Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Molecular characterization of mitochondrial COI gene sequences in Micraspis allardi from Pakistan

  • Rida Asrar,

    Roles Data curation, Investigation, Software, Writing – review & editing

    Affiliation Institute of Physiology and Pharmacology, Faculty of Veterinary Science, University of Agriculture, Faisalabad, Pakistan

    ⨯
  • Mariyam Masood,

    Roles Formal analysis, Software

    Affiliation Department of Zoology, Government College Women University, Faisalabad, Pakistan

    ⨯
  • Imran Bodlah ,

    Roles Data curation, Validation

    imranbodlah@gmail.com

    Affiliation Insect Biodiversity and Conservation Group, Department of Entomology, Pir Mehr Ali Shah Arid Agriculture University, Rawalpindi, Pakistan

    ⨯
  • Ghulam Rasool,

    Roles Methodology, Visualization

    Affiliation Institute of Molecular Biology and Biotechnology (IMBB), The University of Lahore, Lahore, Pakistan

    ⨯
  • Nazia Suleman,

    Roles Investigation, Resources, Writing – original draft

    Affiliation Nuclear Institute for Agriculture and Biology, Faisalabad, Pakistan

    ⨯
  • Sumaira Yousaf

    Roles Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Resources, Software, Supervision, Validation, Visualization, Writing – review & editing

    Affiliation Nuclear Institute for Agriculture and Biology, Faisalabad, Pakistan

    ⨯

Abstract

The Coccinellidae is a highly diversified family of order Coleoptera. Coccinellid ladybirds are well known for their role as biological control agent against varied range of agricultural pests. The samples of coccinellid ladybird collected from Pakistan were identified and characterized as Micraspis allardi (Mulsant, 1866). This is one of the least-studied ladybird species with limited work on its ecological distribution as a biological control agent. The genus Micraspis has vast genetic diversity with a possible presence of unknown number of cryptic species. Sequence information of some species of the genus Micraspis are present in NCBI database. However, least molecular data or sequences describing M. allardi could be available from database. Therefore, morphological and molecular characterization was imperative for this species. Here, the samples collected from sugarcane field of Faisalabad District of Pakistan and were identified by using morphological and molecular protocols. For molecular identification, two different regions of mitochondrial cytochrome c oxidase I (COI) gene (COI-5′ and COI- 3′) were used as molecular markers for the identification of the species. Morphological appearance, DNA sequence similarity searches and phylogenetic analysis collectively indicated it as M. allardi. To the best of our knowledge, this is the first report providing molecular evidence of M. allardi using mitochondrial DNA barcode region (658bp) as well as mtCOI-3ʹ sequences (817bp). The study will help in understanding population genetics through diversity analysis, ecological role, and phenotypic structures associated with the geographic range of this species.

Citation: Asrar R, Masood M, Bodlah I, Rasool G, Suleman N, Yousaf S (2023) Molecular characterization of mitochondrial COI gene sequences in Micraspis allardi from Pakistan. PLoS ONE 18(12): e0294034. https://doi.org/10.1371/journal.pone.0294034

Editor: Muhammad Arif, Sakarya Uygulamali Bilimler Universitesi, TURKEY

Received: May 29, 2023; Accepted: October 24, 2023; Published: December 27, 2023

Copyright: © 2023 Asrar et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are available in the NCBI Genbank repository. Accession numbers OP263122, OP263123, OP263124, OP263125- OP263126, OP263097, OP263098, OP263099, OP263100, OP263101, OP263102, OP263103, OP263104, OP263105, OP263106, OP263107, OP263108, OP263109, OP263110, OP263111.

Funding: The authors received no specific funding for this work.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Ladybird beetles (Coleoptera; Coccinellidae) are found globally, with over 6,000 described species [1] classified in around 360 genera, of which 90% are regarded as beneficial with substantial agricultural significance in biological control programs [2, 3] Micraspis allardi (Mulsant, 1866) is a predatory coccinellid with ecological distribution in Indonesia, Pakistan India, Nepal, Myanmar, Bangladesh, and Bhutan [4–6] with a host range consisting mainly of plant hoppers [7], aphids [8, 9] and psyllids [10, 11]. Although ecology, diversity and distribution of this species has been reported from Pakistan [4, 12, 13]. Even though molecular sequences of some other species of Micraspis have also been reported and are present on NCBI data base. However, M. allardi has morphological descriptions based on phenotypic features only. So far, molecular data or sequences regarding characterization of M. allardi are not available on the NCBI website.

