https://orcid.org/0000-0001-8197-3338
Figures
Abstract
The Okinawa rail is endemic to Okinawa Island and is categorized as an endangered animal. In this study, we focused on innate immunity because it is the first line of host defense. In particular, signals recognizing foreign RNA (e.g., viruses) are important for host defense because they activate the host immune system. The retinoic acid-inducible gene I (RIG-I)-like receptor (RLR) families (RIG-I, MDA5, and LGP2) are sensors that activate innate immunity. Therefore, we analyzed these functions in the Okinawa rail using genomic and cellular analyses of fibroblasts. Fibroblasts can be obtained from dead individuals, allowing these cells to be obtained from dead individuals, which is particularly useful for endangered species. The MDA5 gene of Okinawa rail was sequenced using the Sanger method following PCR amplification and extraction of the amplified sequence from agarose gel. Additionally, mRNA expression analysis of cultured fibroblasts exposed to poly I:C was done. The MDA5 gene was found to be a mutated nonfunctional gene in the Okinawa rail. The mRNA expression rates of inflammatory cytokine genes type I IFN, and Mx1 were slower in Okinawa rail than in chicken cultured fibroblasts. Similar to the mRNA expression results, cell number and live cell ratio also slowly decreased in the Okinawa rail compared with chicken cultured fibroblasts, indicating that the innate immune reaction differs between chicken and the Okinawa rail. To the best of our knowledge, this is the first experimental evaluation of the loss of function of the Okinawa rail innate immune genes. In conclusion, our results provide a basis for conservation strategies for the endangered Okinawa rail.
Citation: Katayama M, Fukuda T, Kato N, Nagamine T, Nakaya Y, Nakajima N, et al. (2023) Cultured fibroblasts of the Okinawa rail present delayed innate immune response compared to that of chicken. PLoS ONE 18(8): e0290436. https://doi.org/10.1371/journal.pone.0290436
Editor: Sebastian D. Fugmann, Chang Gung University, TAIWAN
Received: September 13, 2022; Accepted: August 8, 2023; Published: August 22, 2023
Copyright: © 2023 Katayama et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the paper and its Supporting Information files.
Funding: The authors received no specific funding for this work.
Competing interests: The authors have declared that no competing interests exist.
Introduction
The Okinawa rail (Hypotaenidia okinawae) is endemic to northern Okinawa Island [1]. The Okinawa rail is categorized as endangered (EN) in the IUCN Red List because its individual numbers are estimated to be approximately 1500 [2]. The Ministry of Environment of Japan lists traffic accidents, habitat destruction, and negative influences by introduced species as risk factors for the reduction in the number of Okinawa rails. Therefore, the Ministry of Environment of Japan and non-profit organizations (NPO) are trying to reduce the risk of extinction and conserve the Okinawa rail. In addition to these risks, infectious diseases also need to be considered as risk factors that would dramatically reduce the number of Okinawa rails, considering that more than 400,000 non-poultry birds, such as wild birds, have died of infectious avian influenza virus between 2021 and 2022 worldwide [3]. Information on the risk of infectious disease in Okinawa rails would benefit their conservation, but this information is quite limited owing to their endangered status.
The innate immune system plays a critical role in host defense in vertebrates, including avians [4]. Members of the retinoic acid-inducible gene I (RIG-I)-like receptor (RLR) families (RIG-I, MDA5, and LGP2) are present in the cytoplasm, and RIG-I and MDA5 are important sensors for recognizing virus [5–8]. The innate and adaptive immune systems are activated by RLR-derived signals; therefore, their recognition function plays a critical role in host defense in avians [4]. In avians, species differences are found in recognition systems of RLR families [4,9,10]. For example, the recognition system of RLR families is different between chickens and ducks: chickens lack the RIG-I gene, whereas ducks have this gene [4,9,11]. An immune cell would be the first choice to analyze the RLR function, but the barrier of sampling is high because we basically obtained it from live individuals. In contrast to immune cells, fibroblasts can be obtained from dead individuals, and therefore endangered species-derived fibroblasts can be obtained without sacrificing individuals. RLR genes are expressed in mammals and avian fibroblasts; therefore, many studies have been conducted using fibroblasts to analyze the function of RLR family genes [7,9]. In chickens, duck RIG-I-transfected chicken cells (DF-1) can recognize the RIG-I ligand and induce the expression of antiviral genes, including chicken IFN-β and MX1, whereas HPAIV titers are significantly reduced [9,12]. This could contribute to the higher resistance of ducks to HPAIV infections. Recently, Lee et al. reported using targeted knockout of chMDA5 in chicken DF-1 cells in which the loss of chMDA5 impaired innate immune responses against RNA ligands [13]. Therefore, MDA5 is a major sensor for the activation of innate immune responses in chickens. Based on these results, cultured fibroblasts could be useful for analyzing the function of the innate immune system. Thus, we predicted that the host defense response of the Okinawa rail could be evaluated by analyzing the cellular response to the stimulation of RLR family genes in cultured cells.
Here, we compared the RLR function of the Okinawa rail with that of chicken to evaluate the host defense response of the Okinawa rail through the innate immune response in cultured fibroblasts. We accessed the publicly available draft genome sequence of the Okinawa rail to obtain its genomic information. Subsequently, the MDA5 gene was obtained using the Sanger method after PCR amplification and extraction of the amplified sequence from agarose gel. We further exposed cultured fibroblasts to poly I:C for stimulation of the host RLR [5,9,14,15]. After poly I:C exposure, we analyzed the mRNA expression (of the RLR family and downstream genes), cell growth, live cell ratio, and apoptotic cell ratio in Okinawa rail cells.
Materials and methods
Animal cells
Chicken fibroblasts were obtained from muscle tissue in a previous study [16]. These fibroblasts were preserved in a liquid nitrogen tank until use. Embryonic muscle-derived fibroblasts were obtained from a domestic duck purchased from a farm (Amatake-Tanohatamura Co., Inc. Tanohata village, Iwate, Japan). Fibroblast cells from the Okinawa rail and whooper swans were obtained from dead animals, such as those killed by vehicles; thus, approval was not required to obtain these samples.
The details described below exclude the exact sampling locations to protect the animals against poaching. All records are available at the National Institute for Environmental Science (NIES).
A dead Okinawa rail was found on May 27, 2005, by the Okinawa Wildlife Federation, a non-profit organization that focuses on the conservation of wild animals in the Okinawa area of the southwest region of Japan. The organization has permission from the Japanese Ministry of the Environment (MOE) to handle and perform first-aid activities on endangered animals. Dead birds were transferred to the National Institute for Environmental Studies (NIES) the following day, and cultured fibroblasts were obtained from their muscle tissue and skin (NIES ID:74A). In this study, skin-derived fibroblasts were used.
Dead whooper swans were found by residents on March 10, 2018, in Morioka City, Iwate Prefecture. They were collected by the staff of Iwate Prefecture and transferred the following day to the NIES. Cultured fibroblasts were obtained from muscle tissue and skin of dead birds (NIES ID:5137A). Skin-derived fibroblasts were used.
