Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Chemo-profiling of Purpureocillium lilacinum and Paecilomyces variotii isolates using GC-MS analysis, and evaluation of their metabolites against M. incognita

  • Prashant Patidar,

    Roles Data curation, Formal analysis, Investigation, Methodology, Project administration, Resources, Software, Validation, Visualization, Writing – original draft

    Affiliation Division of Plant Pathology, ICAR-Indian Agricultural Research Institute, New Delhi, India

  • Lakshman Prasad ,

    Roles Conceptualization, Data curation, Formal analysis, Methodology, Resources, Supervision, Validation, Writing – original draft, Writing – review & editing

    laxmanprasad25@yahoo.com

    Affiliation Division of Plant Pathology, ICAR-Indian Agricultural Research Institute, New Delhi, India

  • Sushma Sagar,

    Roles Formal analysis, Methodology, Writing – original draft

    Affiliation Division of Plant Pathology, ICAR-Indian Agricultural Research Institute, New Delhi, India

  • Anil Sirohi,

    Roles Methodology, Resources, Supervision, Validation, Visualization, Writing – original draft

    Affiliation Division of Nematology, ICAR-Indian Agricultural Research Institute, New Delhi, India

  • Mahender Singh Saharan,

    Roles Conceptualization, Formal analysis, Supervision, Visualization, Writing – review & editing

    Affiliation Division of Plant Pathology, ICAR-Indian Agricultural Research Institute, New Delhi, India

  • Mukesh Kumar Dhillon,

    Roles Data curation, Formal analysis, Methodology, Software, Validation, Visualization

    Affiliation Division of Entomology, ICAR-Indian Agricultural Research Institute, New Delhi, India

  • Vaibhav Kumar Singh,

    Roles Supervision

    Affiliation Division of Plant Pathology, ICAR-Indian Agricultural Research Institute, New Delhi, India

  • Tusar Kanti Bag

    Roles Supervision, Visualization

    Affiliation Division of Plant Pathology, ICAR-Indian Agricultural Research Institute, New Delhi, India

Abstract

Nematophagous fungi are the best alternatives to chemical nematicides for managing nematodes considering environmental health. In the current study, activity of metabolites from ten isolates of Purpureocillium lilacinum (Thom) Luangsa-ard (Hypocreales: Ophiocordycipitaceae) and two isolates of Paecilomyces variotii Bainier (Eurotiales: Trichocomaceae), were examined to inhibit the hatching of Meloidogyne incognita (Kofoid & White) Chitwood (Tylenchida: Heteroderidae) eggs. At 100%, 50%, and 25% concentrations, respectively, the culture filtrate of the isolate P. lilacinum 6887 prevented 97.55%, 90.52%, and 62.97% of egg hatching. Out of all the isolates, Pl 6887, Pl 6553, and Pl 2362 showed the greatest results in the hatching inhibition experiment.Gas chromatography-mass spectrometry (GC-MS) analysis revealed a variety of nematicidal compounds from different isolates. A total of seven nematicidal compounds, including four very potent nematicidal fatty acids were found in the isolate Pl 6553. Secondary metabolites of the same isolate possess the highest M. incognita juvenile mortality, i.e., 43.33% and 92% after 48 hrs of treatment at 100 and 200 ppm concentrations, respectively. Significant difference was observed in juvenile mortality percentage among the isolate having highest and lowest nematicidal compounds. Nematicidal fatty acids like myristic and lauric acid were found for the first time in P. lilacinum. Multiple vacuole-like droplets were found inside the unhatched eggs inoculated with the culture filtrate of isolate Pl 6887, and also in the juveniles that perished in the ethyl acetate extract of isolate Pl 6553.

Introduction

Plant parasitic nematodes (PPNs) are potential threats to crop production. Global loss due to PPNs is estimated to be $157 billion annually [1]. Although the number of plant-parasitic nematode species identified is over 4,100, undoubtedly, the most yield-reducing group is the root-knot nematode (Meloidogyne spp.). It ranks top in terms of agricultural damage globally [2]. Out of the 101 RKN species described, Meloidogyne incognita is the most economically important species in the tropical and subtropical regions [3, 4]. Along with the direct damage, an association of RKN with fungal and bacterial plant pathogens is common and results in disease complexes, causing more damage to the crops than the nematode alone [5]. Chemical nematicides are widely used to control RKNs worldwide. However, due to their adverse effects on humans, environmental health, and non-targets, the use of chemical nematicides is not feasible in the current scenario of eco-friendly crop-pest management [6]. It results in the phase-out of several popular nematicides from the market [7]. Hence, biological pesticides are becoming an important component of eco-friendly management systems [8, 9]. Purpureocillium lilacinum (earlier Paecilomyces lilacinus) is one of the various antagonists of the cyst and root-knot nematodes, which is found most effective as an egg and female parasite [10]. It is considered one of the most promising and practicable biological control agents for the management of sedentary endoparasitic PPNs [11] and has been used successfully to manage root-knot nematodes in various crop plants [10, 1216]. Nematicidal metabolites secreted by P. lilacinum during infection of RKNs make its job even easier, and studies suggest that potential isolates of P. lilacinum are efficient producers of metabolites lethal to nematodes [1719]. Similarly, Paecilomyces variotii has also been reported to produce compounds of agricultural importance, including some nematicidal ones [20].

The present study aimed at determining the efficacy of ten P. lilacinum and two P. variotii isolates against M. incognita, in vitro, as well as studying their secondary metabolites in nematode control.

Materials and methods

Fungal cultures

For this study, ten isolates of Purpureocillium lilacinum and two isolates of Paecilomyces variotii were obtained from the Indian Type Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute, New Delhi. The isolates were maintained at 25°C on PDA media.

