Correction
12 Feb 2025: The PLOS ONE Staff (2025) Correction: A new record of the occurrence of Trichuris skrjabini Baskakov, 1924 in goats of Pakistan. PLOS ONE 20(2): e0319514. https://doi.org/10.1371/journal.pone.0319514 View correction
Figures
Abstract
More than 23 Trichuroidea species have been identified in ruminants in different parts of the world. Most are pathogenic, causing trichurosis. Trichuris adults of most species within this family have a predilection for the ceca, where they may cause damage to the epithelial wall. In the present study, Trichuris spp. from large intestine of goats were analysed based on morphological and molecular characteristics. Fifty adult worms (male = 25 and female = 25) were selected for morphometric and molecular analysis. Male Trichuris were distinguished by their longer spicules, typical spicule sheaths, and small spicules that were always completely covered by the spicule sheath. The presence of an uneverted vulva in the vagina distinguished female worms. We have performed the molecular characterisation of adult warms to identify as Trichuris skrjabini. Genetic comparison of T. skrjabini rDNA ITS2 sequences with those from other Trichuris spp. was performed to assess within and between species variation and validate the use of ITS-2 rDNA as a robust species-specific marker for T. skrjabini identification. This work provides the first report of this parasite species from Pakistan and validated species-specific marker of T. skrjabini that reduces the production potential of goats in the country.
Citation: Afshan K, Khan S, Khan B, Hussain S, Firasat S, Narjis G, et al. (2023) A new record of the occurrence of Trichuris skrjabini Baskakov, 1924 in goats of Pakistan. PLoS ONE 18(9): e0290906. https://doi.org/10.1371/journal.pone.0290906
Editor: Hudson Alves Pinto, Universidade Federal de Minas Gerais, BRAZIL
Received: June 24, 2023; Accepted: August 17, 2023; Published: September 1, 2023
Copyright: © 2023 Afshan et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: The datasets supporting the conclusion of this article are included within the article. And sequence data is available at https://data.mendeley.com/datasets/2mv8ngsg6p/1.
Funding: The research work presented in this article was funded by internal research fund of Quaid-i-Azam University Islamabad, Pakistan. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Trichuris (Roederer, 1761 –Nematoda: Trichuridae) infect a wide variety of mammalian hosts, including humans, ruminants, marsupials, rodents, and primates [1]. More than 23 species of Trichuris have been identified in ruminants [2], with the most common being Trichuris ovis, Trichuris skrjabini, and Trichuris discolor [3,4].
Different biometric and morphological traits have been employed in the taxonomic characterisation of the Trichuris species [5]. Only a few characteristics have been described, and congeneric species have not been sufficiently compared [6]. Although morphometric analysis provides keys for Trichuris identification, it is a more traditional approach that might lead to ambiguity due to overlapping morphological and morphometrical traits leading to taxonomic and nomenclatorial challenges [7].
In taxonomic groups of Trichuris with complex systematics and overlapping characterised by morphological convergence, using molecular methods to identify Trichuris at the species level is essential [8,9]. Numerous helminth investigations have used the ITS-2 of the ribosomal DNA (rDNA) as their target locus. This region is considered an acceptable genetic marker for resolving links at the species level [10]. Molecular methods have shown that not all species initially described by morphometric characteristics would remain fully identified [11,12]. Therefore, it is essential to use rDNA regions encompassing the ITS2 to identify Trichuris from sympatric areas worldwide [10,13]. Pakistan has an agriculture-based economy, with livestock being an integral part. The distribution of Trichuris in goats has been sporadically investigated in Pakistan. A few studies previously described Trichuris ovis through egg and adult morphology isolated from sheep and goats, whereas most simply identified at the genus level [14–19]. Trichuris suis (pig whipworm) and Trichuris vulpis (canine whipworm) are considered zoonotic parasites which can threaten the human population [20] and require more reliable methodologies to improve the knowledge of the Trichuris species. However, much of the discussion around integrative taxonomy deals with the merits of applying morphological versus molecular characteristics [21–23]. The present study is the first to confirm the species identity of Trichuris skrjabini from goats using the rDNA ITS-2 genetic marker. Our results suggest, in contrast to previous morphologically based studies, that Trichuris skrjabini is the predominant goats species in the Punjab province, Pakistan. There is no evidence of Trichuris ovis found in this study.