To better understand and utilize ladybird beetles as a bio-resource, proper classification and identification are required [14]. Different molecular markers, some particular DNA sequences, have been reported for the identification of species [15–17]. The mitochondrial cytochrome c oxidase subunit I (mtCOI) gene having variable sequences contributes a lot to species identification. However, some species showed limited sequence variability, while others display high level of polymorphisms, thus complicating species identification. A specific region from 5ʹ end of mtCOI gene (658 bp) has been recommended as a uniform DNA “barcode” region for the identification of species of all animals [18, 19]. Species recognition in Coccinellini is mainly based on morphological characters and DNA barcoding. The morphological identification of ladybird is difficult due to small size; however, DNA barcode identification is very effective and has been reported previously [20–22]. The identification of species using DNA barcode depends upon genetic distances and differences between intra as well as interspecific divergences [23, 24]. In addition, the aptness of the COI region to differentiate known species, identification of cryptic species as well as species-level phylogenetic relationships is imperative [19, 25]. Therefore, DNA barcoding using the 5ʹ region of mitochondrial COI DNA sequence is an effective and reliable tool for identifying specimens of unknown origin and taxonomic status [18, 26] belonging to multiple texa including Coccinellidae species [19, 27]. Bold Systems (Taxonomic browser) indicated very limited information for M. allardi with one specimen record from Pakistan but without molecular characterization. However, the NCBI data base showed partial sequences of COI-5ʹ region for Coccinellidae sp. (JF890394, JF890394, JF890535, JF890581) submitted from Pakistan.

Here, the collected specimens of beetle from Pakistan were identified as M. allardi according to morphological appearance as well as molecular characterization using mitochondrial cytochrome c oxidase subunit 1 (COI) gene sequences (mtCOI-3ʹ and mtCOI-5ʹ “barcodes region”). The availability of these gene sequences may allow the deposition of mitochondrial reference sequences of this species in commonly used repositories like the Barcode of Life database (BOLD), which is mainly used for molecular community analyses and help in species identification [28–30]. To use M. allardi as a biocontrol agent against sucking insect pests like aphids, plant hoppers, and whiteflies, insufficient information regarding M. allardi demands detailed sequence analysis and molecular characterization.

Materials and methods

Sample collection and morphological identification

Samples of beetle were collected from sugarcane crops at Faisalabad, Pakistan (Latitude: 31° 4’ 3.4104". Longitude: 72° 57’ 58.6872").

Morphological identification was performed with the help of main taxonomic characters provided in previous studies [31], based on morphological characteristics and male genitalia. The collected specimens were identified up to species level by comparison with other related identified species. Adult specimens and their genitalia were photographed with the help of digital camera (Amscope 18 megapixel camera) attached to LEICA MS5 microscope. The methodology for genitalia extraction and microphotography follows previous studies [31, 32] Some beetles were preserved in 80% ethanol for further processing of DNA extraction and molecular identification.

DNA extraction and PCR amplification

Three independent samples were selected for molecular identification. Genomic DNA extraction was done using the CTAB method with some modifications and quantified the extracted DNA using nanodrop spectrophotometer (Thermo Scientific Multiskan GO™). PCR amplifications were carried out using universal primer pairs C1J2195/TL2N3014 (TTGATTTTTTGGTCATCCAGAAGT/ TCCAATGCACTAATCTGCCATATTA) and LCO1490/HCO2198 (GGTCAACAAATCATAAAGATATTGG /TAAAGTTCAGGGTGACCAAAAAATCA) for mtCOI-3ʹ and mtCOI-5ʹ regions, respectively [33, 34]. The PCR reaction mixture contained 2X DreamTaq Green PCR Master Mix (Thermo Fisher Scientific), primers, and beetle DNA. The PCR cycling parameters were one denaturation cycle of 94°C for 5 min, followed by 35 cycles of 94°C for 1 min, 40°C for 1 min, and 72°C for 1 min, followed by a final extension of 72°C for 7 min for the mtCOI-3ʹ fragment. While for the mtCOI-5ʹ fragment same profile was used but the annealing temperature was 45°C for 1 min.