Cultural and morphological identification of the fungal isolates.

Investigation on morphological characters was done using a compound microscope (ZEISS). Morphological identification of the isolates was done based on the earlier diagnostic keys and descriptions of the species [21, 22].

Molecular identification of the fungal isolates.

The fungal DNA of all 12 isolates was extracted using the CTAB method from seven-day-old mycelia. The ITS region was amplified using the ITS primers (primer sequences: ITS1: 5’ TCCGTAGGTGAACCTGCGG 3’ and ITS4: 5’ TCCTCCGCTTATTGATATGC 3’) and PCR was performed. Confirmation of PCR amplification was done with the help of agarose gel electrophoresis. The amplified DNA was sequenced using Sanger sequencing and the obtained sequences were compared with the reference sequences available at the NCBI database to identify the species based on sequence similarities (blast.ncbi.nlm.nih.gov/). Phylogenetic analysis was performed using MEGA-X software with the Maximum Likelihood method. The Jukes-Cantor model was used for phylogenetic tree construction by keeping 1000 bootstrap replications.

Source, molecular identification and maintainance of Meloidogyne incognita

The culture of M. incognita was obtained from Division of Nematology, ICAR-Indian Agricultural Research Institute, Pusa, New Delhi. The molecular identity of M. incognita was confirmed using species-specific primers. The primers used were MincF1 (5-AAAAACACGCGATAACAAAAA-3) and MincR1 (5-ATTCAAAACTTGGGGGAAAAA-3) as forward and reverse primers, respectively [23]. The Cox-1 gene primer was used as a positive control [24]. The inoculum was received in the form of egg masses from infected tomato roots. Further, M. incognita was maintained on a susceptible tomato (Solanum lycopersicum Mill. cv. Pusa ruby) grown in earthen pots filled with steam-sterilized sand and soil mixtures. For further experiments, the egg masses were collected from these infected plants.

In vitro egg hatching inhibition assay

Preparation of M. incognita eggs suspension.

The egg masses were separated from the roots of the infected tomato plants with the help of a needle, while eggs were separated from the egg masses using a 1% sodium hypochlorite (NaOCl) solution [25]. The eggs were passed through a 100-mesh sieve nested over 200 and 500-mesh sieves. The eggs collected over a 500-mesh sieve were gently rinsed with sterile distilled water to remove NaOCl residue and decanted in a clean sterile beaker. The egg-hatching inhibition assay was performed on freshly extracted eggs.

Egg-hatching inhibition assay.

All twelve isolates were grown in a 500 ml Erlenmeyer flask containing 300 ml of sterilized potato dextrose broth (HiMedia), followed by incubation at 25°C for 21 days. The cell- free culture filtrate of the isolates was obtained by filtering the broth through a 0.22 μm millipore filter, and used for egg-hatching inhibition assay.

In each well of a 24-well cell culture plate, a 20 μl suspension of M. incognita eggs containing approximately 100 eggs was pipetted. The culture filtrate of the fungal isolates was added into the wells at three different concentrations, that is, 100%, 50%, and 25% with 4 replications each. At 50% and 25% concentrations of the culture filtrate tested, the volume was made up to 1 mL by adding sterile distilled water. Sterile distilled water was taken as negative control. The plates were incubated at 27°C in a BOD incubator after sealing them with parafilm to reduce evaporation. The number of hatched juveniles was monitored regularly, while the final counting of the hatched and unhatched eggs was done on the seventh day of inoculation using a phase contrast microscope. The egg hatching inhibition in the treatments was calculated by the formula HI % = (Total number of hatched J2 in control–Number of hatched J2 in the treatment/ Total number of hatched J2 in control) × 100 [26], which also eliminates the natural mortality in the treatments.

GC-MS analysis

The culture filtrate of each isolate was extracted thrice with an equal volume of ethyl acetate. The aqueous phase was concentrated using a rotary evaporator (Heidolph, Germany) at reduced pressure and a temperature of 55°C. The concentrated, dried metabolites were weighed and re-dissolved in GC-MS grade ethyl acetate at the rate of 1gm per ml. The GC-MS analysis was performed as described by [27] using Shimadzu GC-MS-QP 2010 using Rtx-1 MS column (30 m × 0.25 mm; 0.25 μm i.d.) connected directly with a triple axis mass spectrometer. The injected sample volume was 1 μl. Helium (> 99.99% purity) was used as a carrier gas with a head pressure of 10 psi and flow of 0.75 mL min−1. The oven temperature was held initially at 40°C and increased 4°C min−1 to reach 120°C. Then the temperature increased again at the rate of 5°C min−1 up to 200°C with a hold time of 5 min. Finally, the temperature was raised to 300°C with an increment of 10°C min−1. The total run time was 51 min. The MS acquisition parameters were set with the ion source temperature 250°C, electron ionization 60 eV, full scan mode (50–550 AMU), transfer line temperature 280°C, and E.M voltage 1222. NIST (National Institute of Standards and Technologies) Mass Spectra Library was used for the identification of compounds by matching their mass spectra (Shimadzu Corporation, Kyoto, Japan).

M. incognita Juvenile mortality assay

The juvenile mortality assay was conducted using extracted secondary metabolites of three P. lilacinum isolates Pl 6553, Pl 6887 and Pl 4483.

Preparation of stock and working concentration of secondary metabolites.

The dried secondary metabolites of the isolates Pl 6553, Pl 6887 and Pl 4483 were weighed and re-dissolved in methanol (1mg/ml) to make 1000 ppm stock concentration. Further, the working suspension of 100ppm and 200ppm was prepared from stock solution for juvenile activity test.