Cell culture
We used KAv-1 medium to obtain and culture chicken, Okinawa rail, domestic duck, and whooper swan fibroblasts. KAv‐1 is based on α‐MEM and contains 5% FBS (SH30396.03; Cytiva, Marlborough, MA, USA), 5% chicken serum (16110082; Thermo Fisher, Waltham, MA, USA), 0.1% D-glucose (041–00595; FUJIFILM Wako Pure Chemical Industries, Osaka, Japan), 0.4 mM calcium chloride, 10 mM EPPS (348–03192; FUJIFILM Wako Pure Chemical Industries), 0.11% sodium carbonate (199–01585; FUJIFILM Wako Pure Chemical Industries), 55 μM 2-mercaptoethanol (21985–023; Thermo Fisher, Waltham, MA, USA), and 1% penicillin-streptomycin-amphotericin B suspension (×100) (Antibiotic-Antimycotic Solution) (161–23181; FUJIFILM Wako Pure Chemical Industries). Cells were cultured at 37°C in 5% CO2.
Staining of F-actin
Chicken muscle-derived, Okinawa rail muscle-derived, and chicken embryonic fibroblasts were seeded in 12-well cell culture plates for immunological staining. After 48 h of incubation, F-actin staining was performed using Alexa Fluor 568 phalloidin (A12380; Thermo Fisher Scientific) according to the manufacturer’s protocol. The samples were counterstained with Cellstain-DAPI solution (DOJINDO). Chicken embryonic fibroblasts were obtained from a primary culture of chicken embryonic tissue provided by Prof. Atsushi Tajima, Tsukuba University.
Exposure to poly I:C
After preculture for 48 h, fibroblasts were exposed to 5 μg/mL or 50 μg/mL of poly I:C (polyinosinic-polycytidylic acid sodium salt) (4287/10; R&D Systems, Minneapolis, MN, USA). Poly I:C is a mixture of long and short reagents. During preculture and poly I:C exposure, the cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM; 043–30085; FUJIFILM Wako Pure Chemical Industries) containing 10% FBS (SH30396.03; Cytiva) and 1% penicillin-streptomycin-amphotericin B suspension (×100) (Antibiotic-Antimycotic Solution) (161–23181; FUJIFILM Wako Pure Chemical Industries). Cells were cultured at 37°C in 5% CO2.
RNA extraction and quantitative real-time polymerase chain reaction (PCR)
Total RNA was extracted from the cultured cells using NucleoSpin® RNA (740955.50; MACHEREY-NAGEL, Düren, Germany). After measuring the concentration of total RNA from cultured cells, we synthesized complementary DNA (cDNA) from the total RNA. cDNA was synthesized using the PrimeScript™ RT Reagent Kit with gDNA Eraser (Perfect Real Time) (RR047A; Takara Bio, Shiga, Japan). Quantitative real-time PCR was performed in 12.5 μL reaction mixture containing 2×KOD SYBR® qPCR Mix (QKD-201; TOYOBO, Osaka, Japan), 12.5 ng of cDNA, 0.5 μL of Rox, 0.3 μM of each primer, and DW (added up to 12.5 μL), using the Applied Biosystems 7300 system (Thermo Fisher Scientific). The primer sequences are shown in S1–S4 Tables. The cycling conditions were 98°C for 2 min (initial denature), 98°C for 10 s (denature), 58°C for 10 s (annealing), and 68°C for 32 s (extension at) for 45 cycles. The expression levels of the target genes were normalized with those of GAPDH.
We searched the sequence information of chicken, swan, and domestic duck from the NCBI database (https://www.ncbi.nlm.nih.gov/gene/?term=) and used Oligo7 (Molecular Biology Insight, Vondelpark Colorado Springs, CO, USA) to design the primers for real-time PCR. We confirmed that the designed primers did not amplify non-target sequences with primer blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). During this search, we used the Refseq mRNA as a database, and selected chicken (taxid:9031), domestic duck (taxid:8839), or black swan (taxid:8868) as an organism. Below 400bp amplificated non-target sequence did not find. We consider that our designed primers specifically amplified the target sequence with real-time PCR because the maximum size of the PCR product is around 150 bp.
In addition to chicken, swan, and domestic duck primers, we designed the primers for real-time PCR of Okinawa rail targets. To design the primers for Okinawa rail, we tried to obtain the RIG-I, MDA5, LGP2, IL6, IL1beta, IFN-beta, Mx1, TLR3, and GAPDH sequences. To obtain those Okinawa rail sequences, we searched the Okinawa rail draft sequence (Gallirallus_okinawae_ver1.0 GenBank assembly [GCA_002003005.1] (https://www.ncbi.nlm.nih.gov/assembly/GCA_002003005.1)) using blastn (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&PROG_DEF=blastn&BLAST_SPEC=Assembly&UID=19747853). We used the chicken mRNA sequence as a query, except for RIG-I because there is no chicken ortholog. Therefore, we used the duck RIG-I sequence as the query and designed the primers for the Okinawa rail sequences using Oligo7 (Molecular Biology Insight). We confirmed that the designed primers did not amplify non-target sequences using primer blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). However, we could not select the Okinawa rail mRNA and therefore used the Okinawa rail genome database (genomic/547194/GCA_002003005.1). No amplified product without the target sequence was observed below 400 bp. Therefore, our designed primers specifically amplified the target sequence with real-time PCR.
Sequencing of amplified MDA5 products from chicken and Okinawa rail
The amplified MDA5 products from chicken and Okinawa rail were sequenced after real-time PCR. First, we collected the chicken and Okinawa rail total RNA after exposure to 0 μg/mL or 50 μg/mL of poly I:C for 24 h using an RNA extraction kit (NucleoSpin® RNA). Next, we synthesized cDNA using the PrimeScript™ RT Reagent Kit with gDNA Eraser (Perfect Real Time) (RR047A; Takara Bio, Shiga, Japan). For cDNA synthesis, we prepared the reverse transcriptase plus (RT (+)) and reverse transcriptase minus (RT (-)). To amplify the cDNA, we used the KOD SYBR® qPCR Mix; the detailed protocol is described in the above section. After amplification, we performed electrophoresis of the amplified MDA5 products from chicken and Okinawa rail in a 2% agarose gel. After staining with GelGreen (41005; Biotium, Inc., Fremont, CA), the amplified products of 132 bp (chicken) and 82 bp (Okinawa rail) were extracted because these were the predicted MDA5 targets. The amplified sequences were extracted with NucleoSpin® Gel and PCR Clean-up (740609.50; MACHERY-NAGEL). After those extractions, we stained extracted sequence using BigDye™ Terminator v3.1 Cycle Sequencing Kit (4337457; ThermoFisher) with forward or reverse primers of MDA5. After staining, the samples were sequenced using the Sanger method. We compared the sequences obtained with chicken and Okinawa rail MDA5 sequences using t-coffee (https://tcoffee.crg.eu).
Quantitative real-time PCR with fluorescence probe
We designed the primers and probe to analyze the MDA5 gene expression of chicken and Okinawa rail cultured fibroblasts. To design the primers and probe, we used the common sequence between the chicken and Okinawa rail MDA5. We also designed the primers and probe for GAPDH. Designed primers and probe information are shown in S5 Table. cDNA was synthesized with the PrimeScript™ RT Reagent Kit with gDNA Eraser (Perfect Real Time). Quantitative real-time PCR was performed using 1× THUNDERBIRD Probe qPCR Mix (QPS-101; TOYOBO), 0.3 μM of each primer, 0.2 μM of probe, and 1× Rox. Fifty cycle of 95°C for 60 s (initial denaturation), 95°C for 15 s (denaturation), and 50°C (MDA5) or 55 °C (GAPDH) 60 s (annealing and extension) were used. The expression levels of the target genes were normalized to those of GAPDH.