Materials and methods
Ethical approval
The collection of worms from the slaughtered animals does not require ethical approval, the animals were slaughtered for other purposes to meet the high protein demand of population. The study was approved by the Animal Ethics Committee of the Quaid-i-Azam University,Islamabad.
Worm collection
In this cross-sectional study, 231 slaughtered goats were examined between February and August 2022 at the Sihala abattoir in the Rawalpindi division of the Punjab province. The sample size was determined by using the formula [24],
(1)
where n was the sample size, Z was the desired confidence interval (95%), P was the expected proportion of infected animals in the population (0.35) and d was precision of estimation (5%). The calculated sample size was 188, but we increased it to 231 for greater precision. The animals were examined using a convenient random sample method. Fifty worms (2 to 3 worms per host) were recovered from the cecum or the cecal epithelial wall. The worms were rinsed in phosphate-buffered saline (PBS) before being preserved in 70% ethanol for morphometric and molecular analysis.
Morphological examination
50 adult warms (male = 25 and female = 25) were fixed for morphometric analysis. The worms were cleared in lactophenol and identified under the microscope [25]. Standardised measurements were obtained among the male characters, and spicule length is regarded as the most important criterion for differentiating Trichuris [26]. The main factors used to identify females are the vulvar morphology [27], the structure and lining of the vagina and, alternatively, the distance from the vulva to the uterine sphincter [3,8]. The descriptive univariate statistics based on mean values, standard deviation and range for all parameters were determined for male and female worms [9].
Genomic DNA extraction
Genomic DNA was extracted from 15 out of 50 individual worms of either sex. A small tissue sample of 2 mg was taken from each worm head and put in a petri dish with distilled water (dH2O) to prevent egg contamination. Each worm piece was rinsed twice for 5 min to remove all traces of ethanol. The worms were lysed in a 25 μl worm lysis solution made by mixing 50 μl of proteinase K (10 mg/ml, New England Bio Labs) in 1 ml of Direct PCR lysis reagent (Viagen) following the lysates were incubated for 2 hrs at 60°C and then for 15 min at 85°C [28].
PCR amplification of ITS-2 ribosomal DNA
A total of 500 bp of the ITS-2 region of the rDNA was amplified by using previously reported Trichuris-specific forward primer (ITS2-F: CTCGTAGGTCGTTGAAGAAC) [29] together with universal reverse primer (ITS2-R: TTAGTTTCTTTTCCTCCGCT) [30]. The 25 μl PCR reaction mixtures consisted of 2 μl of PCR buffer (1×) (Thermo Fisher Scientific, USA), 2 μl MgCl2 (25 mM), 2 μl of 2.5 mM dNTPs, 0.7 μl of the primer mix (10 pmol/μl final concentration of each primer), 2 μl of gDNA, and 0.3 μl of Taq DNA polymerase (5 U/μl) (Thermo Fisher Scientific, USA) and 16 μl ddH20. The thermocycler conditions were set at 96°C for 45 sec, followed by 35 cycles of 95°C for 45 sec, 50°C for 45 sec, and 72°C for 45 sec, with a final extension procedure of 72°C for 10 min. The amplified products were visualised by electrophoresis in 1% agarose gel (S1 Fig) PCR products were cleaned using a WizPrepTM Gel/PCR Purification Mini kit (Seongnam 13,209; South Korea).
Sequence and phylogenetic analysis of ITS-2 ribosomal DNA
PCR products were submitted for commercial sequencing (Macrogen, Korea), using the same amplification primers. Both strands of rDNA ITS-2 sequences from each worm were assembled, aligned, and edited to remove primers from both ends using the MUSCLE Alignment tool of the Geneious Pro 5.4 software [31]. The CD-HIT Suite software grouped sequences showing 100% base pair similarity into single unique sequence variants [32]. The unique sequence variants were further aligned with previously published NCBI GenBank rDNA ITS-2 of Trichuris species. All sequences of field samples and the GeneBank were trimmed to 388 bp, the length of the shortest sequence available that contained all the informative sites. The phylogenetic analysis was inferred using the Maximum Likelihood method and Kimura 2-parameter model [33]. The tree with the highest log likelihood (-2414.08) is shown. The percentage of trees where the associated taxa clustered together is displayed next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach and then selecting the topology with superior log likelihood value. A discrete Gamma distribution was used to model evolutionary rate differences among sites [5 categories (+G, parameter = 7.5222)]. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. All positions containing gaps and missing data were eliminated (complete deletion option).
