulose; calli less punctate, smooth, rugulose. Humeral angles rounded, dorsally faintly raised on corners, posterior margin straight. Posterior margin of pronotum straight.
Prosternum coarsely punctate medially, pleura finely and rugulosely punctate. Meso-sternum medially sulcate with two broad shining smooth patches on either side of midline, lateral area rugulose with scattered punctures. Metasternum narrow with a medial sulcus between meta coxae.
Scutellum rugulose punctate, 0.98 times wider than long, slightly tumescent in posterior half, apex broadly rounded.
Hemelytra. Clavus broad at base, narrowed distally and shorter than scutellum; corium broad, finely rugulose punctate. Membrane broad, with a series of basal cells and many parallel longitudinal veins. Hemelytra surpasses tip of abdomen.
Femora laterally compressed, punctate, ventrally with spinules. Tibiae sulcate with more prominent and numerous spines. Tarsi well developed, first and third segment sub-equal, middle shortest; first segment with dense mat of setae underneath, claws and pulvulli well developed; claws divergent.
Abdomen slightly wider in front of middle of its length, slightly thinner than humeral angles. Abdomen very finely punctate and rugulose, less punctate medially and appears smooth. Seventh sternum longest, posterior third rugulose, setose at posterior border, covering convex ventral portion of pygophore. Eighth sternum not visible externally in males. Spiracles prominent, situated closer to anterior border than to lateral margins of segments. Trichobothria posterior to spiracles.
Male genitalia. Exposed portion of pygophore finely rugulose, punctate ventrally with sparse long brown setae, margin finely denticulate. Anterior third of pygophore ochraceous, posterior two thirds more sclerotized, black. Ventral rim of the pygophore triangular, rounded or medially raised and straight, denticulate and without long setae (Fig 15). Ventrally moderately convex, with punctures and without setae (Fig 16). Parameres highly sclerotized with rugae, medially broad and rounded and apically narrowing, outer margin serrated and setose apically, inner margin straight (Fig 17) and with lobe basally.
Geographical distribution. Bhutan, China, India, Indonesia, Japan. Laos, Myanmar, Taiwan, and Vietnam. This species is widely distributed in India’s Southern (Tamil Nadu) and North-eastern regions (Assam, Manipur, Nagaland, and Arunachal Pradesh) [24, 27, 42, 44].
Remarks. The umami taste of C. chinensis makes it a popular dish among ethnic tribes in Northeast India. However, consuming this bug can cause problems like dizziness, nausea, and vomiting in some people. It can lead to a loss of strength and a condition of semi-consciousness in certain people (Boyane, personal communication with native people).
Different morphs in C. chinensis (Figs 13–17).
Coridius chinensis 1: head including ocelli, antennae except apical segment, pronotum, and scutellum brown. Hemelytra a little paler than rest of the body. Venter black, except rostrum and coxal area. Second segment of antennae (1.54 mm) longer than third (1.13 mm). Pygophore: ventral rim rounded; dorsal rim slightly concave. Parameres medially broad, tip upwardly directed with a few setae.
Coridius chinensis 2: head including ocelli, antennae (except apical segment), pronotum and scutellum dark black. Clavi, coria and claws brown. Membrane paler than corium. Second segment of antennae longer (1.59 mm) than third (1.39 mm). Venter completely black. Pygophore: ventral rim slightly raised medially, dorsal rim concave with setae. Parameres slightly slenderer when compared to Coridius chinensis 1; tip pointed with numerous setae.
Coridius chinensis 3: head (except ocelli), pronotum, antennae except apical segment, pronotum, scutellum, clavi, corium and legs are black. Ocelli yellow. Membrane and claws paler than rest of the body. Second antennal is smaller (1.34 mm) than the third segment (1.47 mm). Venter completely black. Scent gland area matte black. Pygophore: ventral rim raised slightly as in Coridius chinensis 2, dorsal rim concave. Parameres slender; tip setose and upwardly directed.