Direct sequencing of Okinawa rail MDA5 using the Sanger method
First, we collected the Okinawa rail total RNA after exposure to 50 μg/mL of poly I:C for 24 h using an RNA extraction kit (NucleoSpin® RNA). Next, we synthesized cDNA using the PrimeScript™ RT Reagent Kit with gDNA Eraser (Perfect Real Time) (RR047A; Takara Bio, Shiga, Japan). We designed the primers using the candidate sequence of Okinawa rail MDA5 genes from the draft genome (S3 Fig) to amplify the MDA5 gene. Designed-primer information is shown in S6 Table. To amplify the Okinawa rail cDNA of MDA5, we used the PrimeSTAR® Max DNA Polymerase (R045A; Takara Bio, Shiga, Japan) or KOD FX Neo (KFX-201; TOYOBO, Osaka, Japan). While using the PrimeSTAR, the first shot PCR was performed in 0.5-μL template cDNA, 12.5-μL reaction mixture containing 2×PrimeSTAR Max Premix, 0.3-μM of each primer, and DW (added up to 25 μL). The cycling conditions were 94°C for 2 min (initial denaturation), 98°C for 10 s (denaturation), 56°C for 10 s (annealing), and 72°C for 60 s (extension) for 45 cycles. Next, the nested PCR was performed in 5 μL of diluted first shot PCR product (which was 1 μL PCR product diluted with 49 μL DW), 12.5 μL of reaction mixture containing 2×PrimeSTAR Max Premix, 0.3 μM of each primer, and DW (added to make up the volume to 25 μL). The cycling conditions were 94°C for 2 min (initial denature), 98°C for 10 s (denature), 56°C for 10 s (annealing), and 72°C for 60 s (extension) for 45 cycles. While using the KOD FX Neo, the first shot PCR was performed in 4-μL template cDNA, 12.5-μL reaction mixture containing 2×PCR buffer for KOD FX Neo, 0.3-μM of each primer, 0.4-mM dNTPs, and DW (added up to 25 μL). The cycling conditions were 94°C for 2 min (initial denaturation), 98°C for 10 s (denaturation), 51°C for 30 s (annealing), and 68°C for 75 s (extension) for 50 cycles. Next, the nested PCR was performed in 5 μL of diluted first shot PCR product (which was 1 μL PCR product diluted with 49 μL DW), 12.5 μL of reaction mixture containing 2×PCR buffer for KOD FX Neo, 0.3 μM of each primer, 0.4 mM of dNTPs, and DW (added up to make up the volume to 25 μL). The cycling conditions were 94°C for 2 min (initial denature), 98°C for 10 s (denature), 56°C for 30 s (annealing), and 68°C for 60 s (extension) for 45 cycles.
We performed electrophoresis of the amplified MDA5 products from Okinawa rail in a 2-% agarose gel. After staining with GelGreen (41005; Biotium, Inc., Fremont, CA), the amplified products were extracted. The amplified sequences were extracted with NucleoSpin® Gel and PCR Clean-up (740609.50; MACHERY-NAGEL). Thereafter, we stained the extracted sequence using BigDye™ Terminator v3.1 Cycle Sequencing Kit (4337457; ThermoFisher) with forward or reverse primers of MDA5. After staining, the samples were sequenced using the Sanger method. We compared the sequences obtained with chicken and Okinawa rail MDA5 sequences using Blast (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and t-coffee (https://tcoffee.crg.eu).
Analysis of apoptosis
The chicken and Okinawa rail cells were trypsinized and collected after 48 h of poly I:C exposure. The collected cells were suspended and stained using the Muse® Annexin V & Dead Cell Kit (MCH100105; Luminex Corporation, Austin, Texas, USA). The stained cells were analyzed using a Muse Cell Analyzer (0500–3115, Luminex Corporation, Austin, Texas, USA).
Genomic information
To obtain target Okinawa rail genes (such as RIG-I and LGP2), we searched the Okinawa rail draft sequence (Gallirallus_okinawae_ver1.0 GenBank assembly [GCA_002003005.1] (https://www.ncbi.nlm.nih.gov/assembly/GCA_002003005.1)) using blastn (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&PROG_DEF=blastn&BLAST_SPEC=Assembly&UID=19747853). We used the chicken mRNA sequence as query, except for RIG-I, because the RIG-I ortholog is absent in chicken. Therefore, we used the duck RIG-I sequence as query.
Statistical analysis
First, we tested the normality of our dataset using the chi-square test for goodness of fit. Some data did not show a normal distribution (S7 Table). Therefore, we employed a unified non-parametric analysis for this study as it is not contingent on normal distribution of the data. To compare the three groups, we used the steal-Dwass test, which is a non-parametric version of the Tukey-Kramer test (Figs 3A, 3B, 5C, 7A, 7B, 10A and 10B). As shown in Fig 9C and 9D, the Mann–Whitney U test is used to compare the two groups, which is also a non-parametric analysis. Significant statistical differences are indicated by *(P<0.05). We used the statistical analysis software Statcel3 to perform the analyses (Statcel-the Useful Addin Forms on Excel-3rd ed., OMS Publishing, Higashi-Kurume, Tokyo, Japan).
Results
Sequence alignment of the RLR family genes (RIG-I, MDA5, and LGP2) between Okinawa rail and chicken or duck
The RLR family recognizes viruses such as influenza. Therefore, we explored the RLR family genes (RIG-I, MDA5, and LGP2) from the draft genome of the Okinawa rail. Our research group has completed the sequencing of the entire genome of the Okinawa rail, and this information has been made available to the public at the DNA databank of Japan (DDBJ), however, gene annotation has not yet been conducted (https://www.ncbi.nlm.nih.gov/genome/?term=okinawa+rail). In this study, we performed a BLAST search for the RLR family mRNA using chicken LGP2, chicken MDA5, and duck RIG-I. We obtained almost full-length sequences of Okinawa rail RIG-I and LGP2 (Fig 1A and 1B), however, hit sequences of the Okinawa rail MDA5 were partial-length sequences (Fig 1C and 1D). Next, we searched for three sequences (TGA, TAA, and TAG) in the candidate sequence of Okinawa rail MDA5, as these sequences could act as stop codons. In the candidate sequence of Okinawa rail MDA5, a large number of the three sequences (TGA, TAA, and TAG) were present (TGA: 51, TAA: 33, and TAG: 12) (Fig 2A and 2B). We hypothesized that MDA5 might be a mutated nonfunctional gene in the Okinawa rail.
a: Graphical summary of hit sequences of duck RIG-I in the Okinawa rail draft genome sequence. b: Graphical summary of hit sequences of chicken LGP2 in the Okinawa rail draft genome sequence. c: Graphical summary of hit sequences of chicken MDA5 in the Okinawa rail draft genome sequence. d: Amino acid structure of chicken MDA5 and mapping of hit sequences of chicken MDA5 in Okinawa rail draft genome sequence to chicken MDA5 coding sequence.
a: Blastn results. The query is chicken MDA5. The subject is the Okinawa rail draft genome sequence. b: TGA, TAA, and TAG sequences in the candidate Okinawa rail MDA5 sequence.