Results
Morphological description
Family Trichuroidea (Ransom, 1911) Railliet, 1915
Genus Trichuris Roederer, 1761
Trichuris skrjabini (Baskakov, 1924)
General characteristics of Trichuris
Morphological characters revealed that the worms had a filiform anterior half and a broad handle-like posterior part (Fig 1). The narrow anterior part displays two different cuticular patterns. One side is heavily striated with transverse grooves, while the other is a delicately tuberculate band showing small circular elevated bodies uniformly spaced (Fig 1A). The anterior part of the body has a ventral side that tapers somewhat toward the cephalic end, revealing a broad longitudinally elongated "bacillary band" with typical cuticle inflations. A set of cephalic papillae surrounds the mouth, formed in two circles (an inner circle and a lateral circle), with a prominent organ, the stylet, emerging from the mouth cavity’s central portion.
Male worms characteristics
The body is 25–49 mm (36.6±7.65) long. The ratio between anterior and posterior body length is 2:1. The thin anterior part is 0.66:1 of the entire body length. The length of the oesophagus is 18–38 (24.4±7.08). The body’s posterior end is curved ventrally. The width at oesophageal region of body is 0.11–0.18 (0.16±0.02), the width at the level of oesophagus-intestinal junction is 0.21–0.75 (0.45±0.19), and the width of the posterior region of body is 0.57–0.96 (0.7±0.14). The distance from the head to the beginning of the bacillary stripes is 0.8–0.98 (0.86±0.06), and the length of the bacillary strips is 1.8–2 (1.92±0.07).
The reproductive system has a spicular tube with a length of 4.31–5.29 (5.0±0.43), diameter of spicule is 0.012–0.017 (0.014± 0.001), and the width of the proximal end of the spicule is 0.02–0.04(0.027±0.007). The maximum length of the spicular sheath is 1.07–1.4 (1.21±0.11), the width of the spicular sheath is 0.25–0.4(0.29±0.05), and the width of the spicular sheath at the tail end of body is 0.25–0.4 (0.29±0.05). The distal bulb/expansion length measurement is 0.13–0.21 (0.16±0.02), and the distal bulb/expansion width is 0.28–0.43(0.336±0.05). The testis is the first part of the genital apparatus, and it is very long and highly convoluted, starting in the posterior part of the male body, oriented anteriorly, and extending along the longitudinal axis of the body, finishing not far from the oesophagus transition into the intestine. The vas deferens run somewhat anteriorly along the intestine, connect the testis in the initial component of the genital apparatus and are pretty lengthy and convoluted to the ejaculatory duct via a tiny tube. The distance between posterior part of testis and tail end of body is 2.85–10.4(6.44±2.75). The length of the ejaculatory duct is 2.57–4.8(4.23±0.86), length of the cloaca is 3.51±0.48 (3.2–4.45). The spicule is in the distal cloacal tube, and protrudes from the sheath in a distinctive spherical expansion. The spines on distal expansion are longer than those on the spicular sheath (Fig 1B).
Female worms characteristics
The body is 36–69 mm (50.4±12.46) long. The ratio between anterior and posterior body length is 1.75:1. The thin anterior part is 0.63:1 on the entire body length (Fig 1C). The total length of the oesophagus is 18–52 (32±12.37). The width of the oesophageal region of the body is 0.15–0.22 (0.19±0.02), the body width at the level of the oesophagus-intestinal junction is 0.31–0.87 (0.47±0.20), the width of the posterior region of body is 0.7–1.1 (0.81±0.14). The distance from the head to the beginning of the bacillary stripes is 0.96–1.37 (1.26±0.15), and the length of bacillary stripes is 1.3–2.3 (1.68±0.37).
A single uterus and vulva are non-protrusive and with a length of 0.02–0.49 (0.24±0.15) at the confluence of the oesophagus and the intestine. The length of muscular zone of the oesophagus is 0.71–2 (1.00±0.49). The vagina is lengthy, about 2.3–4.45 (0.24±0.15), with circumvolutions close to the uterus, a brief straight zone, an extended middle part, and one gently coiled straight portion at the vulva. The distance of the uterus’s posterior loop from the body’s tail end is 0.14–1.24(0.92±0.41). The ovary is lengthy and connects to the oviduct in the back of the body. The distance of tail end of body and posterior fold of seminal receptacle is 0.34–0.5 (0.41±0.05). At the end of the tail, the anus is sub-terminally located (Fig 1C). The eggs found in the gravid uterus were barrel-shaped and had clear mucoid-appearing polar plugs with a brown outer covering (Fig 1C).