Coridius chinensis 4: coloration similar to Coridius chinensis 3. Ocelli yellow. Ventrally black except coxae and rostrum. Second antennal segment longer (1.52 mm) than third (1.21 mm). Pygophore: ventral rim rounded, dorsal rim slightly straight. Parameres slender and pointed apically.
Coridius chinensis 5: dorsal and ventral coloration is similar to Coridius chinensis 3 and Coridius chinensis 4. Ocelli yellow. Second antennal segment longer (1.38 mm) than third (1.26 mm). Pygophore: ventral rim raised medially, as in Coridius chinensis 3. Parameres medially broad and rounded; tip setose and upwardly directed.
Coridius chinensis 6: head including ocelli, pronotum, legs, scutellum, clavi, coriua and membrane black. Second antennal segment longer than third. Venter black except the coxal region which is brown. Pygophore like Coridius chinensis 2. Parameres medially broad, tip pointed and upwardly directed.
Coridius chinensis 7: head, antennae except apical segment, pronotum, scutellum and legs black. Clavi, coria, membrane, and tip of scutellum brown. Venter black. Pygophore: ventral rim medially weakly elevated and straight, dorsal rim concave. Parameres outer margin rounded, tip upwardly directed.
Coridius chinensis 8: head, antennae (except apical segment), pronotum, scutellum, clavui, coriua and legs black. Membrane paler than color of the body. Rostrum, coxae, prosternum, and abdomen segments II-VI brown. Second antennal segment longer than third. Pygophore: ventral rim medially raised, triangular-like, dorsal rim almost straight. Parameres with pointed as in morphs of C. chinensis.
Remarks: Eight samples of Coridius chinensis (Dallas, 1851) formed six lineages in our analysis. Although all samples are keyed out to Coridius chinensis, they show slight variations in the body color and structure of pygophores and parameres. We studied the paralectotype of C. chinensis and found that the basal ¼ of the fifth antennal segment is black in all specimens. C. chinensis 3–5 have yellow ocelli, while all other have black ocelli. These three samples, which share similar morphology, were collected from the same state.
Key to the species of Coridius (modified from Durai (1987); Ahmad et al., (1997))
1. Antennae 4 segmented; body length more than 24 mm, body cupreous; 2nd antennal segment longest (Fig 5A); pygophore wider than long (Fig 10A); parameres medially stout, apex tapering with long seta (Fig 12A)………………….C. insperatus sp. nov.
- Antennae 5 segmented; body length less than 24 mm, body colour variable; 4th antennal segment longest; shape of pygophore and paramere different………………………………………………………………………….…… 2
2. Second antennal segment shorter than third; body length more than 20 mm; entire body reddish brown; lateral margin of pronotum rounded (Fig 5D); ventral rim of pygophore medially weakly elevated (Fig 10D); outer margin of paramere strongly rounded, apex narrowed, setose (Fig 12D) ….………………………….C. nepalensis
- Second antennal segment longer than third; body length 16–20 mm; body dark brown, blackish brown, ochraceous or black; lateral margin of pronotum straight or moderately curved; ventral rim of pygophore emarginate or convex; outer margin of parameres moderately rounded, apex variable ………….……………………………3
3. Body length 18–20 mm; mandibular plates not meeting in front in clypeus; entirely blackish brown (Fig 5C); pygophore slightly medially elevated (Fig 10C); parameres short, apex blunt (Fig 12C) ……………… .… .… .… .… .C. esculentus sp. nov.