Cloning, sequencing and sequence analysis

The PCR products were ligated in the pTZ57R/T plasmid vector (Thermo Fisher Scientific), transformed into E.coli strain Top10 and confirmed by restriction analysis [26]. The confirmed clones were sequenced, and the sequences of each cloned insert were determined by bi-directional, automated Sanger dideoxy chain termination sequencing from Eurofins Genomics. The DNA sequences were assembled, aligned, and edited using Lasergene software (DNASTAR, Madison, WI). Sequence alignment and pairwise distance analyses were performed using MEGA7 [35]. The sequences were submitted to NCBI Genbank.

The model of evolution was selected based on a consensus of the Bayesian Information Criterion (BIC), the corrected Akaike Information Criterion (AICc), and the maximum likelihood parameters) using MEGA7 [35]. The General Time Reversal model (GTR+G+I), with gamma distributed rate of variation among sites being best-fit model of evolution for both mtCOI-3ʹ and mtCOI-5ʹ fragments was used. The phylogenetic trees for both mtCOI-3ʹ and mtCOI-5ʹ sequences were constructed with the sequences downloaded from the database separately using the Maximum Likelihood method [35]. 500 bootstrap replicates were used to test the reliability of the constructed tree. Phylogenetic trees were rooted with the Bemisia tabaci mtCOI-3ʹ and COI-5ʹ sequences as out-group.

Results

Morphological identification

Description.

Body (Fig 1a) Dorsum glabrous, slightly round, moderately convex; head with mouth-parts and antennae brown; scutellum small and brownish; pronotum yellowish brown with two basal circular black spots; elytra brown and sometimes pink with black four spots; elytral suture with black strip; under surface brown; prosternal process without carinae; first abdominal ventrite (Fig 1b) with medially separate and incomplete post-coxal line.

thumbnail
Download:
Fig 1. Morphological description of the Micraspis allardi.

(a): Dorsal-view (b): Abdomen (c): Penis (d): Tegmen lateral-view (e): Tegmen ventral-view.

https://doi.org/10.1371/journal.pone.0294034.g001

Male genitalia.

Penis (Fig 1c) is thin; the penis capsule (Fig 1d) has a long outer arm and short inner arm; the penis apex (Fig 1c) is blunt and has a small thread-like structure on the inner side. Tegmen (Fig 1d and 1e) are robust; the penis guide is broader at the base by about a third of its length, and the last two-thirds of its length gradually tapers into a slightly curved apex in lateral view (Fig 1d), but narrows abruptly into a blunt tip in ventral view (Fig 1e).

Comments.

The following characteristics distinguish Micraspis allardi from other species in the genus Micraspis: The penis (Fig 1c) is narrow, and the penis guide (Fig 1d) is wider at its base than it is at its apex.

Amplification of mitochondrial COI barcode and 3ʹ regions

The universal primers LCO1490/HCO2198 amplified and 658 bp product was obtained barcode 5ʹ region and primer pairs C1J2195/TL2N3014 produced 817 bp fragments from COI 3ʹ region. The cloned PCR products were confirmed using EcoRI and HindIII restriction enzymes revealed the same PCR sizes. Five more repetitive sequences of the confirmed clones were selected for the construction of a phylogenetic tree.