Taxonomic summary
Type host: Goat (Capra aegagrus hircus)
Site of infection: Cecum
Type locality: Rawalpindi Punjab
Genetic analysis of Trichuris
500 bp rDNA ITS-2 fragments were PCR amplified and sequenced from the abattoir-derived Trichuris collected from goats. All sequences in the alignment were trimmed to 388 bp (S2 Fig). The chromatogram revealed that 11 of the 15 different worms had clean rDNA ITS-2 sequences (https://data.mendeley.com/datasets/2mv8ngsg6p/1). Those 11 Trichuris sequences were aligned with 14 NCBI GeneBank sequences of different Trichuris species (3 sequences from Trichuris spp., 2 sequences from Trichuris skrjabini, one sequence from Trichuris leporis, 3 sequences from Trichuris ovis, one sequence from Trichuris colobae, 2 sequences from Trichuris trichiura, 2 sequences from Trichuris suis).
The genetic distance search of 11 Trichuris rDNA ITS2 sequences (present study) shows 99–100% similarity to a previously identified Trichuris skrjabini (AJ489248, KT630825), Trichuris spp. (KJ507245) and 96% similarity with Trichuris spp. (HQ844233) (Table 1). The further comparison showed the lowest similarities (42–78%) between Trichuris of the present study and previously identified rDNA ITS2 sequences of Trichuris spp. (HQ844233, JF690952) Trichuris leporis (AJ251321) Trichuris ovis (JF680987, AY439019, AJ238220), Trichuris suis (MG656444, MG656441), Trichuris trichiura (KJ588165, KJ588167) and Trichuris colobae (FM991956) (Table 1, Fig 2). The full sequence analysis of 388 bp of the rDNA ITS-2 locus revealed four intraspecific variations (P66, P74, P114, P178) in the 11 Trichuris sequences generated by the present study and Trichuris skrjabini (AJ489248, KT630825), Trichuris spp. (KJ507245) indicate genetically linked to the rDNA ITS2 sequence.
11 Three unique sequence variants of Trichuris were aligned with 14 NCBI GeneBank sequences of different Trichuris species. The sequences of each species were identified with the name and color circles. The adjacent table indicates the accession number, host, and country of origin.
This analysis involved 25 nucleotide sequences. The percentage of base substitutions per site between sequences is shown. The analyses were conducted using the Maximum Composite Likelihood model. All positions containing gaps and missing data were eliminated. There was a total of 318 nucleotide positions in the final dataset.
Eleven Trichuris sequences were further grouped into three unique sequence variants (Trichuris-PAK1, Trichuris-PAK2, Trichuris-PAK3) and aligned with 14 NCBI GeneBank sequences of different Trichuris species. The phylogenetic tree was generated intwo separate clades. In clade 1, three unique sequence variants from Pakistan revealed a close link with Trichuris skrjabini (AJ489248, KT630825) and Trichuris spp. (KJ507245, HQ844233) within subclade-i (Fig 2). The other two subclades (ii and iii) include Trichuris spp. (JF690952), T. leporis (AJ251321) and T. ovis (JF680987, AY439019, AJ238220) species. Similarly, the phylogenetic comparison showed that T. suis, T. colobae, and T. trichuris form two distinct subclades (iv and v) within clade 2 (Fig 2).
Discussion
It is assumed that T. ovis were the predominant species in the Punjab province of Pakistan [14–19]. However, all these reports were based on egg and or adult morphology without genetic confirmation of species identity. In the present study, adult Trichuris infecting goats were characterised by the adult morphology at the genus level and the sequences of rDNA ITS-2 region, providing the first documented report of T. skrjabini in the Rawalpindi division of the Punjab province.
First, we have performed the morphological characteristics of Trichuris genus infecting goats. The male of the genus Trichuris displayed a similar morphological pattern in the reproductive system. Additionally, the characteristic of the spicule sheath, spicular length, and the fact that the spicule sheath covers a short spicule was identified in male [34]. The presence of vagina with a noneverted vulva allows for distinguishing between the females [35]. Trichuris skrjabini morphological characters were compared with T. ovis [Baylis (1932), Ortlepp (1937) and Sarwar (1937)]. Morphological characters used for the routine separation of T. ovis from T. skrjabin without the necessity for measurement in the male are the size, shape and degree of eversion of the spicule, and in the female, the type of vulval expansion, nature of the vagina and straight portion of the ovary [36–38]. However, the length and breadth of egg range overlap between the two species. All the measurements of T. skrjabini recorded in the present study are within the range described by Baskakov [39], Magomedbekov [40], Knight [36] and Hinks and Thomas [38]. The speciation of the Trichuris genus is challenging because of the Trichuris phenotypic plasticity, lack of morphological features, and the substantial overlap in morphometric traits among species [41].