- Body length less than 18 mm; mandibular plates meeting in front of clypeus; colour variable; pygophore and parameres variable……………….………………… 4
4. Basal fourth of fifth antennal segment black (Fig 13); outer margin of paramere medially broad and basally with knob like structure, apex thumb-like upwardly directed (Fig 17) …… .… .… .… .… .… .… .… .… .… .… .… .… .… .… .… .… .… .… .… .……C. chinensis
- Basal fourth of fifth antennal segment not black; outer margin of paramere variable and basally without knob like structure, apex not thumb-like or upwardly directed………………………………………………………………………………. 5
5. Antennae entirely black or of the same color as head………….………… .… .. 6
- Antennae with orange, yellowish brown or ochraceous segment five……… 10
6. Lateral margins of pronotum and connexivum black; body uniformly black; pronotum trapezoidal (Fig 5G).…………………………………………. C. assamensis
- Lateral margins of pronotum and connexivum red, orange, or yellow; body colour variable; pronotum shape variable …………………………………………. 7
7. Pronotum, apical half of scutellum, and coria yellowish orange (Fig 5H); abdomen ventrally reddish (Fig 6H); body more than 17 mm …………………C. ianus
- Pronotum, apical half of scutellum, and coria black or blackish brown; abdomen ventrally black; body less than 17 mm ………………….…………….……8
8. Connexivum, and posterior third of pygophore, orange (Fig 7A); fourth segment of antennae flat and dilated.……………………………………… C. laosanus
- Connexivum, and posterior third of pygophore, reddish or black; fourth segment of antennae slender and two apical thirds dilated ………………….……… 9
9. Pronotum dark brown with red band along lateral margin; connexivum bright red; abdomen ventrally dark brown. (Fig 7B) ……………………… C. sanguinolentus
- Pronotum black with ochraceous band along lateral margin; connexivum ochraceous; abdomen ventrally black. (Fig 5I) …………….………………. C. fuscus
10. Scutellum wider than longer…………………………….……….……….… 11
- Scutellum longer than wider…………………………………………………. 12
11 Body uniformly black and coria brown; second antennal segment shorter than third (Fig 7C)… .… .… .… .… .… .… .… .… .… .… .… .… .… .… .… .… .… .… .… .… .…… C. nigriventris
- Body ochraceous or blackish brown and coria of the same color as pronotum; second antennal segment longer than third (Fig 5F) ……………………. C. brunneus
12. Pronotum with mid-longitudinal pale ochraceous band; antennal segments 2 to 4 indistinctly grooved; body pale brown to dark brown with irregular patches of yellow (Fig 5B); pygophore slightly narrow and distally wide, ventral rim slightly notched medially (Fig 10B); outer margin of parameres moderately rounded, apex narrowed and upwardly directed (Fig 12B)………… .… .… .… .… .… .… .… .… .… .… .… .C. adii sp. nov.
- Pronotum without mid-longitudinal band; antennal segments 2 to 4 distinctly grooved; body yellowish brown with lateral margin of head blackish brown (Fig 5E); pygophore proximally narrow and distally wide, ventral rim not notched medially (Fig 10E); outer margin of parameres strongly rounded and apex robust and straight (Fig 12E)…………………………………………………………….………C. singhalanus
Discussion
Phylogenetic consideration
In our analyses, we observed robust family-level relationships within the Pentatomoidea superfamily. Specifically, we found that Dinidoridae formed a monophyletic group and sister taxa to Tessaratomidae. The previous studies showed Dinidoridae does not form a sister relationship with Tessaratomidae [45], whereas our results, as well as a few studies [46, 47], supported the sister relationship between these taxa.
In the integrated framework, our findings from molecular and morphological studies revealed a high convergence in the species delimitation of most Coridius species. Tree-based delimitation PTP and bPTP retrieved 13 and 14 lineages, respectively, including three new species. Except for C. chinensis, which formed six putative species. Similarly, ASAP 1 recovered 14 and ASAP 2 recovered 25, respectively. In C. adii sp. nov. C. assamensis, C. chinensis, and C. singhalanus, we found discrepancies between morphological and molecular delimitation analyses. Therefore, we compared the parameres of these species, which showed distinctness; however, species delimitation PTP, bPTP, and ASAP 1 indicated a single species, whereas ASAP 2 treated them as distinct species (Fig 4).
