https://orcid.org/0000-0001-8609-448X
Figures
Abstract
This study aimed to investigate the antimicrobial resistance (AMR), antibiotic resistance genes (ARGs) and integrons in 157 Escherichia coli (E. coli) strains isolated from feces of captive musk deer from 2 farms (Dujiang Yan and Barkam) in Sichuan province. Result showed that 91.72% (144/157) strains were resistant to at least one antimicrobial and 24.20% (38/157) strains were multi-drug resistant (MDR). The antibiotics that most E. coli strains were resistant to was sulfamethoxazole (85.99%), followed by ampicillin (26.11%) and tetracycline (24.84%). We further detected 13 ARGs in the 157 E. coli strains, of which blaTEM had the highest occurrence (91.72%), followed by aac(3’)-Iid (60.51%) and blaCTX-M (16.56%). Doxycycline, chloramphenicol, and ceftriaxone resistance were strongly correlated with the presence of tetB, floR and blaCTX-M, respectively. The strongest positive association among AMR phenotypes was ampicillin/cefuroxime sodium (OR, 828.000). The strongest positive association among 16 pairs of ARGs was sul1/floR (OR, 21.667). Nine pairs positive associations were observed between AMR phenotypes and corresponding resistance genes and the strongest association was observed for CHL/floR (OR, 301.167). Investigation of integrons revealed intl1 and intl2 genes were detected in 10.19% (16/157) and 1.27% (2/157) E. coli strains, respectively. Only one type of gene cassettes (drA17-aadA5) was detected in class 1 integron positive strains. Our data implied musk deer is a reservoir of ARGs and positive associations were common observed among E. coli strains carrying AMRs and ARGs.
Citation: Liu H, Pan S, Cheng Y, Luo L, Zhou L, Fan S, et al. (2023) Distribution and associations for antimicrobial resistance and antibiotic resistance genes of Escherichia coli from musk deer (Moschus berezovskii) in Sichuan, China. PLoS ONE 18(11): e0289028. https://doi.org/10.1371/journal.pone.0289028
Editor: Md. Tanvir Rahman, Bangladesh Agricultural University, BANGLADESH
Received: May 26, 2023; Accepted: July 8, 2023; Published: November 27, 2023
Copyright: © 2023 Liu et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the paper and its Supporting information files.
Funding: This work was funded by the National Key Research and Development Program of China (2018YFD0500900, 2016YFD0501009), the Chengdu Giant Panda Breeding Research Foundation (CPF2017-05, CPF2015-4) and the Science and Technology Achievements Transfer Project in Sichuan province (2022JDZH0026).
Competing interests: The authors have declared that no competing interests exist.
1. Introduction
Musk deer is one of the first-class protected and endangered animals in China [1]. In captive environment, intestinal disease is the main disease that threatens musk deer breeding [2, 3]. Antimicrobial resistance (AMR) of E. coli has become a global challenge due to the wide usage of antibiotics in clinic [4]. In particular, E. coli isolates that were resistant to at least three or more categories of antibiotics are considered as multi-drug resistant (MDR) [5], which increased the difficulty of treating animal bacterial diseases and also a potential risk to public health.
Antibiotic resistance gene (AGR) was considered to be the main factor of antimicrobial resistance [6] and become a new contaminant for environmental pollution [7]. ARGs are usually carried by integrons, transposons and plasmids to mediate the horizontal transmission of AMR [8]. Integrons can capture, convert and adapt resistance gene cassettes into functionally expressed genes via self-efficient gene expression system [9]. Integron usually links to plasmid, which can transfer ARGs among various bacterial species [10].
E. coli is usually considered as an indicator organism to AMR [6, 11, 12]. Though AMR associated with ARGs have been reported in E. coli from different animals (honeybees, poultry and pigs) [13–15], antimicrobial resistance of E. coli in musk deer remains unknown. This study aimed to examine the antimicrobial resistance phenotype, antimicrobial resistance genes and integron in E. coli to better understand the association among AMR phenotypes and ARGs in musk deer.