Preparation of M. incognita juveniles suspension.

Tomato plants infected with M. incognita were uprooted, and the roots were washed free of soil with tap water. The individual egg masses were picked from the roots with the help of a toothpick and surface sterilized with 0.1% NaOCl. The egg masses were then kept in a clean Petri plate, and sterile distilled water was added to the plate just to cover the surface of the egg masses. The plates were kept at room temperature to allow the hatching of eggs. The freshly hatched juveniles were collected using a micropipette in a clean beaker. Counting juveniles per ml was done with the help of a stereomicroscope aided by a hand tally counter. Finally, the number of juveniles was adjusted to 100/ 20 μl suspension.

The juvenile mortality assay.

For the juvenile mortality assay, two concentrations (100 and 200 ppm) of the methanol-dissolved secondary metabolites of the three P. lilacinum isolates (Pl 6553, Pl 6887 and Pl 4483) were used. The 24 well cell culture plate were used for the bioassay. Each well received 100 M. incognita J2 (20 μl suspension), and either 10 μl (for 100 ppm concentration) or 20 μl (for 200 ppm concentration) methanol dissolved secondary metabolites of the isolates from the stock concentration of 1000 ppm. The volume was made up to 1 ml with 0.5% Tween 80. Each treatment was replicated three times.Both 10 and 20 μl of pure methanol, dissolved in 0.5% Tween 80, along with 100 M. incognita juveniles was taken as control. The plates were incubated at 27°C in a BOD incubator after sealing with parafilm. After 24 and 48 hours of incubation, the live and dead juveniles were counted. The freely moving juveniles were considered alive, whereas the juveniles, being straight and did not show any movement after probing with a nematode handling needle, were considered dead [28].

Data analysis

Completely randomized design (CRD) was followed as experimental design for both egg-hatching inhibition and juvenile mortality experiments. All percentage data were first transformed into arcsine value and then used for two-way Analysis of Variance (ANOVA) for hatching inhibition assay and three-way Analysis of Variance (ANOVA) for juvenile mortality assay. The post hoc multiple comparisons were done at a 5% significant level by Duncan’s Multiple Range Test (DMRT). All the analysis was carried out using OPSTAT software (http://14.139.232.166/opstat/).

Results

Cultural and morphological identification of the fungal isolates

The ten isolates of P. lilacinum were confirmed as Purpureocillium lilacinum using the reference keys [22]. The colony colour on PDA media for all the isolates of P. lilacinum was lilac to vinaceous, which is typical of this fungus. Whereas morphological investigations revealed the production of phialides with long tapering necks, and ellipsoidal to fusiform conidia, varied from 2.6–3.40 × 2–2.8 μm in size. Both isolates of The cultural and morphological characters of both P. variotii isolates were matched with the keys [22, 29] as they produced a white fluffy colony, which turns yellowish brown or sand colored during conidiogenesis. They also produced fusoid to broadly ellipsoid conidia, varied from 3.3–4.8 × 2–2.4 μm in size with visible multiple nuclei inside. Chlamydospores were observed only in one isolate (Pav 746), among the two isolates of P. variotii studied.

Molecular identification of the fungal isolates

After sequencing of PCR products of all the 12 isolates, the obtained sequences were BLAST at the NCBI database, which confirms ten P. lilacinum isolates and two P. variotii isolates. The GenBank accession number of all the isolates is mentioned in the S1 Table. The phylogenetic tree was constructed using the maximum likelihood method, which shows the close relatedness of P. lilacinum and P. variotii isolates with already available sequences of P. lilacinum and P. variotii, respectively, on the NCBI database (Fig 1).

thumbnail
Fig 1. Phylogenetic relationship between isolates of Purpureocillium lilacinum and Paecilomyces variotii based on ITS sequences constructed using the maximum likelihood method.

The percentage of trees in which the associated taxa clustered together is shown next to the branches and are based on 1000 bootsrap replications.

https://doi.org/10.1371/journal.pone.0297925.g001

Molecular identity of M. incognita

Molecular identity of M. incognita was confirmed using species-specific primers [23]. It produced about 150 bp amplicon (Fig 2). The Cox-1 gene was used as a positive control [24].

thumbnail
Fig 2. Meloidogyne incognita molecular confirmation.

PCR products with MincF1/R1 primer set. M: 100 bp ladder, Mi: 150 bp, (MincF1 and Minc R1), P: Positive control- Cox-1 gene, 418 bp (JB3 and JB5 primers) and N: No template control.

https://doi.org/10.1371/journal.pone.0297925.g002

Egg-Hatching inhibition assay

Significant variation in hatching inhibition was found among the treatments as compared to the control (Table 1). The isolate, Pl 6887 was the best-performing isolate, as the highest hatching inhibition (97.55%, 90.52%, and 62.97%) was achieved at 100%, 50%, and 25% concentration, respectively. It was the only isolate where more than 50% hatching inhibition was observed at the lowest concentration (25%) tested. However, hatching inhibition in the culture filtrate of the isolates Pl 6553 was comparable to Pl 6887 at 100% and 50% concentrations. The culture filtrate of the Paecilomyces variotii isolate Pav 1833, showed 90.52%, 56.88%, and 28.74% hatching inhibition at 100, 50, and 25% concentrations, respectively. The result obtained was better than three isolates of P. lilacinum (Pl 4483, Pl 5596 and Pl 6948). However, hatching inhibition in another Paecilomyces variotii isolate (Pav 746) was the lowest among all the isolates at 100% and 25% concentrations. Unhatched eggs of M. incognita from the culture filtrate of the isolates, Pl 6887 and Pl 6553, were deformed and vacuolated (Fig 3) when observed under phase contrast microscope at higher magnification.

thumbnail
Fig 3. Effect of culture filtrate of P. lilacinum on M. incognita eggs.