Similarly, we observed that C. esculentus sp. nov. forms a clade with C. chinensis and is closely related to it in terms of coloration. However, PTP and bPTP grouped this clade as a single species, while ASAP 1 and ASAP 2 treated C. esculentus sp. nov. and C. chinensis as separate species (Fig 4). Additionally, a closer look at the head and pygophore revealed that the major difference between C. esculentus sp. nov. and other species is in the shape of the mandibular plates and the parameres (Fig 12). It’s important to note that the low node support for C. esculentus sp. nov. (PP: 0.82, MLBS: 52) is likely a result of the small sample size. A well-supported clade of C. nepalensis and two unidentified species resulted in a single species in the bPTP analysis. We could not examine the voucher specimens for unidentified species sequences, which create gaps in Fig 4. In the instance of C. ianus, all our analyses showed two putative species. C. ianus has several colour and size variants; it would be interesting to sequence multiple specimens to understand their relationships, but this remains out of the scope of the present study. The African species C. viduatus, which morphologically resembles C. ianus, formed a sister clade with each other (Fig 4). Our results also reveal that C. nigriventris, which was previously synonymized with C. nepalensis, forms a distinct lineage, and therefore we suggest treating that as a valid species.
Hidden diversity in Coridius chinensis
The current study shows that C. chinensis is a complex of species and, at the same time, disentangles some of its morphological diversity within north-eastern India. We found morphological variation along the geographical distribution of specimens of the C. chinensis complex and discovered at least six independent lineages, which were earlier grouped as one valid species, C. chinensis. The construction of trees using maximum likelihood and Bayesian inference for the several specimens of Coridius chinensis revealed similar tree topologies, with each clade being well-supported by high posterior probability and bootstrap support (see Fig 4). The phylogenetic placement of C. chinensis individuals may suggest that they are partially and geographically differentiated lineages of a species.
Our findings for C. chinensis indicate that there is high intraspecific diversity resulting in the six putative species. These individuals are from diverse geographic areas and may have different ecological niches and food preferences. Given this, we observed that C. chinensis is genetically diverse yet morphologically indistinguishable (Figs 13–17). Since the morphological investigation did not reveal any significant differences, we opted to maintain its current taxonomic status. To address the complexity within C. chinensis, future research will require larger taxon sampling across the occurrence regions, as well as multiple loci (nuclear and mitochondrial) data combined with ecological data. We agree that the use of additional nuclear gene markers can provide a well-resolved tree and gain a much deeper understanding of the phylogenetic relationships.
Taxonomic consideration
Durai [27] catalogued 37 species under the genus Coridius and listed all synonyms and distribution records for each species. Later, Lis [23] published a checklist of the Old World Dinidoridae species, including Coridius, along with a few new synonyms, and proposed two new genera: the first was Coridiellus Lis 1990, to which six species of Coridius were transferred, and the second was Colporidius Lis, where Coridius aeneus (Walker, 1868) was transferred. Considering all these changes, Rolston et. al. [42] published a catalogue of the world’s Dinidoridae, which included only 32 valid species under the genus Coridius.
C. adii sp. nov. C. esculentus sp. nov. and C. insperatus sp. nov. described here, unquestionably belong to the genus Coridius since they exhibit all the key characters of Dinidorini and Coridius. Interestingly, according to Distant’s [44] and Durai’s [27] revisions, the genus Coridius has five segmented antennae. But C. insperatus sp. nov. described from Arunachal Pradesh, has only four segmented antennae that distinguish it from all other known species. The mandibular plates in C. insperatus sp. nov. are narrower and mesially meeting each other (Fig 9A), whereas in all other species they are broad and meet in front of the clypeus (Fig 9B–9K).
The Indian Coridius can be divided into two groups solely based on antennal coloration (though this has not been tested phylogenetically): the species with all antennal segments black form the first group, which includes C. assamensis, C. fuscus, C. ianus, C. laosanus, C. nigriventris, and C. sanguinolentus. In the second group, the apical segment of the antenna is orange or yellowish brown. This includes C. adii sp. nov., C. chinensis, C. brunneus, C. esculentus sp. nov., C. insperatus sp. nov., C. nepalensis, and C. singhalanus.