2. Materials and methods
2.1 Sample collection
From Sep to Oct 2020, fresh fecal samples were collected from 157 clinically healthy musk deer in Dujiang Yan (n = 101) and Barkam (n = 56) (S1 Table). Each sample was collected from an individual. Fresh fecal specimens (approximately 10 g) from each musk deer were collected immediately by feeders after defecation on the ground and then quickly transferred into individual 50-mL plastic containers. After collection, samples were stored at 4°C in a cooler and transported to the laboratory for bacterial isolation within 12 h.
This study was reviewed and approved by the Institutional Animal Care and Use Committee of Sichuan Agricultural University under permit number DYY-2020103018. Prior to the collection of fecal specimens from captive musk deer, permission was obtained from Sichuan Institute of Musk Deer Breeding in Sichuan, China.
2.2 Isolation and enumeration of E. coli
Fecal samples were pre-enriched in buffered peptone water (Oxoid, UK) and incubated for 4–6 h at 37°C. All isolates were presumptively identified by Gram staining, MacConkey (Solarbio, BeiJing), and then confirmed by eosin methylene blue agar growth (Chromagar, France) (Solarbio, BeiJing), and then confirmed by eosin methylene blue agar growth (Chromagar, France) [16, 17] and biochemically identified by API 20E system (BioMerieux, France). The 16SrRNA (F: AGAGTTTGATCCTGGCTCAG, R: GGTTACCTTGTTACGACTT) of all strains were further amplified to confirm the isolates are E. coli.
2.3 Antimicrobial susceptibility testing
The susceptibilities of all isolates to 27 antimicrobials were tested using the standard disk diffusion method recommended by the Clinical and Laboratory Standards Institute [18]. The following antimicrobial disks (Oxoid) were used: aminoglycosides (gentamicin, CN, 10 μg; tobramycin, TOB, 10 μg; amikacin, AK, 30 μg; netilmicin, NET, 10 μg), chloram phenicols (chloramphenicol, CHL, 30 μg), quinolones (ciprofloxacin, CIP, 5 μg), sulfonamide (sulfamethoxazole, RL, 25 μg), tetracyclines (tetracycline, TE, 30 μg; doxycycline, DO, 30 μg; tigecycline, TGC, 15 μg; minocycline, MH, 30 μg), β-lactams (piperacillin/tazobactam10:1, TZP, 100 μg/10 μg; ertapenem, ETP, 10 μg; imipenem, IPM, 10 μg; meropenem, MEM, 10 μg; cephazolin, KZ, 30 μg; cefuroxime sodium, CXM, 30 μg; cefotaxime, CTX, 30 μg, ceftriaxone, CRO, 30 μg; cefepime, FEP, 30 μg; cefoxitin, FOX, 30 μg, aztreonam, ATM, 30 μg; ampicillin, AMP, 10 μg; amoxicillin/clavulanic acid 2:1, AMC, 20/10 μg; ampicillin/sulbactam 1:1, SAM, 10/10 μg; fosfomycin, FOS, 50 μg). Results were interpreted in accordance with CLSI criteria. E. coli ATCC25922 was used as a control. The 27 antibiotics were chosen with the following rationale: AMC, CN, CRO, AK, ENR, FFC and FOX have been used in two farms (Table 1); E. coli in other Cervidae have been found resistant to TOB, NET, CHL, CIP, RL, TE, TGC, MH, TZP, MEM, KZ, CXM, CTX, CAZ, FEP and SAM [19, 20]; AML, AMP, TET, DOX and RL have been widely used in animal husbandry [21]. MDR refers to the concurrent resistance of three or more categories of antibiotics [22].
2.4 DNA extraction and screening for antimicrobial resistance genes and integrons
Total E. coli genomic DNA was extracted by kit according the manufacturer (Tiangen Biotech, Beijing, China). Extracted DNA was stored at -20°C. Thirteen different resistance genes and intl 1, intl 2 and intl 3 gene amplified by polymerase chain reaction (PCR). Subsequently, strains harboring intl 1 or intl 2 genes were elaborated for the amplification of variable regions (VRs). The PCR products were separated by gel electrophoresis in a 1.5% agarosegel stained with GoldView™ (Sangon Biotech, Shanghai, China), visualized under ultraviolet light and photographed using a gel documentation system (Bio-Rad, Hercules, USA). Primers and detailed conditions for PCR are described in S2 Table. The PCR reaction mixture was prepared with a composition of 12.5 μL of master mix (Origin, India), 2 μL template DNA, 1 μL primers (forward and reverse) and the volume raised to 25 μL with the water free from nuclease.