(a) Control, where the egg is under embryogenesis, and (b) egg with a giant vacuole (red arrow), two vacuoles fusing (white arrow) and multiple variously sized vacuoles like droplets in the culture filtrate of P. lilacinum isolate Pl 6887, at 7th day of incubation. Scale bars of a and b were 50 μm.

https://doi.org/10.1371/journal.pone.0297925.g003

thumbnail
Table 1. List of isolates Paecilomyces variotii and Purpureocillium lilacinum and effect of their culture filtrates on M. incognita egg hatching.

https://doi.org/10.1371/journal.pone.0297925.t001

Chemo-profiling analysis using Gas Chromatography Mass Spectroscopy

GC-MS analysis revealed a large number of bioactive compounds from all the 12 isolates (S1S12 Figs). However, as of our interest, the compounds found as nematicidal in earlier studies [1719, 3035] were shortlisted and mentioned with their retention time and area in Table 2. Identification of compounds were done based on NIST database. The number of nematicidal compounds varied among the isolates. The highest number (seven) of nematicidal compounds were found in the ethyl acetate fraction of Pl 6553 isolate, followed by five in Pl 6887 (Table 2). Nematicidal fatty acids, namely, lauric (dodecanoic acid), myristic (tetradecanoic acid), stearic (octadecanoic acid) and butyric (butanoic acid) acid were found in Pl 6553 isolate, along with other nematicidal compounds like benzene acetic acid, 4-hydroxy benzene ethanol and benzoic acid. Only one reported nematicidal compound found in Pl 4483 isolate i.e., palmitic acid (hexadecanoic acid). No nematicidal fatty acid, other than palmitic acid, was found in the ethyl acetate extract of P. variotii isolates.

thumbnail
Table 2. List of nematicidal compounds identified using GC-MS analysis in Paecilomyces variotii and P. lilacinum isolates.

https://doi.org/10.1371/journal.pone.0297925.t002

The juvenile mortality assay

The juvenile mortality assay was conducted with three isolates of P. lilacinum. Two isolates, Pl 6887 and Pl 6553 showed higher hatching inhibition as well as higher number of nematicidal compounds in GC-MS analysis. While the isolate Pl 4483 showed to secrete only one nematicidal compound, were included in the juvenile mortality assay to compare with Pl 6887 and Pl 6553. The ethyl acetate extract of all three P. lilacinum isolates showed differences in the mortality of M. incognita juveniles (Table 3). The isolate Pl 6553 showed the highest mortality of the juveniles i.e., 11.66% and 43.33% at 100 ppm, and 25% and 92% at 200 ppm concentrations, after 24 and 48 hours of treatment, respectively. While the lowest juvenile mortality was observed with Pl 4483 i.e., 4% and 10% at 100 ppm, and 10% and 18.66% at 200 ppm, after 24 and 48 hours of treatment, respectively. The juvenile mortality observed in the Pl 6887 isolate was in between the two other isolates (Pl 6553 and Pl 6887) and so was the number of nematicidal compounds. The juveniles in control were observed freely moving and lacking any vacuoles inside the body (Fig 4A), while multiple vacuoles were observed in the juveniles after 48 hours of incubation with the metabolites of Pl 6553 isolate (Fig 4B).

thumbnail
Fig 4.

M. incognita juvenile after 48 hours of incubation in (A) control where juveniles werefreely moving (scale bar 200 μm) (B) a dead juvenile in metabolites of P. lilacinum (Pl 6553) with vacuoles-like droplets (black arrow) after 48 hours of incubation (scale bar 50 μm).

https://doi.org/10.1371/journal.pone.0297925.g004

thumbnail
Table 3. Effect of P. lilacinum metabolites on M. incognita juvenile mortality.

https://doi.org/10.1371/journal.pone.0297925.t003

Discussion

Chemical nematicides are still a top priority among growers for crop protection against nematodes even after the restriction and lack of availability. However, interest in the biological control of nematodes has increased in recent years, and studies suggest natural products can replace the hazardous chemical nematicides [33, 40]. Nematophagous fungi have enough potential to suppress the nematode population in the field, without causing any adverse effects on the environment [10].

In this study, the nematicidal potential of ten P. lilacinum and two P. variotii isolates was studied against M. incognita. Our study showed that the 21-day-old culture filtrate of P. lilacinum isolates can inhibit the hatching of M. incognita eggs up to varying extent. Eggs-hatching inhibition up to 97.55%, 90.52% and 62.97% was obtained with the culture filtrate of Pl 6887 isolate at 100%, 50% and 25% concentrations, respectively. However, in a study of [41], hatching inhibition was quite lower with the 8-day-old culture filtrate of the same isolate. It suggests that the accumulation of compounds detrimental to nematode egg hatching is greater as the age of fungal culture increases in broth. Similar kind of results were found by [42], where the 30-day-old culture filtrate of P. lilacinum completely inhibited M. incognita egg-hatching. Similarly, many studies support that the culture filtrate of P. lilacinum is effective in inhibiting egg hatching of various root-knot nematode species [32, 43, 44]. In a study [45] egg-hatching inhibition of M. incognita by culture filtrate of P. variotii isolates was reported. However, it was not better than P. lilacinum isolates. In our study, P. variotii isolates, Pav 1833, showed 90.58%, 56.88%, and 28.74% hatching inhibition at 100, 50 and 25% concentrations, respectively, which was found better than the results obtained with three isolates of P. lilacinum (Pl 4483, Pl 5596 and Pl 6948). The culture filtrate of the P. lilacinum isolates, especially, Pl 6887 and Pl 6553 was found toxic to the M. incognita eggs. The eggs were found vacuolated and deformed. Similar morphological changes in the eggs due to exposure to the culture filtrate of P. lilacinum are reported earlier [44].