Changes in the RLR family (RIG-I, MDA5, and LGP2) gene expression induced by poly I:C exposure in cultured chicken, Okinawa rail, domestic duck, and whooper swan fibroblasts
As shown in Figs 1 and 2, Okinawa rail MDA5 might be a mutated nonfunctional gene based on the sequence information. To test this hypothesis, we determined the chicken and Okinawa rail RLR family (RIG-I, MDA5, and LGP2) gene expression levels in cultured fibroblasts after stimulation of RLRs. We used chicken muscle-derived and Okinawa rail skin-derived fibroblasts. We first confirmed that the cytoskeleton was similar between chicken muscle-derived and Okinawa rail skin-derived fibroblasts (S1 Fig). Therefore, we considered that the chicken and Okinawa rail cultured fibroblasts had similar characteristics. In chickens, the RIG-I gene is not present; therefore, we performed quantitative PCR of RIG-I in Okinawa rail [4,9,11]. We analyzed the mRNA expression of the chicken and Okinawa rail RLR family genes after exposure to 5 μg/mL and 50 μg/mL poly I:C for 24 h. In chicken, MDA5 and LGP2 mRNA levels were significantly increased with exposure to 5 μg/mL and 50 μg/mL poly I:C compared with 0 μg/mL poly I:C (Fig 3A). In Okinawa rail, RIG-I and LGP2 mRNA levels significantly increased with exposure to 5 μg/mL and 50 μg/mL poly I:C, whereas MDA5 mRNA expression was not influenced by exposure to poly I:C (Fig 3B). These results indicate that there are species differences in the response of MDA5 between chicken and Okinawa rail. Particularly, Okinawa rail MDA5 expression did not increase with stimulation with poly I:C; therefore, this gene lost its function in Okinawa rail during its evolution. This result is consistent with our hypothesis.
a: Expression of MDA5 and LGP2 after exposure to 5 μg/mL and 50 μg/mL poly I:C in chicken cultured fibroblasts. Centerlines of box plots indicate medians; box limits indicate 25th and 75th percentiles. Target gene expression was quantified relative to the GAPDH internal control. The expression level of the control (poly I:C minus) was 1.0. n = 6. *shows p < 0.05. b: Expression of RIG-I, MDA5, and LGP2 after exposure to 5 μg/mL and 50 μg/mL poly I:C in Okinawa rail culture cells. Centerlines of box plots indicate medians; box limits indicate 25th and 75th percentiles. Target gene expression was quantified relative to the GAPDH internal control. The expression level of the control (poly I:C minus) was 1.0. n = 6. *shows p < 0.05. c: Time-course analysis of RLR family gene expression after poly I:C exposure in chicken and Okinawa rail cultured fibroblasts. d: Time-course analysis of RLR family gene expression after poly I:C exposure in domestic duck and whooper swan cultured cells. Analysis points are 0 (before poly I:C exposure), 3, 6, 24, 48, and 72 h after poly I:C exposure. Error bars show the standard deviation. Target gene expression was quantified relative to the GAPDH internal control. Prior to poly I:C exposure, the expression level was 1.0. n = 6.
In addition to dose-dependent analysis with poly I:C, we also analyzed time-course analysis with poly I:C exposure. In the chicken, MDA5 and LGP2 mRNA levels increased after 50 μg/mL poly I:C exposure (Fig 3C). In Okinawa rail, although RIG-I and LGP2 mRNA levels increased after 50 μg/mL poly I:C exposure, MDA5 mRNA levels remained constant (Fig 3C). The RIG-I, MDA5, LGP2 genes are present in duck and swan cells, similar to Okinawa rail. The RIG-I, MDA5, LGP2 genes were upregulated in duck and swan cultured fibroblasts after exposure to 50 μg/mL poly I:C (Fig 3D). These results support our hypothesis that Okinawa rail MDA5 is a mutated nonfunctional gene.
Sequence of a transcript fragment of MDA5 in chicken and Okinawa rail
In Fig 3, we show MDA5 mRNA expression staining with SYBR green. We amplified the MDA5 transcript target in chicken and Okinawa rail using real-time PCR (Fig 4A). We used the two templates to evaluate the origin of the amplified sequence: synthesized cDNA with reverse transcriptase (RT) plus (+) and RT minus (RT(-)) (Fig 4A). We only detected the target sequence of MDA5 transcript fragments of chicken and Okinawa rail when amplified from synthesized cDNA with RT (+) (Fig 4B). Therefore, the amplified sequences of chicken and Okinawa rail originated from mRNA, not the genome or primer dimers.
a: Amplified MDA5 sequence from chicken and Okinawa rail using real-time PCR staining with SYBR green. Amplification plots of chicken MDA5 reverse transcriptase plus (RT(+)) (upper left), chicken MDA5 RT (-) (lower right), Okinawa rail MDA5 RT (+) (upper light), and Okinawa rail MDA5 RT (-) (lower light) with real-time PCR. b: Detection of the amplified MDA5 sequence after real-time PCR. Electrophoretic image of the detection of the amplified MDA5 sequence from chicken (left panel) and Okinawa rail (right panel). Samples were exposed to 50 μg/mL poly I:C for 24 h. c, d: Comparison between chicken MDA5 genome sequence and amplified sequence using real-time PCR. The amplified MDA5 product from chicken was sequenced using the Sanger method. Before sequencing, to stain those sequences with dye, we used the forward or reverse primer of chicken. The stained sequence of the amplified MDA5 product from chicken was obtained with the forward (c) and reverse (d) primers. e: Primer design of Okinawa rail MDA5. Arrows indicate forward and reverse primers of Okinawa rail MDA5. f, g: Comparison between Okinawa rail MDA5 genome sequence and amplified sequence using real-time PCR. Before sequencing, to stain the sequences with dye, we used the forward and reverse primers of Okinawa rail. The stained sequences of the amplified product of MDA5 transcripts in Okinawa rail were obtained using forward (f) and reverse (g) primers. h: Graphical summary of hit sequences of the amplified product of Okinawa rail MDA5 in the chicken mRNA database.
We next sequenced the amplified MDA5 products from chick and Okinawa rail using the Sanger method. For staining the amplified products with dye, we used the forward or reverse primer of chicken and Okinawa rail. The sequence of the amplified MDA5 product from chicken was highly similar to that of the reference sequence of chicken MDA5 (Fig 4C and 4D). Therefore, our designed primers amplified the chicken MDA5 target sequence. We designed the primers for the amplification of Okinawa rail MDA5 transcripts fragment with the candidate sequence of Okinawa rail MDA5 (Fig 4E). After sequencing with the Sanger method, our results show that the sequence of the amplified product was highly similar to that of the MDA5 sequence of Okinawa rail (Fig 4F and 4G). We conclude that our designed primers correctly amplified the Okinawa rail MDA5 target sequence derived from the candidate sequence of Okinawa rail MDA5.