Phylogenetic analysis of mtCOI-3ʹ and mtCOI-5ʹ sequences

The raw Sanger sequences were cleaned to remove restriction enzyme sites, trimmed to the same length, and aligned. We applied the Kimura-2-parameter (K2P) model for DNA barcoding analysis. This study reports five sequences of mtCOI-5ʹ with accession numbers OP263122- OP263126 and fifteen sequences of mtCOI-3ʹ region, submitted to database with accession numbers OP263097- OP263111. To find out the sequence similarity of mtCOI-5ʹ and mtCOI-3ʹ sequences, BLAST search was used. The most similar sequences were downloaded from the databases. During the BLAST search of mtCOI-3ʹ sequences, no reference sequence having a similarity of more than 85–87% was found in the database (Fig 2). Therefore, this is the first report of the mtCOI-3ʹ sequence of the beetle sample identified as Micraspis allardi.

thumbnail
Download:
Fig 2. Phylogeny analysis of COI-3ʹ sequences.

Phylogenetic tree analysis of under study beetle species (red colour) with sequences from the database.

https://doi.org/10.1371/journal.pone.0294034.g002

However, BLAST search of mtCOI-5ʹ (barcode) sequences showed 100% similarity with the four sequences in database having Accession Nos. JF890394, JF890395, JF890535 and JF890581 but named as Coccinellidae sp. BOLD: AAP7928 (unpublished data). The analysis of our sequences alogwith the morphological identification, phylogenetic analysis and, and the sequences of mtCOI-5 collected from BOLD systems determined that beetle species described here is M. allardi. The sequences considerably expand the known morphological disparity of the species. Phylogenetic analysis of our samples also confirmed that JF890394, JF890395, JF890535, and JF890581 are the sequences of M. allardi (Fig 3). Sequence analysis of both fragments confirmed that the under-study beetle species belongs to the M. allardi. This study firstly reported the molecular identification and characterization of M. allardi using two fragments (mtCOI-3 and mtCOI-5) of mitochondrial COI gene sequences.

thumbnail
Download:
Fig 3. Phylogenetic analysis of COI-5ʹ sequences.

Phylogenetic tree analysis of under study beetle species (red colour) with sequences from the database.

https://doi.org/10.1371/journal.pone.0294034.g003

Distance analysis

Regarding COI-3ʹ sequences obtained for our samples, the intraspecific distance ranged from 0.0–3.5% while the mean distance was 1.5%. A maximum interspecific distance was found to be 3.5% for the accession OP263110. However, for the COI-5ʹ sequences of the study, the intraspecific distance ranged from 0.0–2.1% while the mean distance was 0.8%. Thus, the distances among sequences showed that the sequences under study are of same species, M. allardi.

Discussion

Here we present the first mitochondrial cytochrome c oxidase subunit 1 (COI) gene sequences COI-3ʹ and COI barcodes of M. allardi. Previous molecular work on Micraspis species has provided information regarding other species. The genus Micraspis) comprises vast genetic diversity, yet the unknown number of cryptic species may be present and should be reviewed using morphological and molecular characterization. The family Coccinellidae comprises two subfamilies: Microweiseinae Leng, and Coccinellinae Latreille also Coccinellinae consists of two tribes: Coccinellini and Chilocorini [36]. Coccinellidae contains a group of beetles that are considered important for their role in biological control [37; 38] and their diversity in varied habitats [5]. Recently, M. allardi (Coleoptera: Coccinellidae) has been reported as a biological control agent of P. Perpusilla, a sugarcane crop pest [39]. We also collected samples from sugarcane crops during a biological control study from the vicinity of Faisalabad. Previously its presence has been reported from the Faisalabad region [9, 40]. The collected sample of M. allardi has been identified using the morphological characteristics in Pakistan as described earlier [41] however other species have been characterized at molecular level [42–44].