With its orange apical antennomeres, C. adii sp. nov. and C. esculentus sp. nov. fall into the second group. Though C. adii sp. nov. seems unrelated to the group with entirely black antennae, it resembles C. singhalanus in body coloration but differs in anatomy. The pygophores of C. adii sp. nov. and C. singhalanus are almost equal in length and width, but the ventral rim is distinctly notched (Fig 10B) in C. adii sp. nov. while it is not notched in C. singhalanus (Fig 10E). Similarly, the parameres in C. adii sp. nov. have a broadly rounded outer margin and a distally tapering tip (Fig 12B), whereas in C. singhalanus it is medially broad and has the apical tip rounded (Fig 12E). Additionally, we compared C. adii sp. nov. with images of the lectotype of C. singhalanus (Fig 7D), which clearly showed the absence of a pale carina on the pronotum of C. singhalanus.
Similarly, C. esculentus, sp. nov. is included in the second group as well and has yellow apical segments; it bears a resemblance to C. chinensis due to its dark brown color. Therefore, we compared this species with the images of the C. chinensis paralectotype (Fig 7E). Upon close examination of both C. chinensis (Figs 13−17) and its paralectotype (Fig 7E), we observed a consistent pattern–a black region on the basal fourth of the apical antennal segment (Figs 7E, 7H and 13). However, in the case of C. esculentus sp. nov. this black region is absent (Fig 7G). Additionally, another distinguishing trait that sets C. esculentus sp. nov. apart from is the knob-like structure on the paramere (Fig 12C). In 1997, Ahmad et. al. [48] described two new species of Coridius from Pakistan, C. turbatensis Ahmad, Hussain & Kamaluddin, 1997, and C. neobrunneus Ahmad, Hussain & Kamaluddin, 1997, with which we have compared the new species; however, these species are more closely related to C. ianus and C. brunneus (see [48]).
Distant [44] included 10 species under the genus Aspongopus (= Coridius), but later Durai [27] synonymized a few species, including C. nigriventris under C. nepalensis, based on the morphological similarity of aedeagus. In our analysis, we found that these two species formed distinct clades (Fig 4); hence, we reinstated and re-established the species status of C. nigriventris based on morphological and molecular evidence (Figs 7 and 8C) (for more information, refer to the results section). The most useful diagnostic characters for distinguishing species were revealed: these are relative size, length of antennal segments, shape of mandibular plates, pygophore, and parameres.
Finally, the discovery of C. adii sp. nov., C. esculentus sp. nov., and C. insperatus sp. nov. implies that there are likely many more species to be described from the north-eastern area of India. In addition, extensive systematic surveys throughout the range of C. chinensis are required to resolve the species’ hidden diversity.
Conclusions
There are 13 Coridius species known from India, including three new species described in this study. The phylogenetic trees and species delimitation results support the establishment of three new Coridius species. The LDA revealed that the most important morphological characters to consider while identifying these species are total body length, maximum body width, and the length and width of the pronotum and scutellum. Our findings indicate that C. chinensis is a species complex that needs extensive research to resolve intraspecific variation. In this work, we reinstated C. nigriventris, which was previously synonymized under C. nepalensis. Also, we are providing illustrations of C. assamensis, C. fuscus, C. laosanus, C. sanguinolentus, and C. singhalanus for the first time. The current study on Coridius is intended to provide a framework for future studies with a larger sample size as well as to demonstrate that our integrative approach combining morphological (LDA) and molecular analyses (species delimitation methods) is most promising for resolving species delimitation and uncovering hidden diversity. The presence of several undescribed lineages in our data highlights the need to revise the taxonomy and systematics of Coridius. A large-scale global phylogenetic investigation of all known Coridius likely has great potential to yield numerous additional species.
Supporting information
S1 File. Measurements morphological characters of Coridius spp.
https://doi.org/10.1371/journal.pone.0298176.s001
(DOCX)
S1 Fig. Variation in morphometric characters of Coridius spp.