In our study, we found that the ethyl acetate extract of P. lilacinum isolates was toxic to M. incognita juveniles. Earlier report [46] proved the higher toxicity of ethyl acetate extract of P. lilacinum to M. javanica juveniles. The per cent mortality achieved with Pl 6553 isolate was 43.33% and 92% after 48 hours of exposure at 100 and 200 ppm concentrations, respectively. [31], screened nematicidal activities of fatty acids produced in cultures of two Basidiomycetes viz., Pleurotus pulmonarius and Hericium coralloides. It was found that the LD50 value of linoleic and myristic acid against Caenorhabditis elegans was 5 ppm, 25 ppm for lauric, palmitic and oleic acid, and 50 ppm for stearic acid. Their study highlighted the importance of saturated and unsaturated fatty acid mixtures produced by nematophagous fungi and their contribution to nematicidal activity. [33], determined the nematicidal property of fatty acids (butyric, caproic, caprylic, capric, lauric, myristic, palmitic, oleic and linoleic acid) against M. incognita. It was found that the fatty acids were effective in inhibiting egg-hatching, killing second-stage juveniles and overall suppression M. incognita population, both in in-vivo and in vitro conditions. However, those fatty acids were not obtained from P. lilacinum. In our study, GC-MS analysis revealed a total of seven nematicidal compounds from Pl 6553 isolate, including four potent nematicidal fatty acids, namely, lauric, myristic, stearic, and butyric acid, with a per cent area of 0.11, 0.16, 0.22, and 0.43, respectively. [17], identified linoleic acid and oleic acid from cultures of P. lilacinum isolates. Production of palmitic, stearic, oleic and linoleic acid was also reported earlier from P. lilacinum [18, 34]. The nematicidal potential of butyric acid was described earlier [33, 3739] with the majority of the reports suggesting butyric acid is effective against Meloidogyne spp. However, there are fewer reports where it was secreted by P. lilacinum [34]. Butyric acid was present in four isolates of P. lilacinum we studied, namely, Pl 4910 (0.48), Pl 5596 (0.74), Pl 6064 (0.85), and Pl 6553 (0.43).

Our study is the first report on the production of lauric and myristic acid by P. lilacinum (isolates Pl 6553 and Pl 6064). However, both lauric and myristic acid were reported earlier from the toxin-producing Basidiomycetes [31]. The juvenile mortality achieved with the metabolites of Pl 6553 was highest followed by Pl 6887, and least with Pl 4483. GC-MS analysis showed 7, 5 and 1 nematicidal compounds from these isolates, respectively. It suggets that the higher juvenile mortality of Pl 6553 metabolites was compound effect of the nematicidal compounds, which were present in higher number as compared to other isolates two isolates, Pl 6887 and Pl 4483. The toxic effect of nematicidal compounds secreted by Pl 6553 was visible as the formation of multiple vacuoles inside the dead juveniles, the phenomenon termed methuosis [47]. Palmitic acid was found in every isolate studied, except for Pl 5596 and Pl 6553. Whereas, it was the only nematicidal fatty acid found in both the P. variotii isolates. It may conclude that P. variotii is a less efficient producer of nematicidal fatty acids contrary to P. lilacinum. Acetic acid with a high per cent area (5.32%), was only found in Pl 6887, which is also described as nematicidal earlier [30, 48].

Sharma et al. [19] found a fraction of 20 compounds, with 5 major ones, namely, 2-ethyl butyric acid, Phenyl ethyl alcohol, Benzoic acid, Benzene acetic acid and 3,5-Di-t-butyl phenol, which gave 94.6% egg hatching inhibition, and 62% juvenile mortality against M. incognita. However, the nematicidal effect of those five compounds was not determined individually. These compounds, except for 2-ethyl butyric acid and 3,5-Di-t-butyl phenol, were also detected in our study from different isolates. Comparatively, the per cent area of some of these compounds was much higher in the isolates of P. variotii than in P. lilacinum. However, the hatching inhibition obtained from the culture filtrate of P. lilacinum isolates was comparatively higher than P. variotii isolates. It suggests that there may be some other effective compounds playing a role in inhibiting egg hatching that need to be identified.

Our study, supported by the previous reports [17, 31, 34, 49], shows that higher hatching inhibition and mortality of juveniles, and quantity, as well as quality of the nematicidal compounds present can be an excellent indicator of the nematicidal potential of a fungal biocontrol agents. The P. lilacinum isolate Pl 6553, performed best in all such aspects including toxicity of its metabolites on eggs and juveniles. It also suggests that nematicidal compounds, derived from microbes, can be inexpensive alternatives to the chemical nematicides apart from being eco-friendly and selective. We found significant variation in the hatching inhibition obtained from the culture filtrate of P. lilacinum and Paecilomyces variotii isolates. Along with that, GC-MS analysis of metabolites of these isolates revealed a range of nematicidal compounds, while a couple of them are reported for the first time. The presence of a higher number of nematicidal compounds correlated with the mortality of M. incognita juveniles.