The sequence of the amplified products from Okinawa rail was obtained from both the 5’ and 3’ ends (Fig 4F and 4G). To obtain the full-length sequence of the amplified product from Okinawa rail with real-time PCR, we combined those sequences. Next, we obtained two full-length sequences of the amplified product of Okinawa rail with real-time PCR. Sequence No. 1 was GTTGCAAAGCCAGCACTGAATGGGATAACATTATAATATGTCTCCCTACAGGCAGTGGTAAACCAGAGTGGCTATTTACAT, and sequence No. 2 was GTTGCAAAGCCAGCACTGAAATGGGATAACATTATAATATGTCTCCCTACAGGCAGTGGTAAACCCAGAGTGGCTATTTACAT. After mapping to the chicken RNA reference database, our obtained sequence only hit the MDA5 mRNA (Fig 4H). Therefore, we considered that our amplified product was identified as the Okinawa rail MDA5 sequence.
MDA5 mRNA expression analysis with fluorescence probe in cultured chicken and Okinawa rail fibroblasts after exposure to poly I:C
In addition to mRNA expression analysis of MDA5 staining with SYBR green, we analyzed MDA5 mRNA expression with a fluorescence probe. To design the MDA5 primers and probe, we targeted the common sequences of MDA5 and GAPDH between chicken and the Okinawa rail genomes (Fig 5A and 5B). Similarly to the real-time PCR analysis with SYBR green, even though chicken MDA5 expression increased with exposure to poly I:C, Okinawa rail MDA5 expression did not change after exposure (Fig 5C and 5D). Therefore, we considered that Okinawa rail MDA5 lost its function during its evolution. Based on the results, we regarded that the Okinawa rail MDA5 gene could be nonfunctional.
a, b: Primer and probe design of chicken and Okinawa rail MDA5 (a) and GAPDH (b). Blue arrows show forward and reverse primers. Yellow arrows show fluorescence probes. c: Expression of MDA5 after exposure to 5 μg/mL and 50 μg/mL poly I:C in the chicken and Okinawa rail cultured fibroblasts. Centerlines of box plots indicate medians; box limits indicate 25th and 75th percentiles. Target gene expression was quantified relative to the GAPDH internal control. The expression level of the control (poly I:C minus) was 1.0. n = 6. *shows p < 0.05. d: Time-course analysis of MDA5 expression during poly I:C exposure in chicken and Okinawa rail cultured fibroblasts. The analysis points were 0 (before poly I:C exposure), 3, 6, 24, 48, and 72 h after poly I:C exposure. Error bars show the standard deviation. Target gene expression was quantified relative to the GAPDH internal control. Prior to poly I:C exposure, the expression level was 1.0. n = 6.
Direct sequencing of MDA5 of Okinawa rail using the Sanger method
Next, we tried to obtain the long sequence of the ORF of MDA5 in Okinawa rail. First, we designed the primers based on the candidate sequence of Okinawa rail MDA5 from the draft genome (S3 Fig). Using these primers, we amplified the MDA5 sequence from the cDNA of Okinawa rail with PCR (S4A Fig). Additionally, we amplified the sequence with nested PCR (S4A Fig). Next, we performed agarose-gel electrophoresis of the nested-PCR products to visualize the bands (S4B Fig). After the extraction of the amplified sequence from the agarose gel, we read those sequences using the Sanger method.
We obtained the ORF of the MDA5, including the ATG start codon, and we found the sequence size to be over 1200 bp (Fig 6A). Next, we performed the Blast search with chicken genome (Fig 6B). These sequences showed homology with the chicken MDA5 genome (Fig 6C). The Okinawa rail MDA5 amino acid sequence also showed homology with that of the chicken MDA5 amino acid sequence (S4C and S4D Fig). Several stop codons were present in the Okinawa rail MDA5 sequence (Fig 6D). We observed the deletion of the base in the Okinawa rail MDA5 sequence (Fig 6D). Therefore, we concluded that Okinawa rail MDA5 is a non-functional gene, resulting from frameshift mutations. This conclusion was fully consistent with the mRNA expression of Okinawa rail MDA5. Thus, we conclude that Okinawa rail MDA5 gene is nonfunctional.
a: Obtained ORF sequence of Okinawa rail MDA5. b: blast search flow. c: Graphical summary of the hit sequence of the ORF obtained from Okinawa rail MDA5 in chicken whole genome information. d: Comparison between the obtained ORF of Okinawa rail and chicken MDA5. Red circles denote stop codons.
In Fig 4, the mRNA of Okinawa rail MDA5 is amplified with real-time PCR. This amplified sequence is contained in our obtained Okinawa rail MDA5 (S5 Fig). Although we observed the frameshift mutation in this sequence, stop codons were absent in it (S5 Fig). However, we found stop codons upstream of this short sequence. Therefore, we concluded that the levels of Okinawa rail MDA5 mRNA do not increase after exposure to poly I:C.
Inflammatory cytokine expression induced by poly I:C exposure in cultured chicken, Okinawa rail, domestic duck, and whooper swan cells
RLR family recognition of poly I:C leads to increased expression of inflammatory cytokines, such as IL-6 and IL1-β [17,18]. We analyzed the mRNA expression of these cytokines from chicken and Okinawa rail after exposure to 5 μg/mL and 50 μg/mL poly I:C for 24 h. In chicken cultured cells, IL6 and IL1beta mRNA levels significantly increased with exposure to 5 μg/mL and 50 μg/mL poly I:C compared with 0 μg/mL poly I:C (Fig 7A). In Okinawa rail cultured cells, IL-6 mRNA expression levels significantly increased after exposure to poly I:C at 24 h (Fig 7B). Although IL1-β mRNA expression levels also increased with exposure to poly I:C for 24 h, the increment was not significant compared to 0 μg/mL poly I:C exposure (Fig 7B). Therefore, the cellular response of inflammatory cytokines to poly I:C exposure is different between chicken and Okinawa rail cell at 24 h.
a: Expression of IL6 and, IL1beta after exposure to 5 μg/mL and 50 μg/mL poly I:C in the chick cultured fibroblasts. Centerlines of box plots indicate medians; box limits indicate 25th and 75th percentiles. Target gene expression was quantified relative to the GAPDH internal control. The expression level of the control (poly I:C minus) was 1.0. n = 6. *shows p < 0.05. b: Expression of IL6 and IL1beta after exposure to 5 μg/mL and 50 μg/mL poly I:C in the Okinawa rail cultured fibroblasts. Centerlines of box plots indicate medians; box limits indicate 25th and 75th percentiles. Target gene expression was quantified relative to the GAPDH internal control. The expression level of the control (poly I:C minus) was 1.0. n = 6. *shows p < 0.05. c: Time-course analysis of IL6 and IL1beta expression during poly I:C exposure in chicken and Okinawa rail cultured fibroblasts. d: Time-course analysis of IL6 and IL1beta expression during poly I:C exposure in domestic duck and whooper swan cultured fibroblasts. Analysis points are 0 (before poly I:C exposure), 3, 6, 24, 48, and 72 h after poly I:C exposure. Error bars show the standard deviation. Target gene expression was quantified relative to the GAPDH internal control. Prior to poly I:C exposure, the expression level was 1.0. n = 6.
The maximum expression level of IL-6 in chicken, domestic duck, and whooper swans was at 3 h but that in Okinawa rail was at 24 h (Fig 7C and 7D). IL1-β expression increased in chicken, Okinawa rail, and domestic duck cultured fibroblasts after exposure to 50 μg/mL poly I:C, but swan cell expression levels did not dramatically change (Fig 7C and 7D). Similar to IL-6 expression, the maximum expression level of IL1-β for the Okinawa rail was at a later point compared to that for the chicken (Fig 7B).