So far, the species recognition of M. allardi is by morphological characteristics only as no data regarding molecular identification is available. While investigating the BOLD system [30], there is only one record from Pakistan (http://v3.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=393866). However, there are four sequences of barcode region submitted in NCBI database (http://v3.boldsystems.org/index.php/Taxbrowser Taxonpage?taxid = 105896). The mtCOI-5ʹ resultant sequences of this study had sequence similarity identical to partial sequences of COI-5ʹ region for Coccinellidae sp (JF890394, JF890395, JF890535, JF890581). To date, no mtCOI-3ʹ sequences of M. allardi have been submitted and published. This first report uses the nucleotide sequences of two mitochondrial cytochrome oxidase I gene regions, COI-3ʹ and COI-5ʹ also termed as barcode region. Characterization of M. allardi using this technique provided accurate identification of the subject specie for future investigations and various research areas. Similar to previous reports, this study also utilized the COI gene for species identification, considered the best tool for identifying economically important species. Our study adds the first mitochondrial COI sequences of M. allardi to databases and thereby makes mitochondrial barcoding available for further studies on this important biocontrol agent. Future studies should build reference databases based upon M. allardi COI and other molecular marker genes combined with the morphological identification of species from diverse locations.

Conclusion

This study provides the first sequences of M. allardi based upon mitochondrial COI marker. These sequences will be helpful for DNA barcoding of this biocontrol agent worldwide.