Therefore, 11 Trichuris rDNA ITS-2 sequences from the present study and 14 Trichuris sequences from NCBI GenBank were examined. The comparison between Trichuris of the present study yielded 99–100% similarity to a previously identified rDNA ITS2 sequence of Trichuris skrjabini (KT630825, AJ489248) isolated from the sheep in Czech Republic and goats in Spain and Trichuris spp. (KJ507245) isolated from the black goat in China. Similarly, phylogenetic analysis indicates that Trichuris from Pakistan revealed a strong genetic link between T. skrjabini descended from sheep in Czech Republic and goats in Spain and Trichuris spp. descended from goats in China. We have identified four intraspecific single nucleotide polymorphisms (SNPs) between sequences of the Trichuris generated by the present study and Trichuris skrjabini (AJ489248, KT630825), Trichuris spp. (KJ507245).
Conclusions
In conclusion, the molecular confirmation and the phylogenetic analysis of the intestinal nematode of goats confirm, for the first time, the presence of Trichuris skrjabini in the Rawalpindi division of Punjab. Furthermore, Trichuris skrjabini was the only nematode identified in 11 worms from goats. The results of our study have implications for the diagnosis and control of Trichuris in the region and the need for accurate species identification to understand parasite distribution and population genetics. There is a need to identify new genetic markers for molecular analysis of a wide range of Trichuris isolates from different host species and geographical areas to improve our understanding of parasite population genetic structures and transmission dynamics.
Supporting information
S1 Fig. Agarose gel electrophoresis (1%) of PCR product band of 500 bp of Trichuris the ITS-2 region.
https://doi.org/10.1371/journal.pone.0290906.s001
(PNG)
S2 Fig. Sequences alignment trimmed to 388 bp.
https://doi.org/10.1371/journal.pone.0290906.s002
(JPG)
Acknowledgments
We would like to thank workers at abbatoirs for their help during the sampling period.
References
- 1.
Anderson RC. Nematode parasites of vertebrates: their development and transmission. 2nd ed. CAB International ed. Wallingford Oxon UK, 2000; pp 650.
- 2. Knight RA. Trichuris oreamnos sp. n. from the mountain goat, Oreamnos americanus (Blainville), in British Columbia, Canada, and a key to trichurids in North American ruminants. J Parasitol Res. 1974; 275–279. https://doi.org/10.2307/3278464.
- 3. Callejón R, Halajian A, De Rojas M, Marrugal A, Guevara D and Cutillas C. 16S partial gene mitochondrial DNA and internal transcribed spacers ribosomal DNA as differential markers of Trichuris discolor populations. Vet Parasitol. 2012; 186(3–4): 350–363. https://doi.org/10.1016/j.vetpar.2011.11.033.
- 4. Nechybova S, Vejl P, Hart V, Melounova M, Cilova D, Vasek J, et al. Long-Term Occurrence of Trichuris Species in Wild Ruminants in the Czech Republic. Parasitol Res. 2018; 117: 1699–1708. pmid:29721657
- 5. Babero BB, Murua RB. A new species of whipworm from a South American hystricomorph rodent. Mem Inst Oswaldo Cruz. 1990; 85:211–213. https://doi.org/10.1590/S0074-02761990000200012.
- 6. Suriano DM, and Navone GT. Three new species of the genus Trichuris Roederer, 1761 (Nematoda: Trichuridae) from cricetidae and octodontidae rodents in Argentina. Res Rev Parasitol. 1994; 54: 39–46.
- 7. Oliveros R, Cutillas C, De Rojas M, and Arias P. Characterization of four species of Trichuris (Nematoda: Enoplida) by their second internal transcribed spacer ribosomal DNA sequence. Parasitology Res. 2000; 86(12), 1008–1013. https://doi.org/10.1007/PL00008519.