These results show that the cellular response of inflammatory cytokines to poly I:C exposure was different between chicken and Okinawa rail cultured fibroblasts. In particular, we considered that these responses were delayed in Okinawa rail cultured fibroblasts compared to that of chicken cultured fibroblasts.
Cell number and evaluation of live cell ratio in chicken and Okinawa rail cultured fibroblasts after poly I:C exposure
We evaluated the number of chicken and Okinawa rail cultured fibroblasts after poly I:C exposure for 24 h and 48 h. The number of chicken cultured fibroblasts decreased in a dose-dependent manner at 24 h and 48 h (Fig 8A and 8B). Similar to the cell number, the live cell ratio of chicken cultured fibroblasts also decreased with poly I:C exposure, with a significant decrease after exposure to 50 μg/mL poly I:C (Fig 8C and 8D). In Okinawa rail cultured fibroblasts, the cell number and live cell ratio remained constant at 24 h, regardless of poly I:C exposure (Fig 8A and 8C). Contrastingly, the cell number and live cell ratio of Okinawa rail cells decreased with poly I:C exposure for 48 h (Fig 8B and 8D). The cellular response to poly I:C was different between chicken and Okinawa rail cultured fibroblasts. In particular, the decrease in cell number and live cell ratio was delayed in Okinawa rail cultured fibroblasts compared with that of chicken cultured fibroblasts.
a, b: Number of chicken and Okinawa rail cells at 24 h (a) and 48 h (b) after poly I:C exposure. Box plot graphs show the cell numbers of the control (poly I:C minus) and after 5 μg/mL and 50 μg/mL of poly I:C exposure. Centerlines of box plots indicate medians; box limits indicate 25th and 75th percentiles. n = 6. *shows p < 0.05. c, d: Live cell ratios of chicken and Okinawa rail cells at 24 h (c) and 48 h (d) after poly I:C exposure. Box plot graphs show the cell numbers of the control (poly I:C minus) and after 5 μg/mL and 50 μg/mL of poly I:C exposure. Centerlines of box plots indicate medians; box limits indicate 25th and 75th percentiles. n = 6. *shows p < 0.05.
Apoptosis occurred after poly I:C exposure in chicken cultured fibroblasts
Chicken cultured fibroblasts showed significantly increased late apoptosis and cell death at 48 h (Fig 9A and 9C). In contrast, Okinawa rail cultured fibroblasts did not show a significant change after exposure to 50 μg/mL poly I:C (Fig 9B and 9D). Therefore, exposure to poly I:C for 48 h induced apoptosis in chicken cultured fibroblasts but not in Okinawa rail cultured fibroblasts. These results support our hypothesis that the cellular response to poly I:C exposure differs between chicken and the Okinawa rail.
a: Detection of apoptotic cells in chicken after 48 h of exposure to 50 μg/mL poly I:C. b: Detection of apoptotic Okinawa rail cells after 48 h of exposure to 50 μg/mL poly I:C. c, d: Comparison of live cells, early apoptotic cells, and late apoptosis/dead cell ratio between control (poly I:C minus) and 50 μg/mL poly I:C-exposed chicken cells (c) and Okinawa rail cells (d). Left, live cells; middle, early apoptotic cells; right, late apoptosis/dead cells. Box plot graphs show the ratio of control (poly I:C minus) to 50 μg/mL poly I:C-exposed cells. Centerlines of box plots indicate medians; box limits indicate 25th and 75th percentiles. n = 6. *shows p < 0.05.
IFN-β and Mx1 expression in chicken and Okinawa rail cultured fibroblasts after poly I:C exposure
The IFN-beta is activated by RIG-I- and MDA5- derived signals [4,5]. Our results show that IFN-β mRNA expression dose-dependently increased with the amount of poly I:C in chicken and Okinawa rail cultured fibroblasts (Fig 10A). Similar to inflammatory cytokines, the time point of the maximum value of IFN-β mRNA expression was delayed in Okinawa rail cultured fibroblasts compared with that in chicken cultured fibroblasts (chicken: 6 h, Okinawa rail: 24 h) (Fig 10B).
a: Expression of IFNβ mRNA after exposure to 5 μg/mL and 50 μg/mL poly I:C (control) in chicken and Okinawa rail cells. Centerlines of box plots indicate medians; box limits indicate 25th and 75th percentiles. IFNβ mRNA expression was quantified relative to the GAPDH internal control. The expression level of the control (poly I:C minus) was 1.0. n = 6. *shows p < 0.05. b: Time-course analysis of IFNβ during poly I:C exposure in chicken and Okinawa rail cells. Analysis points are 0 (before poly I:C exposure), 3, 6, 24, 48, and 72 h after poly I:C exposure. Error bars show the standard deviation. IFNβ mRNA expression was quantified relative to the GAPDH internal control. Prior to poly I:C exposure, the expression level was 1.0. n = 6. *shows p < 0.05. c: Expression of Mx1 mRNA after exposure to 5 μg/mL and 50 μg/mL poly I:C (control) in chicken and Okinawa rail cells. Centerlines of box plots indicate medians; box limits indicate 25th and 75th percentiles. Mx1 mRNA expression was quantified relative to the GAPDH internal control. The expression level of the control (poly I:C minus) was 1.0. n = 6. *shows p < 0.05. d: Time-course analysis of Mx1 mRNA expression during poly I:C exposure in chicken, Okinawa rail, domestic duck, and whooper swan cells. The measurement points are 0 (before poly I:C exposure), 3, 6, 24, 48, and 72 h after poly I:C exposure. Error bars show the standard deviation. Mx1 mRNA expression was quantified relative to the GAPDH internal control. Prior to poly I:C, the expression level was 1.0. n = 6. *shows p < 0.05.
Mx1 protein suppresses the intracellular self-renewal of viruses, such as that of the influenza virus [19,20], and the Mx1 protein induces IFN-β signaling [19]. Chicken and Okinawa rail cultured fibroblasts showed significantly increased Mx1 mRNA expression after exposure to 5 μg/mL and 50 μg/mL poly I:C compared with 0 μg/mL poly I:C exposure (Fig 10C). In addition to inflammatory cytokine expression, IFN-β and Mx1 mRNA expression associated with poly I:C exposure was also delayed in Okinawa rail cultured fibroblasts compared with that in chicken cultured fibroblasts (Fig 10D). These results also indicate that Okinawa rail cultured fibroblasts show delayed response to poly I:C compared with that shown by chicken cultured fibroblasts.