(A) Pronotum length and breadth ratio (PL/PB). (B) scutellum length and breadth ratio (SL/SB). (C) maximum body breadth (MB). (D) total body length (TBL).
https://doi.org/10.1371/journal.pone.0298176.s002
(TIF)
S2 Fig. Correlation plots of different variables.
https://doi.org/10.1371/journal.pone.0298176.s003
(TIF)
Acknowledgments
The authors would like to express their gratitude to the State Biodiversity Boards and State Forest Departments of Arunachal Pradesh, Manipur, and Nagaland for granting permissions to conduct sampling. We are grateful to the village heads for their generous help and for allowing us to document their insect knowledge. We thank Gumnya Ete, Thejavikho Chase, Ajano Tsanglao, Ale, Fuchumlo Tsanglao, Anil Tallang, Aavika Dhanda, Barkha Subba, and Femi Benny for their valuable help during the fieldwork. We would like to thank Ravikanth G. for providing the lab facilities and Ranjith A.P. for his valuable input on the MS. SSB is thankful to Ganesh Shinde for his help in creating a map. SSB is grateful for the specimens donated by Dr. Marcos Roca-Cusachs (USNW, Australia) and Anandita Buragohain. SSB is indebted to Randall T. Schuh (AMNH, USA) for his input and insightful literature. Also, many thanks to David Rider (North Dakota State University, USA) for his support in providing literature. We are extending our gratitude to Mick Webb and Stuart Cole for providing images of types deposited in the BMNH. We would like to acknowledge Núria López Mercader and Antoni Serra Sorribes of the Universitat de Barcelona’s Centre de Recursos de Biodiversitat Animal (CRBA-UB) for providing images of the specimens. We are indebted to Amoret Spooner, collection manager at the Oxford University Museum of Natural History, for sending type photographs and granting permission to use them in the manuscript. Digital images of the types used above are under the copyright of the respective institutions. HVG is grateful to the authorities of Modern College of Arts, Science, and Commerce, Shivajinagar, Pune, India, for encouragement and facilities.
References
- 1.
Mayr E. The growth of biological thought: Diversity, evolution, and inheritance: Harvard University Press; 1982.
- 2. Isaac NJ, Mallet J, Mace GM. Taxonomic inflation: its influence on macroecology and conservation. Trends Ecol Evol. 2004;19(9):464–469. pmid:16701308.
- 3. Wiens JJ. Species delimitation: new approaches for discovering diversity. Syst Biol. 2007;56(6):875–878. pmid:18027280.
- 4. Singhal S, Hoskin CJ, Couper P, Potter S, Moritz C. A Framework for Resolving Cryptic Species: A Case Study from the Lizards of the Australian Wet Tropics. Syst Biol. 2018;67(6):1061–1075. pmid:29635540.
- 5. Chambers EA, Hillis DM. The Multispecies Coalescent Over-Splits Species in the Case of Geographically Widespread Taxa. Syst Biol. 2020;69(1):184–193. Epub 2019/06/11. pmid:31180508.
- 6. Noguerales V, Cordero PJ, Ortego J. Integrating genomic and phenotypic data to evaluate alternative phylogenetic and species delimitation hypotheses in a recent evolutionary radiation of grasshoppers. Mol Ecol. 2018;27(5):1229–1244. Epub 20180301. pmid:29411440.
- 7. Sites JW, Marshall JC. Operational Criteria for Delimiting Species. Annual Review of Ecology, Evolution, and Systematics. 2004;35(1):199–227.
- 8. Zapata F, Jimenez I. Species delimitation: inferring gaps in morphology across geography. Syst Biol. 2012;61(2):179–194. Epub 20110816. pmid:21840841.
- 9. Fontaneto D, Flot J-F, Tang CQ. Guidelines for DNA taxonomy, with a focus on the meiofauna. Marine Biodiversity. 2015;45(3):433–451.
- 10. Mehta RS, Bryant D, Rosenberg NA. The probability of monophyly of a sample of gene lineages on a species tree. Proc Natl Acad Sci U S A. 2016;113(29):8002–8009. Epub 20160718. pmid:27432988; PubMed Central PMCID: PMC4961160.
- 11. Newton LG, Starrett J, Hendrixson BE, Derkarabetian S, Bond JE. Integrative species delimitation reveals cryptic diversity in the southern Appalachian Antrodiaetus unicolor (Araneae: Antrodiaetidae) species complex. Mol Ecol. 2020;29(12):2269–2287. Epub 20200617. pmid:32452095.