References

  1. 1. Andow DA, Fontes EM, Pires CS, Souza LM, Paula DP. Invasion of the coccinellid community associated with a tropical annual agroecosystem. Ecological Entomology. 2023 Apr;48(2):174–85.
  2. 2. Nagdev P, Beerendra KG, Ganguli J, Ganguli RN. Feeding efficiency of predatory coccinellid beetle, Menochilus sexmaculatus (Fabricius) on cowpea aphid (Aphis craccivora Koch) under laboratory conditions at Raipur, Chhattisgarh. 2022. SP-11(8): 910–912.
  3. 3. Lira R, do Nascimento DV, Barbosa PR, Simmons AM, Torres JB. Predation performance and survival of susceptible and pyrethroid-resistant Eriopis connexa Germar (Coleoptera: Coccinellidae) to insecticides used in brassica crops. Pest Management Science. 2023 Mar 11. pmid:36905633
  4. 4. Ali M, Ahmed K, Ali S, Raza G, Hussain I, Nafees MA, et al. An annotated checklist of Coccinellidae with four new records from Pakistan (Coleoptera, Coccinellidae). ZooKeys. 2018(803):93. pmid:30643484
  5. 5. Mishra AK, Yousuf M. Notes on coccinellid beetles (Coleoptera: Coccinellidae) from forest ecosystem of Uttarakhand, India. Journal of Biological Control. 2019 May 24:1–6.
  6. 6. Dorji C, Loday P, Vorst O. A preliminary checklist of the Coccinellidae of Bhutan (Insecta: Coleoptera). Zootaxa. 2019 Dec 23;4712(4):497–530.
  7. 7. Pal S, Bhatt J. Feeding Efficiency of Six Beetle Species against Mustard Aphid, Lipaphis erysimi (Kalt.) in Uttarakhand, India. Int. J. Curr. Microbiol. App. Sci. 2018;7(4):1970–6.
  8. 8. Chaudhary HC, Singh R. Records of the predators of aphids (Homoptera: Aphididae) in eastern Uttar Pradesh. The Aphidiological Society of India. 2012;25:13–30.
  9. 9. Ehsan N, Naureen R. Population dynamics of predatory coccinilids in cereal crops of district Faisalabad. Pakistan Journal of Agricultural Sciences. 2019 Dec 1;56(4).
  10. 10. Singh S, Sharma DR. Coccinellid predators beetles of insect pests of citrus in the Indian Punjab. Crop Improvement. 2010;37(2):207-.
  11. 11. Ramya HR, Thangjam R. Predatory coccinellids of insect pests of Assam lemon (Citrus limon L. Burmf) in Jorhat district of Assam. Journal of Biological control. 2016 Aug 26:121–3.
  12. 12. Hussain M, Malik MF, Siddique S, Umar M, Zainab T, Zafar F. Diversity and Distribution of Coccinellid Beetles in Irrigated and Rainfed Fields of Gujrat, Punjab, Pakistan. Punjab Univ. J. Zool. 2018;33:1–6.
  13. 13. Ahmed KS, Majeed MZ, Rafi MA, Sellami F, Afzal M. Biodiversity and Species Distribution of Coccinellids (Coccinellidae: Coleoptera) in District Sargodha (Punjab), Pakistan. Pakistan Journal of Zoology. 2017 Sep 1;49(5).
  14. 14. Che L, Zhang P, Deng S, Escalona HE, Wang X, Li Y, et al. New insights into the phylogeny and evolution of lady beetles (Coleoptera: Coccinellidae) by extensive sampling of genes and species. Molecular Phylogenetics and Evolution. 2021 Mar 1;156:107045. pmid:33352317
  15. 15. Tautz D., Arctander P., Minelli A., Thomas R. H. & Vogler A. P. DNA points the way ahead in taxonomy. Nature 418, 479 (2002). pmid:12152050
  16. 16. Will KW, Rubinoff D. Myth of the molecule: DNA barcodes for species cannot replace morphology for identification and classification. Cladistics. 2004 Feb;20(1):47–55. pmid:34892971
  17. 17. Oh JH, Kim S, Lee S. DNA barcodes reveal population-dependent cryptic diversity and various cases of sympatry of Korean leptonetid spiders (Araneae: Leptonetidae). Scientific Reports. 2022 Sep 15;12(1):15528. pmid:36109541
  18. 18. Vidya CV, Bhaskar H, Chaitanya R, Mathew D. Stethorini (Coleoptera: Coccinellidae: Coccinellinae) of South India: their associated mite species and barcode gap analysis. Egyptian Journal of Biological Pest Control. 2022 Dec;32(1):1–9.
  19. 19. Huang W, Xie X, Huo L, Liang X, Wang X, Chen X. An integrative DNA barcoding framework of ladybird beetles (Coleoptera: Coccinellidae). Scientific Reports. 2020 Jun 22;10(1):10063. pmid:32572078
  20. 20. Seago AE, Giorgi JA, Li J, Ślipiński A. Phylogeny, classification and evolution of ladybird beetles (Coleoptera: Coccinellidae) based on simultaneous analysis of molecular and morphological data. Molecular Phylogenetics and Evolution. 2011 Jul 1;60(1):137–51. pmid:21426943
  21. 21. Greenstone MH, Vandenberg NJ, Hu JH. Barcode haplotype variation in north American agroecosystem lady beetles (Coleoptera: Coccinellidae). Molecular Ecology Resources. 2011 Jul;11(4):629–37. pmid:21457477
  22. 22. Wang ZL, Wang TZ, Zhu HF, Wang ZY, Yu XP. DNA barcoding evaluation and implications for phylogenetic relationships in ladybird beetles (Coleoptera: Coccinellidae). Mitochondrial DNA Part A. 2019 Jan 2;30(1):1–8. pmid:29514522