Discussion
RLR families (RIG-I, MDA5, and LGP2) act as sensors for stimulation of the host’s innate immune system [4–8]. Therefore, their recognition function is critical in host defense in birds [4,5]. In avians, the recognition systems of the RLR families differ among species [10], for example, the lack of the RIG-I gene in chickens [4,9]. Therefore, we considered that obtaining the sequence of Okinawa rail RLR families would be a clue to their reactivity of host defense to infectious disease. Therefore, we first tried to obtain the RLR family genes (RIG-I, MDA5, and LGP2) from the draft genome of the Okinawa rail. Although the almost full sequence of RIG-I and LGP2 allowed us to obtain the Okinawa rail draft genome with a blastn search, the candidate sequence of MDA5 was partial. Zheng and Satta reported that avian MDA5 has the highest conservation level in the helicase domain but a lower level in the caspase recruitment domain (CARDs) region using predicted coding sequences from 62 bird species [10]. The corresponding sequence of the CARD region (approximately 1 to 600 base pairs from the N-terminal) was not obtained from the Okinawa rail draft genome sequence in this study; therefore, our results agree with those of previous reports. In the candidate sequence of Okinawa rail MDA5, a number of TGA, TAA, and TAG sequences were found; therefore, we considered that stop codons occurred in the Okinawa rail MDA5 sequence. Based on these results, we suspect that MDA5 is a mutated nonfunctional gene in the Okinawa rail.
In this study, we analyzed the mRNA expression of MDA5 in Okinawa rail cultured fibroblasts. Although phagocytosis and antigen presentation occurs only in immune cells (e.g., macrophages and dendritic cells), fibroblasts recognize antigens through RLRs. Therefore, fibroblasts can be used for RLR-derived signaling studies in humans, mice, and chickens [9,15,21]. To stimulate the RLR pathway, we used poly I:C, which has been used in a number of studies for stimulation of the RLR pathway [5,9,14,15]. In the present study, poly I:C stimulated RIG-I, LGP2, and downstream signals but did not alter MDA5 mRNA expression in Okinawa rail cultured fibroblasts. In addition to mRNA expression analysis of Okinawa rail MDA5 after poly I:C exposure, we tried to obtain the ORF of MDA5, including the ATG start codon. As consequently, we obtained the ORF of the MDA5, including the ATG start codon and the sequence size is over 1200bp. In those sequences, we observed a number of stop codons. This result is fully consistent with our hypothesis. Based on these results, we conclude that MDA5 of Okinawa rail is a mutated nonfunctional gene. To the best of our knowledge, this is the first experimental evaluation of the loss of function of Okinawa rail genes.
We considered that the loss of function of the MDA5 gene is critical for the innate immune response of the Okinawa rail. In mammals, RIG-I is the main sensor for detecting the influenza A virus, whereas MDA5 is the primary influenza A virus sensor in chicken [22,23]. MDA5 recognizes dsRNA of the influenza A virus, resulting in type I IFN induction in chicken cells [22]. In the present study, we showed that IFN-β mRNA expression was delayed in Okinawa rail after exposure to poly I:C compared to that in chicken. The Mx protein is induced by an IFN-β signal and exhibits antiviral activity against RNA viruses, such as the influenza virus [19,20]. In the present study, Mx1 mRNA expression was delayed in Okinawa rail compared to that in chickens. These results indicate that the innate immune response of the Okinawa rail is delayed when compared to that of chickens. This result is consistent with our hypothesis that the loss of function of the MDA5 gene has a critical effect on the innate immune response of the Okinawa rail.
Furthermore, we observed that inflammatory cytokine mRNA expression in Okinawa rail was delayed compared with that in chickens, domestic ducks, and whooper swans after poly I:C exposure. Cell number and live cell ratio analysis in chicken cells showed a rapid decrease in cell number and live cell ratio with poly I:C exposure compared with that in Okinawa rail cultured fibroblasts. Late apoptosis/dead cells were only significantly increased in chicken cells after 48 h of poly I:C exposure. Based on these in vitro experiments, we conclude that the innate immune response of Okinawa rail cultured fibroblasts was delayed compared with that of chicken cultured fibroblasts.
In addition to RLRs, toll-like receptor (TLR) 3 is stimulated by poly I:C in avian cells [24]. In the present study, we observed that TLR3 mRNA expression increased with exposure to poly I:C (S2 Fig). Similar to RLRs, TLRs are sensors for the recognition of antigens, and TLR-derived signals activate innate immunity in birds [4,5]. Although a single knockout of MDA5 in chicken DF-1 reduced the innate immune responses against RNA ligands, a single knockout of TLR3 maintained innate immune responses against RNA ligands [13]. Therefore, it has been suggested that MDA5 is the major sensor, whereas TLR3 is a secondary sensor in chicken. Therefore, we also considered that RLR in Okinawa rail would be the major sensor for virus recognition compared with TLR 3.
The innate immune response plays a critical role in host defense, especially during the early stages. Our in vitro study indicated that the MDA5 gene is a mutated nonfunctional gene in the Okinawa rail and that the innate immune response of the Okinawa rail is delayed compared to that of chicken. Our results provide useful information for the conservation of Okinawa rail because studies of the Okinawa rail immune response are quite limited.
Supporting information
S1 Fig. Comparison of the cytoskeleton of chick muscle-derived fibroblast, Okinawa rail skin derived fibroblast, and chicken embryonic fibroblast.
Images show the cytoskeleton of chick muscle-derived fibroblast (upper three panels), Okinawa rail skin-derived fibroblast (middle three panels), and chicken embryonic fibroblast (lower three panels). The left panels show merge images; the middle panels show staining with F-actin; the right panels show the image of Dapi. Scale bar show 100 μm.
https://doi.org/10.1371/journal.pone.0290436.s001
(PDF)
S2 Fig. Expression of TLR3 mRNA after poly I:C exposure in chicken and Okinawa rail culture cells.
Expression of TLR3 mRNA after exposure to 5 μg/mL and 50 μg/mL poly I:C (control) in chick and Okinawa rail cells. Left side is chicken, right side is Okinawa rail. Centerlines of box plots indicate medians; box limits indicate 25th and 75th percentiles. TLR3 mRNA expression was quantified relative to the GAPDH internal control. The expression level of the control (poly I:C minus) was 1.0. n = 6. *shows p < 0.05.
https://doi.org/10.1371/journal.pone.0290436.s002
(PDF)
S3 Fig. Primer design for the direct sequencing of Okinawa rail MDA5.
a: Our designed primer location in the candidate sequence of Okinawa rail MDA5 from the draft genome. b-d: Designed primers of this study.
https://doi.org/10.1371/journal.pone.0290436.s003
(PDF)
S4 Fig. Amino acids sequence of the obtained Okinawa rail MDA5.
a: Flow of obtaining the Okinawa rail MDA5. b: Image of electrophoresis after nested PCR. We extracted the amplification sequence from the white arrows. c: Amino acids sequence of our obtained Okinawa rail MDA5. Those sequences were translated from our obtained Okinawa rail MDA5 sequence (Fig 6A). Red asterisks are stop codons. d: Homology between chicken MDA5 and our Okinawa rail MDA5 amino acids sequence.
https://doi.org/10.1371/journal.pone.0290436.s004
(PDF)
S5 Fig. Translation of the 81 bp cDNA fragment into an amino acid sequence.