2.5 Sequence and data analysis
All positive PCR products were directly sequenced by BGI (Beijing, China) in both directions. Sequences were analyzed online using BLAST (http://blast.ncbi.nlm.nih.gov). P-values < 0.05 were considered to be statistically significant. The association between AMR phenotypes and the ARG was calculated, and the association was considered significant at a P-value of < 0.05 and was reported as an odds ratio (OR) with 95% confidence intervals (CI). An OR of > 1 was considered as positive association or the increasing probability of the cooccurrence of the genotype or phenotype, while an OR of < 1 was considered as negative association or the decreasing probability of the cooccurrence of the genotype or phenotype. All analyses were conducted using the SPSS 27 software (StataCorp Lp, College Station, TX, USA).
3. Results
3.1 Antimicrobial susceptibility testing for 157 E. coli
The distribution of antibiotic resistant in 157 E. coli was summarized in S1 Table. One hundred and forty-four isolates (91.71%, 144/157) were resistant to at least one antibiotic. Most of these isolates showed resistance to RL (85.99%, 135/157), AMP (26.11%, 41/157), TE (24.84%, 39/157), CTX (24.20%, 38/157), CXM (23.57%, 37/157) and KZ (22.93%, 36/157). All strains were sensitive to AK, ETP, IPM, MEM and FOX. Fifty-five antibiotic resistance patterns were observed, and the top three prevalent patterns are RL (44.59%, 70 isolates), RL/TE (4.46%, 7 isolates) and RL/TE/DO (4.46%, 7 isolates). Thirty-eight isolates (24.20%, 38/157) were found MDR in our study (Dujiang Yan, 19.80%, 20/101; Barkam, 32.14%, 18/56). Thirteen strains were resistant to more than 10 kinds of antibiotics, DJY62 and DJY75 were resistant to 15 antibiotics.
The details of AMRs for E. coli strains from captive musk deer in two farms were shown in Table 2 and Fig 1. Both Dujiang Yan (93.07%, 94/101) and Barkam (89.27%, 50/56) have high rate of antibiotic resistance and showed no significant difference (P > 0.05). Significant differences in resistance to TE, KZ, CXM, SAM and CIP were observed from Barkam and Dujiang Yan (P < 0.05).
The color scale on the right of figure showed the total number of E. coli isolates, in each of which carried a pair of antibiotic resistance genes and antibiotic corresponding to abscissa and ordinate, blue indicating the number is low, white indicating intermediate value, and red indicating the number is high. The number of positive isolates were also listed in the figure. A: Eighty-six E. coli strains were resistant to RL and the blaTEM was the most prevalent genes among all tested genes in Dujiang Yan. B: The results were similar in Dujiang Yan, the most prevalent AMR was RL and blaTEM was the most prevalent genes among all tested genes in Barkam.
3.2 Distribution of 13 antibiotic resistance genes (ARGs) for 157 E. coli
As S1 Table showed, at least one of the ARGs were detected in 149 (149/157, 94.90%) strains. Among the 13 ARGs, 11 were detected: blaTEM (91.72%), aac(3’)-IId (60.51%), sul2 (19.11%), blaCTX-M (16.56%), sul1 (14.01%), tetA (12.10%), sul3 (10.83%), floR (9.55%), aac(6’)-Ib (8.28%), tetB (7.01%), qnrA (1.27%). The remaining 2 ARGs (blaSHV and catA1) were not detected. Fifty ARGs patterns were observed, of which blaTEM /aac(3’)-IId (27.39%, 43/157) was the most prevalent pattern. It is worth noting that 20 isolates carried more than 5 types of ARGs. Strain Bar35 from Barkam carried the most ARGs (10 types).