  23. 23. Taylor H. R. & Harris W. E. 2012. An emergent science on the brink of irrelevance: a review of the past 8 years of DNA barcoding. Mol.Ecol. Resour. 12(3), 377–388. pmid:22356472
  24. 24. Shimbori EM, Querino RB, Costa VA, Zucchi RA. Taxonomy and Biological Control: New Challenges in an Old Relationship. Neotropical Entomology. 2023 Jan 19:1–22.
  25. 25. Pons J, Barraclough TG, Gomez-Zurita J, Cardoso A, Duran DP, Hazell S, Kamoun S, Sumlin WD, Vogler AP. Sequence-based species delimitation for the DNA taxonomy of undescribed insects. Systematic biology. 2006 Aug 1;55(4):595–609. pmid:16967577
  26. 26. Yousaf S, Rehman A, Masood M, Ali K, Suleman N. Occurrence and molecular identification of an invasive rice strain of fall armyworm Spodoptera frugiperda (Lepidoptera: Noctuidae) from Sindh, Pakistan, using mitochondrial cytochrome c oxidase I gene sequences. Journal of Plant Diseases and Protection. 2022 Feb;129(1):71–8.
  27. 27. Hanif A, Manan A, u Rehman F, Ali I. DNA Barcoding as A Tool for Taxonomic Identification of Ladybird Beetles (Coleoptera: Coccinellidae) from Pakistan: A Review. Pak-Euro Journal of Medical and Life Sciences. 2023 Jun 30;6(1):39–46.
  28. 28. Ratnasingham S, Hebert PD. BOLD: The Barcode of Life Data System (http://www.barcodinglife.org). Molecular ecology notes. 2007 May;7(3):355–64.
  29. 29. Quince C, Walker AW, Simpson JT, Loman NJ, Segata N. Shotgun metagenomics, from sampling to analysis. Nature biotechnology. 2017 Sep;35(9):833–44. pmid:28898207
  30. 30. Pilgrim J. The opportunities of research parasitism: A case study using the Barcode of Life Data System (BOLD). GigaScience. 2022;11:giac123. pmid:36472572
  31. 31. Hayat A., Khan MR, and Naz F, Subfamilies Coccinellinae and Coccidulinae (Coccinellidae: Coleoptera) with new records from AJK, Pakistan. Journal of Applied Environmental and Biological Sciences. 2017.7(4): 12–66.
  32. 32. Majerus M, P Kearns, Naturalists Hand Books “Lady Birds” University of Cambridge. Richmond Publishing Co. Ltd. England. 1989101pp.
    • 33. Frohlich DR, Torres-Jerez I, Bedford ID, Markham PG, Brown JK. A phylogeographical analysis of the Bemisia tabaci species complex based on mitochondrial DNA markers. Molecular ecology. 1999 Oct;8(10):1683–91. pmid:10583831
    • 34. Vrijenhoek R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol. 1994;3(5):294–9. pmid:7881515
    • 35. Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular biology and evolution. 2016 Jul 1;33(7):1870–4. pmid:27004904
    • 36. Szawaryn K, Větrovec J, Tomaszewska W. A new tribe of the ladybird beetle subfamily Microweiseinae (Coleoptera: Coccinellidae) discovered on an island in the North Atlantic Ocean. Insects. 2020 Jun 13;11(6):367. pmid:32545733
    • 37. Li H, Li B, Lövei GL, Kring TJ, Obrycki JJ. Interactions among native and non-native predatory Coccinellidae influence biological control and biodiversity. Annals of the Entomological Society of America. 2021 Mar 1;114(2):119–36 pmid:33732410
    • 38. Vasista T, Chalam MS, Naidu KH. Predatorty potential of two aphidophagous coccinellids, Chilomenus sexmaculata Fabricus and Coccinella transversalis Fabricus on two aphid hosts Aphis craccivora Koch and Aphis gossypii glover. The Pharma Innovation Journal 2021; SP-10(9): 484–490.
    • 39. Wanasinghe VK, Chanchala KM, Nikpay A, Goebel FR. Biological Control of Sugarcane Pests in Sri Lanka: Current Status and Future Prospects.2022; 83–90.
    • 40. Abbas MN, Kausar S, Rana SA. Diversity and distribution of ladybird beetles (Coccinellidae) in the cropland of Faisalabad district. International journal of advanced research. 2013;1:27–33.
    • 41. Bodlah MA, Bodlah I, Tariq Rasheed M, e Fareen G, Ikram K, Iqbal Z, Zada R. Coccinellidae beetles (Coleoptera) fauna of district Layyah (Punjab), Pakistan. Asian Journal of Agriculture and Biology. 2021;1.
    • 42. Ghosh S, Behere GT, Agarwala BK. Molecular characterization of ladybird predators (Coleoptera: Coccinellidae) of aphid pests (Homoptera: Aphididae) in North East India. Current Science. 2017 Nov 10:1755–9.
    • 43. Poorani J. An annotated checklist of the Coccinellidae (Coleoptera)(excluding Epilachninae) of the Indian subregion. Oriental Insects. 2002 Jan 1;36(1):307–83.
    • 44. Poolprasert P, Senarat S, Nak-eiam S, Likhitrakarn N. Molecular taxonomic identification of predatory ladybird beetles inferred from COI Sequences (Coleoptera: Coccinellidae). Malaysian Journal of Applied Sciences. 2019 Dec 31;4(2):10–8.