Conclusion

The isolates of P. lilacinum varied in the production of nematicidal compounds and the presence of these compounds in higher numbers plays a significant role in an overall reduction of the root-knot nematode by inhibiting egg-hatching and/or killing juveniles. We found that the culture filtrate of the isolates Pl 6887 and Pl 6553 was highly effective in inhibiting M. incognita egg hatching. Along with that, Pl 6553 secreted compounds that are highly detrimental to second-stage juveniles. Our study demonstrates that the presence of nematicidal secondary metabolites in the solvent affects the survival of nematodes, and higher juvenile mortality can be achieved when more nematicidal compounds are produced by the perticular isolate. While Pl 6887 is already a commercialized isolate in India, Pl 6553 is a potential candidate for further research and field trials, with its diverse range of nematicidal compounds.

Supporting information

S1 Table. GenBank accession number of P. lilacinum and P. variotii isolates used in the study.

https://doi.org/10.1371/journal.pone.0297925.s001

(PDF)

S1 Fig. GC-MS chromatogram of secondary metabolites from P. variotii 746 isolate (PNG).

https://doi.org/10.1371/journal.pone.0297925.s002

(PNG)

S2 Fig. GC-MS chromatogram of secondary metabolites from P. variotii 1833 isolate (PNG).

https://doi.org/10.1371/journal.pone.0297925.s003

(PNG)

S3 Fig. GC-MS chromatogram of secondary metabolites from P. lilacinum 2362 isolate (PNG).

https://doi.org/10.1371/journal.pone.0297925.s004

(PNG)

S4 Fig. GC-MS chromatogram of secondary metabolites from P. lilacinum 4483 isolate (PNG).

https://doi.org/10.1371/journal.pone.0297925.s005

(PNG)

S5 Fig. GC-MS chromatogram of secondary metabolites from P. lilacinum 4899 isolate (PNG).

https://doi.org/10.1371/journal.pone.0297925.s006

(PNG)

S6 Fig. GC-MS chromatogram of secondary metabolites from P. lilacinum 4910 isolate (PNG).

https://doi.org/10.1371/journal.pone.0297925.s007

(PNG)

S7 Fig. GC-MS chromatogram of secondary metabolites from P. lilacinum 5596 isolate (PNG).

https://doi.org/10.1371/journal.pone.0297925.s008

(PNG)

S8 Fig. GC-MS chromatogram of secondary metabolites from P. lilacinum 6064 isolate (PNG).

https://doi.org/10.1371/journal.pone.0297925.s009

(PNG)

S9 Fig. GC-MS chromatogram of secondary metabolites from P. lilacinum 6381 isolate (PNG).

https://doi.org/10.1371/journal.pone.0297925.s010

(PNG)

S10 Fig. GC-MS chromatogram of secondary metabolites from P. lilacinum 6553 isolate (PNG).

https://doi.org/10.1371/journal.pone.0297925.s011

(PNG)

S11 Fig. GC-MS chromatogram of secondary metabolites from P. lilacinum 6887 isolate (PNG).

https://doi.org/10.1371/journal.pone.0297925.s012

(PNG)

S12 Fig. GC-MS chromatogram of secondary metabolites from P. lilacinum 6948 isolate (PNG).

https://doi.org/10.1371/journal.pone.0297925.s013

(PNG)

Acknowledgments

The authors wants to thank Head, Division of Plant Pathology and In-charge, Indian Type Culture Collection, IARI, New Delhi for providing the fungal isolates.