- 8. Callejón R, Gutiérrez-Avilés L, Halajian A, Zurita A, de Rojas M and Cutillas C. Taxonomy and phylogeny of Trichuris globulosa Von Linstow, 1901 from camels. A review of Trichuris species parasitizing herbivorous. Infect Genet Evol. 2015; 3461–74. https://doi.org/10.1016/j.meegid.2015.06.011.
- 9. Callejón R, Halajian A and Cutillas C. Description of a new species, Trichuris ursinus n. sp.(Nematoda: Trichuridae) from Papio ursinus Keer, 1792 from South Africa. Infect Genet Evol. 2017; 51: 182–193. https://doi.org/10.1016/j.meegid.2017.04.002 pmid:2
- 10. Zhu XQ, Jacobs DE, Chilton NB, Sani RA, Cheng N, Gasser RB. Molecular characterization of a Toxocara variant from cats in Kuala Lumpur, Malaysia. Parasitol. 1998; 117(2): 155–164. pmid:9778638
- 11. Ravasi DF O’Riain MJ, Davids F and Illing N. "Phylogenetic evidence that two distinct Trichuris genotypes infect both humans and non-human primates. 2012; e44187. https://doi.org/10.1371/journal.pone.0044187.
- 12. Salaba O, Rylková K, Vadlejch J, Petrtýl M, Scháňková S, Brožová A, et al. The first determination of Trichuris sp. from roe deer by amplification and sequenation of the ITS1-5.8S-ITS2 segment of ribosomal DNA. Parasitol Res. 2013; 112(3): 955–960. https://doi.org/10.1007/s00436-012-3215-0.
- 13. Betson M, Søe MJ, Nejsum P. Human trichuriasis: whipworm genetics, phylogeny, transmission and future research directions. Curr Trop Med. 2015; 2: 209–217. https://doi.org/10.1007/s40475-015-0062-y.
- 14. Razzaq A. Prevalence of internal parasites in sheep/goats and effective economic de-worming plan at upland Balochistan, Pakistan. Afr J Biotechnol. 2012; 11(62): 12600–12605. https://doi.org/10.5897/AJB10.1303.
- 15. Gul-e-lala KA and Khatoon N. Histopathologic findings in large intestine of goat (capra hircus) infected with Trichuris sp. in Karachi, Pakistan. Pakistan J. Parasitol. 2021; 71: 9–12.
- 16. Raza MA, Younas M, Schlecht E. Prevalence of gastrointestinal helminths in pastoral sheep and goat flocks in the cholistan desert of Pakistan. Journal of Animal and Plant Sciences, 2014; 24(1): 127–134.: https://www.researchgate.net/publication/260197935.
- 17. Razzaq A, Ashraf K, Maqbool A, Khan MA, Islam M, Khan H. Epidemiology, serodiagnosis and therapeutic studies on ovine nematodes at district Loralai, Balochistan, Pakistan. J Anim Plant Sci. 2013; 23(6): 1559–1565.
- 18. Khan W, Al-Jabr OA, Khan T, Khan A, El-Ghareeb WR, Aguilar-Marcelino L, et al. Prevalence of gastrointestinal parasite in small ruminants of District Dir Upper Khyber Pakhtunkhwa Province of Pakistan. Braz J. Biol. 2021; 83:1–5. pmid:34669799
- 19. Ullah N, Sayed Khan M, Shah M. (2013) Infestation of helminthes parasite in sheep, Ovis aries (L.) in district Peshawar, Pakistan. International Journal of Biosciences (IJB), 2013; 3(2): 28–34.
- 20. Mohd-Shaharuddin N, Lim YA, Hassan NA, Nathan S, Ngui R. Molecular characterization of Trichuris species isolated from humans, dogs and cats in a rural community in Peninsular Malaysia. Acta tropica. 2019; 190:269–72. https://doi.org/10.1016/j.actatropica.2018.11.026.
- 21. Padial JM, Miralles A, De la Riva I, Vences M. The integrative future of taxonomy. Front Zoo. 2010;7(1):1–4. pmid:20500846
- 22. Adams DC, Chelsea M, Kozak KH, Wiens JJ. Are rates of species diversification correlated with rates of morphological evolution?. Proc R Soc Lond. 2009; 276: 2729–2738. pmid:19439441
- 23. Bickford D, Lohman DJ, Navjot SS, Ng PKL, Meier R, Winker K, et al. Cryptic species as a window on diversity and conservation. Trends Ecol Evol. 2007; 22: 148–155. pmid:17129636
- 24.