- 12. Yang Z, Rannala B. Bayesian species delimitation using multilocus sequence data. Proc Natl Acad Sci U S A. 2010;107(20):9264–9269. Epub 20100503. pmid:20439743; PubMed Central PMCID: PMC2889046.
- 13. Dayrat B. Towards integrative taxonomy. Biological Journal of the Linnean Society. 2005;85:407–415.
- 14. Garraffoni ARS, Araujo TQ, Lourenco AP, Guidi L, Balsamo M. Integrative taxonomy of a new Redudasys species (Gastrotricha: Macrodasyida) sheds light on the invasion of fresh water habitats by macrodasyids. Sci Rep. 2019;9(1):2067. Epub 20190214. pmid:30765851; PubMed Central PMCID: PMC6376054.
- 15.
Engel MS, Ceríaco LM, Daniel GM, Dellapé PM, Löbl I, Marinov M, et al. The taxonomic impediment: a shortage of taxonomists, not the lack of technical approaches. Oxford University Press UK; 2021. p. 381–387.
- 16. Riedel A, Sagata K, Suhardjono YR, Tänzler R, Balke M. Integrative taxonomy on the fast track-towards more sustainability in biodiversity research. Frontiers in zoology. 2013;10:1–9.
- 17. Salvador RB, Cavallari DC, Rands D, Tomotani BM. Publication practice in Taxonomy: Global inequalities and potential bias against negative results. Plos one. 2022;17(6):e0269246. pmid:35648765
- 18. Jadin RC, Orlofske SA, Jezkova T, Blair C. Single-locus species delimitation and ecological niche modelling provide insights into the evolution, historical distribution and taxonomy of the Pacific chorus frogs. Biological Journal of the Linnean Society. 2021;132(3):612–633.
- 19. Kessel GM, Alderslade P, Bilewitch JP, Schnabel KE, Gardner JP. The use of integrative taxonomy in Octocorallia (Cnidaria: Anthozoa): a literature survey. Zoological Journal of the Linnean Society. 2023;198(2):677–690.
- 20. Schlick-Steiner BC, Steiner FM, Seifert B, Stauffer C, Christian E, Crozier RH. Integrative Taxonomy: A Multisource Approach to Exploring Biodiversity. Annual Review of Entomology. 2010;55(1):421–438. pmid:19737081
- 21. Bickford D, Lohman DJ, Sodhi NS, Ng PK, Meier R, Winker K, et al. Cryptic species as a window on diversity and conservation. Trends Ecol Evol. 2007;22(3):148–155. Epub 20061128. pmid:17129636.
- 22. Nosil P, Harmon LJ, Seehausen O. Ecological explanations for (incomplete) speciation. Trends Ecol Evol. 2009;24(3):145–156. Epub 20090129. pmid:19185951.
- 23. Lis J. New genera, new species, new records and checklist of the Old World Dinidoridae (Heteroptera, Pentatomoidea). Annals of the Upper Silesian Museum, Entomology. 1990;1:103–147.
- 24. Lis J. New records of Oriental and Australian Dinidoridae with descriptions of two new species [Heteroptera: Pentatomoidea]. Roczniki Muzeum Górnośląskiego w Bytomiu Entomologia. 1992;3:35–43.
- 25. Schaefer CW, Ahmad I. The Food Plants of Four Pentatomoid Families (Hemiptera: Acanthosomatidae, Tessaratomidae, Erostylidae, and Dinidoridae)1987.
- 26. Mozhui L, Kakati L, Meyer-Rochow VB. Entomotherapy: a study of medicinal insects of seven ethnic groups in Nagaland, North-East India. Journal of Ethnobiology and Ethnomedicine. 2021;17(1):1–22.
- 27. Durai P. A revision of the Dinidoridae of the World (Heteroptera: Pentatomoidea). Oriental Insects. 1987;21(1):163–360.
- 28.
Tsai J-F, Yang M-M, Rédei D, Yeh G-F. Jewel bugs of Taiwan (Heteroptera: Scutelleridae): Chung Hsing University; 2011.