References

  1. 1. Abad P, Gouzy J, Aury JM, Castagnone-Sereno P, Danchin EG, Deleury E, et al. Genome sequence of the metazoan plant-parasitic nematode Meloidogyne incognita. Nat Biotechnol. 2008 Aug;26(8):909–15. https://doi.org/10.1038/nbt.1482
  2. 2. Jones JT, Haegeman A, Danchin EG, Gaur HS, Helder J, Jones MG, et al. Top 10 plant‐parasitic nematodes in molecular plant pathology. Mol Plant Pathol. 2013 Dec;14(9):946–61. pmid:23809086
  3. 3. Pulavarty A, Egan A, Karpinska A, Horgan K, Kakouli-Duarte T. Plant parasitic nematodes: A review on their behaviour, host interaction, management approaches and their occurrence in two sites in the Republic of Ireland. Plants. 2021 Oct 30;10(11):2352. pmid:34834715
  4. 4. Eisenback JD. Meloidogyne incognita (root-knot nematode). Invasive Species Compendium; CABI: Wallingford, UK. 2020. https://www.cabi.org/isc/datasheet/33245
  5. 5. Mai WF, Abawi GS. Interactions among root-knot nematodes and Fusarium wilt fungi on host plants. Annu Rev Phytopathol. 1987 Sep;25(1):317–38. https://doi.org/10.1146/annurev.py.25.090187.001533
  6. 6. Peiris PU, Li Y, Brown P, Xu C. Fungal biocontrol against Meloidogyne spp. in agricultural crops: A systematic review and meta-analysis. Biol Control. 2020 May 1;144:104235. https://doi.org/10.1016/j.biocontrol.2020.104235
  7. 7. Desaeger J, Wram C, Zasada I. New reduced-risk agricultural nematicides-rationale and review. J Nematol. 2020 Sep 3;52(1):1–6. https://doi.org/10.21307/jofnem-2020-091
  8. 8. Davies K, Spiegel Y, editors. Biological Control of Plant-Parasitic Nematodes:: Building Coherence between Microbial Ecology and Molecular Mechanisms. Springer Science & Business Media; 2011 Jun 27.
  9. 9. Prasad L, Pervez R, Gaba S. Bio-efficacy of fungal bioagents and its crude secondary metabolites against root knot nematode Meloidogyne incognita [(Kofoid & White, 1919)Chitwood, 1949] infesting tomato (Solanum lycopersicum L.). Redia: Giornale di Zoologia. 2021 Jan 1;104.
  10. 10. Siddiqui ZA, Mahmood I. Biological control of plant parasitic nematodes by fungi: a review. Bioresour Technol. 1996 Dec 1;58(3):229–39.
  11. 11. Morgan-Jones G, White JF, Rodriguez-Kabana R. Phytonematode pathology: Ultrastructural studies. II. Parasitism of Meloidogyne arenaria eggs and larvae by Paecilomyces lilacinus. Nematropica. 1984 Jun 1:57–71.
  12. 12. Jatala P. Biological control of plant-parasitic nematodes. Annu Rev Phytopathol. 1986 Sep;24(1):453–89. https://doi.org/10.1146/annurev.py.24.090186.002321
  13. 13. Hewlett TE, Dickson DW, Mitchell DJ, Kannwischer-Mitchell M. Evaluation of Paecilomyces lilacinus as a biocontrol agent of Meloidogyne javanica on tobacco. J Nematol. 1988 Oct;20(4):578.
  14. 14. Jacobs P. Nematophagous fungi. BRIC version (www. biological-research. com). 2002.
  15. 15. Kiewnick S, Sikora RA. Biological control of the root-knot nematode Meloidogyne incognita by Paecilomyces lilacinus strain 251. Biol Control. 2006 Aug 1;38(2):179–87. https://doi.org/10.1016/j.biocontrol.2005.12.006
  16. 16. Huang WK, Cui JK, Liu SM, Kong LA, Wu QS, Peng H, et al. Testing various biocontrol agents against the root-knot nematode (Meloidogyne incognita) in cucumber plants identifies a combination of Syncephalastrum racemosum and Paecilomyces lilacinus as being most effective. Biol Control. 2016 Jan 1;92:31–7. https://doi.org/10.1016/j.biocontrol.2015.09.008
  17. 17. Park JO, Hargreaves JR, McConville EJ, Stirling GR, Ghisalberti EL, Sivasithamparam K. Production of leucinostatins and nematicidal activity of Australian isolates of Paecilomyces lilacinus (Thom) Samson. Lett Appl Microbiol. 2004 Apr 1;38(4):271–6. https://doi.org/10.1111/j.1472-765X.2004.01488.x
  18. 18. Teles AP, Takahashi JA. Paecilomide, a new acetylcholinesterase inhibitor from Paecilomyces lilacinus. Microbiol Res. 2013 May 6;168(4):204–10. pmid:23219197
  19. 19. Sharma A, Gupta A, Dalela M, Sharma S, Sayyed RZ, Enshasy HA, et al. Linking organic metabolites as produced by Purpureocillium lilacinum 6029 cultured on Karanja deoiled cake medium for the sustainable management of root-knot nematodes. Sustainability. 2020 Oct 8; 12(19):8276. https://doi.org/10.3390/su12198276
  20. 20. Degenkolb T, Vilcinskas A. Metabolites from nematophagous fungi and nematicidal natural products from fungi as an alternative for biological control. Part I: metabolites from nematophagous ascomycetes. Appl Microbiol Biotechnol. 2016 May;100:3799–812. pmid:26715220
  21. 21. Luangsa-Ard JJ, Hywel-Jones NL, Samson RA. The polyphyletic nature of Paecilomyces sensu lato based on 18S-generated rDNA phylogeny. Mycologia. 2004 Jul 1;96(4):773–80. https://doi.org/10.1080/15572536.2005.11832925
  22. 22. Luangsa-Ard J, Houbraken J, van Doorn T, Hong SB, Borman AM, Hywel-Jones NL, et al. Purpureocillium, a new genus for the medically important Paecilomyces lilacinus. FEMS Microbiol Lett. 2011 Aug 1;321(2):141–9. https://doi.org/10.1111/j.1574-6968.2011.02322.x
  23. 23. Devran Z, Polat İ, Mıstanoğlu İ, Baysal Ö. A novel multiplex PCR tool for simultaneous detection of three root-knot nematodes. Australasian Plant Pathol. 2018 Jul;47:389–92. https://doi.org/10.1007/s13313-018-0570-z
  24. 24. Bowles J, Blair D, McManus DP. Genetic variants within the genus Echinococcus identified by mitochondrial DNA sequencing. Mol. Biochem. Parasitol. 1992 Sep 1;54(2):165–73. pmid:1435857