Daniel W, Cross L. Biostatistics: A Foundation for Analysis in the Health Sciences. Wiley 11th Edition; 1999.
- 25.
Soulsby EJL. Helminths, Arthropods and Protozoa of Domesticated Animals. 7. Ed. London: Bailliere Tindall; 1986; pp. 212–342.
- 26. Essa IM and Azzal GY. First Record of Nematode Trichuris spp. from sheep in Basrah City, Southen Iraq. Eur J Mol Clin Med. 2021; 8(02): 2021.
- 27. Cutillas C, Callejon R, De Rojas M, Tewes B, Ubeda JM, Ariza C et al. Trichuris suis and Trichuris trichiura are different nematode species. Acta Trop. 2009; 111(3): 299–307. https://doi.org/10.1016/j.actatropica.2009.05.011.
- 28. Costa-Junior LM, Chaudhry UN, Silva CR, Sousa DM, Silva NC, Cutrim-Júnior JA, et al. Nemabiome metabarcoding reveals differences between gastrointestinal nematode species infecting co-grazed sheep and goats. Vet Parasitol. 2021; 289: 109339. pmid:33359968
- 29. Nissen S, Al-Jubury A, Hansen TV, Olsen A, Christensen H, Thamsborg SM, et al. Genetic analysis of Trichuris suis and Trichuris trichiura recovered from humans and pigs in a sympatric setting in Uganda. Vet Parasitol. 2012; 188:68–77.
- 30. Gasser RB, Monti JR, Zhu X, Chilton NB, Hung GC, Guldberg P. Polymerase chain reaction-linked single-strand conformation polymorphism of ribosomal DNA to fingerprint parasites. Electrophoresis 1997; 18:1564–1566. pmid:9378122
- 31.
Drummond AJ, AB Buxton S, Cheung M, Cooper A, Duran C, Field M, et al 2012. Geneious v5.6.
- 32. Huang Y, Niu B, Gao Y, Fu L, Li W. CD-HIT Suite: a web server for clustering and comparing biological sequences. Bioinformatics. 2010; 26(5):680–2. pmid:20053844
- 33. Kimura M. (1980). A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution. 1980; 16:111–120. https://doi.org/10.1007/BF01731581.
- 34. Cutillas C, German P, Arias P and Guevara D. Characterization of Trichuris skrjabini by isoenzyme gel electrophoresis: comparative study with Trichuris ovis. Acta Trop. 1996; 62(2): 63–69. https://doi.org/10.1016/S0001-706X(96)00019-8.
- 35. Vejl P, Nechybová S, Peřinková P, Melounová M, Sedláková V, Vašek J, Čílová D, Rylková K, Jankovská I, Vadlejch J, Langrová I. Reliable molecular differentiation of Trichuris ovis and Trichuris discolor from sheep (Ovis orientalis aries) and roe deer (Capreolus capreolus) and morphological characterization of their females: morphology does not work sufficiently. Parasitol Res. 2017; 116(8): 2199–2210. https://doi.org/10.1007/s00436-017-5524-9.
- 36. Knight R. A. (1971). Rcdescriptions of Trichuris discolor and Trichuris skrjabini from domestic ruminants in the United States and comparisons with Triduiris ovis. Journal of Parasitology, 57, 302–310.
- 37. Knight R. A. (1972). New geographic distribution records of Trichuris skrjabini in sheep in the United States and measurements of various morphological characters. Helminthol Soc Wash Proc.
- 38. inks M.I. and Thomas R.J., 1974. A new record of the occurrence of Trichuris skrjabini Baskakov, 1924 in sheep in Britain. Journal of helminthology, 48(1), pp.33–38.
- 39. Baskakov V. P. (1924). The fauna of parasitic worms in Turkestan camels. Trudy Gosudarstv. Inst.Eksper. Vet., 2, 92–105.
- 40. Magomedbekov U. A. 1957. Trichocephalus skriabini. In Skrjabin K. I., Skikhobalova N. P., and Orlov I. V. Osnovy Nematodologii, v. 6. Trikhotsefalidy I kapilliariidy zhivotnykh i cheloveka i vyzy-vaemye imi zabolevaniia. Mockva, p. 103–106.
- 41. Robles MdR. New species of Trichuris (Nematoda: Trichuridae) from Akodon montensis Thomas, 1913 of the Paranaense forest in Argentina. J Parasitol. 2011; 97: 319–327. pmid:21506781