- 29. Weihs C, Ligges U, Luebke K, Raabe N. klaR analyzing German business cycles. Data analysis and decision support. 2005:335–343.
- 30. Revelle W. psych: procedures for psychological, psychometric, and personality research. 2020. R package version. 2022;2(7).
- 31. Ripley B, Venables B, Bates DM, Hornik K, Gebhardt A, Firth D, et al. Package ‘mass’. Cran r. 2013;538:113–120.
- 32. Beck MW. ggord: Ordination Plots with ggplot2. R package version. 2017;1(0).
- 33. Folmer O. Black M Hoeh W Lutz R Vrijenhoek R 1994 DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology. 3(5):294–299. pmid:7881515
- 34. Kambhampati S PS. PCR primers for the amplification of four insect mitochondrial gene fragments. Insect Molecular Biology. 1995;4(4):233–236. pmid:8825760
- 35. Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B. PartitionFinder 2: new methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Molecular biology and evolution. 2017;34(3):772–773. pmid:28013191
- 36. Trifinopoulos J, Nguyen L-T, von Haeseler A, Minh BQ. W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic acids research. 2016;44(W1):W232–W235. pmid:27084950
- 37. Ronquist F, Teslenko M, Van Der Mark P, Ayres DL, Darling A, Höhna S, et al. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic biology. 2012;61(3):539–542. pmid:22357727
- 38. Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA. Posterior Summarization in Bayesian Phylogenetics Using Tracer 1.7. Systematic Biology. 2018;67(5):901–904. pmid:29718447
- 39.
Rambaut A. FigTree, a graphical viewer of phylogenetic trees (Version 1.4. 4). Institute of evolutionary biology, University of Edinburgh. 2018.
- 40. Kapli P, Lutteropp S, Zhang J, Kobert K, Pavlidis P, Stamatakis A, Flouri T. Multi-rate Poisson tree processes for single-locus species delimitation under maximum likelihood and Markov chain Monte Carlo. Bioinformatics. 2017;33(11):1630–1638. pmid:28108445; PubMed Central PMCID: PMC5447239.
- 41. Puillandre N, Brouillet S, Achaz G. ASAP: assemble species by automatic partitioning. Mol Ecol Resour. 2021;21(2):609–620. Epub 20201120. pmid:33058550.
- 42. Rolston L, Rider D, Murray M, Aalbu R. Catalog of the Dinidoridae of the World. Papua New Guinea Journal of Agriculture, Forestry and Fisheries. 1996;39(1):22–101.
- 43. Kocorek A. Coridius pseudoflavomarginatus sp. n. from Madagascar and new records for some other species of the family Dinidoridae (Hemiptera: Heteroptera). Polskie Pismo Entomologiczne. 2003;72:51–55.
- 44. Distant W. The Fauna of British India. Rhynchota Vol. 1. 1902; pp 438.
- 45. Roca‐Cusachs M, Schwertner CF, Kim J, Eger J, Grazia J, Jung S. Opening Pandora’s box: molecular phylogeny of the stink bugs (Hemiptera: Heteroptera: Pentatomidae) reveals great incongruences in the current classification. Systematic Entomology. 2021;47(1):36–51.
- 46. Tembe S, Shouche Y, Ghate HV. DNA barcoding of Pentatomomorpha bugs (Hemiptera: Heteroptera) from Western Ghats of India. Meta Gene. 2014;2:737–745. Epub 20141010. pmid:25606457; PubMed Central PMCID: PMC4287870.
- 47. Grazia J, Schuh RT, Wheeler WC. Phylogenetic relationships of family groups in Pentatomoidea based on morphology and DNA sequences (Insecta: Heteroptera). Cladistics. 2008;24(6):932–976. pmid:34892882
- 48. Ahmad I, Hussain M, Kamaluddin S, editors. A review of genus Coridius Illiger (Hemiptera: Dinidoridae) from Indo-Pakistan sub-continent with description of two new species from Mekran and Bangladesh and their cladistic relationships. Proceedings of the Pakistan Congress of Zoology; 1997.