  25. 25. Ehwaeti ME, Phillips MS, Trudgill DL. The viability of Meldidogyne incognita eggs released from egg masses of different ages using different concentrations of sodium hypochlorite. Nematologica. 1998 Jan 1;44(2):207–19. https://doi.org/10.1163/005325998X00081
  26. 26. Kesba H, Abdel-Rahman A, Sayed S, Al-Sayed AS. Screening the nematicidal potential of indigenous medicinal plant extracts against Meloidogyne incognita under lab. and greenhouse conditions. Egypt J Biol Pest Control. 2021 Dec;31(1):1–2. https://doi.org/10.1186/s41938-021-00429-y
  27. 27. Kassam R, Yadav J, Chawla G, Kundu A, Hada A, Jaiswal N, et al. Identification, characterization, and evaluation of nematophagous fungal species of Arthrobotrys and Tolypocladium for the management of Meloidogyne incognita. Front Microbiol. 2021 Dec 10;12:790223. https://doi.org/10.3389/fmicb.2021.790223
  28. 28. Jang JY, Choi YH, Shin TS, Kim TH, Shin KS, Park HW, et al. Biological control of Meloidogyne incognita by Aspergillus niger F22 producing oxalic acid. PloS one. 2016 Jun 3;11(6):e0156230. pmid:27258452
  29. 29. Samson RA. Paecilomyces and some allied hyphomycetes. Baarn: Centraalbureau voor Schimmelcultures; 1974 Jun; Stud Mycol 6:1–119
  30. 30. Djian C, Pijarowski L, Ponchet M, Arpin N, Favre-Bonvin J. Acetic acid: a selective nematicidal metabolite from culture filtrates of Paecilomyces lilacinus (Thom) Samson and Trichoderma longibrachiatum Rifai. Nematologica. 1991 Jan 1;37(1–4):101–12. https://doi.org/10.1163/187529291X00105
  31. 31. Stadler M, Mayer A, Anke H, Sterner O. Fatty acids and other compounds with nematicidal activity from cultures of Basidiomycetes. Planta Med. 1994 Apr;60(02):128–32. pmid:8202563
  32. 32. Gapasin RM, Vasquez EA, Rendon GA. Bioassay-guided identification of the nematicidal secondary metabolites from Paecilomyces lilicanus for the control of root-knot nematode (Meloidogyne graminicola, Golden and Birchfield). Ann trop res. 2011;33(2):22–43. https://doi.org/10.32945/atr3322.2011
  33. 33. Zhang WP, Ruan WB, Deng YY, Gao YB. Potential antagonistic effects of nine natural fatty acids against Meloidogyne incognita. J Agric Food Chem. 2012 Nov 21;60(46):11631–7. https://doi.org/10.1021/jf3036885
  34. 34. Sharma A, Sharma S, Yadav S, Naik SN. Role of Karanja deoiled cake based medium in production of protease and fatty acids by Paecilomyces lilacinus 6029. J Biosci Bioeng. 2014 Sep 1;118(3):270–1. https://doi.org/10.1016/j.jbiosc.2014.02.020
  35. 35. Liu YJ, Zhai CY, Liu Y, Zhang KQ. Nematicidal activity of Paecilomyces spp. and isolation of a novel active compound. J Microbiol. 2009 June 47(3):248–52. Epub 2009 Jun 26. pmid:19557340.
  36. 36. Stadler M, Anke H, Sterner O. Linoleic acid—The nematicidal principle of several nematophagous fungi and its production in trap-forming submerged cultures. Arch Microbiol. 1993 Nov;160:401–5.
  37. 37. Browning M, Dawson C, Alm SR, Gorres JH, Amador JA. Differential effects of butyric acid on nematodes from four trophic groups. Appl Soil Ecol. 2004 Sep 1;27(1):47–54. https://doi.org/10.1016/j.apsoil.2004.03.005
  38. 38. Browning M, Wallace DB, Dawson C, Alm SR, Amador JA. Potential of butyric acid for control of soil-borne fungal pathogens and nematodes affecting strawberries. Soil Biol Biochem. 2006 Feb 1;38(2):401–4. https://doi.org/10.1016/j.soilbio.2005.05.020
  39. 39. Ntalli NG, Vargiu S, Menkissoglu-Spiroudi U, Caboni P. Nematicidal carboxylic acids and aldehydes from Melia azedarach fruits. J Agric Food Chem. 2010 Nov 10;58(21):11390–4. pmid:20925380
  40. 40. Chen JX, Song BA. Natural nematicidal active compounds: Recent research progress and outlook. J Integr Agric. 2021 Aug 1;20(8):2015–31. https://doi.org/10.1016/S2095-3119(21)63617-1
  41. 41. Rompalli R, Mehendrakar SR, Venkata PK. Evaluation of potential bio-control agents on root-knot nematode Meloidogyne incognita and wilt causing fungus Fusarium oxysporum f. sp. conglutinans in vitro. Afr J Biotechnol. 2016 Jun 6;15(19):798–805.
  42. 42. dela piza RM. Nematicidal activity of Paecilomyces lilacinus (Thom) Samson culture filtrate against root-knot nematode, Meloidogyne incognita (Kofoid and White) Chitwoood. B.S. Thesis, Leyte State University. 2003.
  43. 43. Cayrol JC, Djian C, Pijarowski L. Study of the nematicidal properties of the culture filtrate of the nematophagous fungus Paecilomyces lilacinus. Revue de Nematologie. 1989;12(4):331–6.
  44. 44. Khan MR, Goswami BK. Effect of culture filtrates of Paecilomyces lilacinus isolates on hatching of Meloidogyne incognita eggs. Ann Plant Prot Sci. 2000;8(1):62–5.
  45. 45. Perveen Z, Shahzad S. A comparative study of the efficacy of Paecilomyces species against root-knot nematode Meloidogyne incognita. Pak. J. Nematol. 2013 Jul 1;31(2):125–31.
  46. 46. Siddiqui IA, Qureshi SA, Sultana V, Ehteshamul-Haque S, Ghaffar A. Biological control of root rot-root knot disease complex of tomato. Plant Soil. 2000 Dec;227:163–9. https://doi.org/10.1023/A:1026599532684
  47. 47. Maltese WA, Overmeyer JH. Methuosis: nonapoptotic cell death associated with vacuolization of macropinosome and endosome compartments. Am J Pathol. 2014 Jun 1;184(6):1630–42. pmid:24726643
  48. 48. Seo Y, Kim YH. Control of Meloidogyne incognita using mixtures of organic acids. Plant Pathol J. 2014 Dec 30(4):450. https://doi.org/10.5423%2FPPJ.NT.07.2014.0062
  49. 49. Anke H, Sterner O. Nematicidal metabolites from higher fungi. Curr Org Chem. 1997 Nov 1;1(4):361–74. https://doi.org/10.1016/j.apsoil.2004.03.005