The orange line is the 81bp cDNA fragment of Fig 4H. The blue highlight sequences are translated amino acids sequences of Okinawa rail that of 81bp cDNA fragment. The green highlight sequences are translated amino acids sequences of chicken that of 81bp cDNA fragment. Asterisks are stop codons.
https://doi.org/10.1371/journal.pone.0290436.s005
(PDF)
S2 Table. Primer sequence for Okinawa rail qPCR.
https://doi.org/10.1371/journal.pone.0290436.s007
(PDF)
S3 Table. Primer sequence for domestic duck qPCR.
https://doi.org/10.1371/journal.pone.0290436.s008
(PDF)
S4 Table. Primer sequence for whooper swan qPCR.
https://doi.org/10.1371/journal.pone.0290436.s009
(PDF)
S5 Table. Primer sequence for qPCR with fluorescence probe.
https://doi.org/10.1371/journal.pone.0290436.s010
(PDF)
S6 Table. Primer sequence for direct sequencing.
https://doi.org/10.1371/journal.pone.0290436.s011
(PDF)
Acknowledgments
We thank all members of the time-capsule team at the National Institute of Environmental Studies. We also thank Prof. Atsushi Tajima, Tsukuba University, for providing chicken embryonic tissue.
References
- 1. Yamashina Y, Mano T. A new species of rail from Okinawa Island. Journal of the Yamashina Institute for Ornithology. 1981;13(3):1–6. Zoorec:Zoor11900017170.
- 2.
IUCN-Species-Survival-Commission. IUCN red list categories and criteria version 3.1. IUCN (International Union for Conservation of Nature). 2012.
- 3. Miller BJ. Why unprecedented bird flu outbreaks sweeping the world are concerning scientists. Nature. 2022;606(7912):18–9. pmid:35618804.
- 4. Chen S, Cheng A, Wang M. Innate sensing of viruses by pattern recognition receptors in birds. Vet Res. 2013;44:82. Epub 20130909. pmid:24016341; PubMed Central PMCID: PMC3848724.
- 5. Magor KE. Evolution of RNA sensing receptors in birds. Immunogenetics. 2022;74(1):149–65. Epub 20220121. pmid:35059779; PubMed Central PMCID: PMC8776391.
- 6. Yoneyama M, Kikuchi M, Natsukawa T, Shinobu N, Imaizumi T, Miyagishi M, et al. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat Immunol. 2004;5(7):730–7. Epub 20040620. pmid:15208624.
- 7. Yoneyama M, Kikuchi M, Matsumoto K, Imaizumi T, Miyagishi M, Taira K, et al. Shared and unique functions of the DExD/H-box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity. J Immunol. 2005;175(5):2851–8. pmid:16116171.
- 8. Kato H, Takeuchi O, Sato S, Yoneyama M, Yamamoto M, Matsui K, et al. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature. 2006;441(7089):101–5. Epub 20060409. pmid:16625202.
- 9. Barber MR, Aldridge JR Jr, Webster RG, Magor KE. Association of RIG-I with innate immunity of ducks to influenza. Proc Natl Acad Sci U S A. 2010;107(13):5913–8. Epub 20100322. pmid:20308570; PubMed Central PMCID: PMC2851864.
- 10. Zheng W, Satta Y. Functional Evolution of Avian RIG-I-Like Receptors. Genes (Basel). 2018;9(9). Epub 20180912. pmid:30213147; PubMed Central PMCID: PMC6162795.
- 11. Zou J, Chang M, Nie P, Secombes CJ. Origin and evolution of the RIG-I like RNA helicase gene family. BMC Evol Biol. 2009;9:85. Epub 20090428. pmid:19400936; PubMed Central PMCID: PMC2686710.
- 12. Barber MR, Aldridge JR Jr, Fleming-Canepa X, Wang YD, Webster RG, Magor KE. Identification of avian RIG-I responsive genes during influenza infection. Mol Immunol. 2013;54(1):89–97. Epub 20121204. pmid:23220072; PubMed Central PMCID: PMC3565471.
- 13. Lee SB, Park YH, Chungu K, Woo SJ, Han ST, Choi HJ, et al. Targeted Knockout of MDA5 and TLR3 in the DF-1 Chicken Fibroblast Cell Line Impairs Innate Immune Response Against RNA Ligands. Front Immunol. 2020;11:678. Epub 20200430. pmid:32425931; PubMed Central PMCID: PMC7204606.
- 14. Zou J, Kawai T, Tsuchida T, Kozaki T, Tanaka H, Shin KS, et al. Poly IC triggers a cathepsin D- and IPS-1-dependent pathway to enhance cytokine production and mediate dendritic cell necroptosis. Immunity. 2013;38(4):717–28. pmid:23601685.
- 15. Kato H, Takeuchi O, Mikamo-Satoh E, Hirai R, Kawai T, Matsushita K, et al. Length-dependent recognition of double-stranded ribonucleic acids by retinoic acid-inducible gene-I and melanoma differentiation-associated gene 5. J Exp Med. 2008;205(7):1601–10. pmid:18591409; PubMed Central PMCID: PMC2442638.
- 16. Katayama M, Kiyono T, Ohmaki H, Eitsuka T, Endoh D, Inoue-Murayama M, et al. Extended proliferation of chicken- and Okinawa rail-derived fibroblasts by expression of cell cycle regulators. J Cell Physiol. 2019;234(5):6709–20. pmid:30417340.
- 17. Golebski K, Luiten S, van Egmond D, de Groot E, Roschmann KI, Fokkens WJ, et al. High degree of overlap between responses to a virus and to the house dust mite allergen in airway epithelial cells. PLoS One. 2014;9(2):e87768. Epub 20140203. pmid:24498371; PubMed Central PMCID: PMC3912021.
- 18. Rubins KH, Hensley LE, Relman DA, Brown PO. Stunned silence: gene expression programs in human cells infected with monkeypox or vaccinia virus. PLoS One. 2011;6(1):e15615. Epub 20110118. pmid:21267444; PubMed Central PMCID: PMC3022624.
- 19. Schneider WM, Chevillotte MD, Rice CM. Interferon-stimulated genes: a complex web of host defenses. Annu Rev Immunol. 2014;32:513–45. Epub 20140206. pmid:24555472; PubMed Central PMCID: PMC4313732.
- 20. Staeheli P, Haller O, Boll W, Lindenmann J, Weissmann C. Mx protein: constitutive expression in 3T3 cells transformed with cloned Mx cDNA confers selective resistance to influenza virus. Cell. 1986;44(1):147–58. pmid:3000619.
- 21. Kim JA, Seong RK, Son SW, Shin OS. Insights into ZIKV-Mediated Innate Immune Responses in Human Dermal Fibroblasts and Epidermal Keratinocytes. J Invest Dermatol. 2019;139(2):391–9. Epub 20180912. pmid:30218650.
- 22. Liniger M, Summerfield A, Zimmer G, McCullough KC, Ruggli N. Chicken cells sense influenza A virus infection through MDA5 and CARDIF signaling involving LGP2. J Virol. 2012;86(2):705–17. Epub 20111109. pmid:22072756; PubMed Central PMCID: PMC3255855.
- 23. Pichlmair A, Schulz O, Tan CP, Naslund TI, Liljestrom P, Weber F, et al. RIG-I-mediated antiviral responses to single-stranded RNA bearing 5’-phosphates. Science. 2006;314(5801):997–1001. Epub 20061012. pmid:17038589.
- 24. Wang Y, Yang F, Yin H, He Q, Lu Y, Zhu Q, et al. Chicken interferon regulatory factor 7 (IRF7) can control ALV-J virus infection by triggering type I interferon production through affecting genes related with innate immune signaling pathway. Dev Comp Immunol. 2021;119:104026. Epub 20210123. pmid:33497733.