The details of ARGs carrying rate for E. coli strains from captive musk deer in two farms were shown in Tables 3 and 4, Fig 1. Among strains that carried ARGs, 94 (93.07%, 94/101) strains were isolated from Dujiang Yan and 55 (98.21%, 55/56) strains were isolated from Barkam. The most prevalent ARGs pattern was blaTEM /aac(3’)-IId in Dujiang Yan (29.70%, 30/101) and in Barkam (23.21%, 13/56), respectively. The ARGs carrying rate in Barkam was 98.21%, higher than that in Dujiang Yan (93.07%). In addition, blaSHV, catA1 and qnrA were not detected in Dujiang Yan, blaSHV and catA1 were not detected in Barkam. Significant difference in blaCTX-M, floR, tetA, sul2, aac(6’)-Ib were observed between strains from Barkam and Dujiang Yan (P < 0.05).
3.3 Associations for 21 AMRs/11 ARGs, between AMRs and ARGs, respectively
For the associations between AMRs pairs, 58 pairs were found positively associated (OR > 1) (Table 5). The strong association was observed between CXM and AMP (OR, 828.000; 95% CI, 93.653–7320.478), followed by KZ/CTX (OR, 497.250; 95% CI, 87.295–2832.443), CXM/CTX (OR, 328.667; 95% CI, 70.110–1540.743), ATM/CRO (OR, 223.667; 95% CI, 27.667–1808.144) and ATM/KZ (OR, 188.571; 95% CI, 23.581–1507.989). A total of 16 pairs positive associations (OR > 1) in ARGs were also observed (Table 6). The strongest positive association was detected between sul1 and floR (OR, 21.667; 95% CI, 6.361–73.802), followed by sul1/sul2 (OR, 17.143; 95% CI, 6.026–48.766) and blaCTX-M/sul3 (OR, 15.278; 95% CI, 4.937–47.282).
As Table 7 showed, a total of 73 pairs positive associations between AMRs and ARGs were observed (P < 0.05) and no negative associations was observed. Positive associations were found between 9 pairs of AMR phenotypes with corresponding resistance genes. There was a positive association between chloramphenicol antibiotics with floR gene, CHL/floR (OR: 301.167, CI: 46.078–1968.425). Six β-lactams antibiotics were positively associated with blaCTX-M gene: CRO/blaCTX-M (OR: 27.857, CI: 9.579–81.011), KZ/blaCTX-M (OR: 23.958, CI: 8.371–68.573), CXM/blaCTX-M (OR: 22.353, CI: 7.862–63.557), CTX/blaCTX-M (OR: 20.926, CI: 7.403–59.151), ATM/blaCTX-M (OR: 15.815, CI: 5.668–44.125) and CAZ/blaCTX-M (OR: 6.526, CI: 2.059–20.685). Two tetracyclines antibiotics have positive associations with tetB gene: DO/tetB (OR: 15.030, CI: 3.698–61.087) and TE/tetB (OR: 9.892, CI: 2.477–39.515).
3.4 Integron types and gene cassette
Among the 157 strains, int1 and intI2 genes were found in 16 (10.19%, 16/157) and 2 (1.27%, 2/157) strains, respectively (Table 8). As Table 8 showed, only 1 strain (Bar 36) contained both intI1 and intI2 genes. No intI3 gene was detected. The prevalence of class 1 integrons was 8.91% (9/101) in Dujiang Yan and 12.50% (7/56) in Barkam. Class 2 integrons was only detected in Barkam (3.57%, 2/56). As shown in Table 8, only one cassette arrays (dfrA17-aadA5) were identified from 16 class 1 integron positive isolates, no cassette was detected in class 2 integron.
4. Discussion
To better understand the antibiotic resistance of E. coli from captive musk deer in Sichuan, China, 157 E. coli strains isolated were detected for the occurrence of AMRs, ARGs, integrons and gene cassettes. Among the 157 E. coli strains, 144 strains were resistant to at least one antibiotic (91.72%, 144/157), which is lower than data from hybrid deer as reported in another study (100.00%, 51/51) [23]. Meanwhile, 38 isolates in our study were found to be multi-drug resistant (MDR) and the rate of MDR (24.2%, 38/144) is higher than E. coli strains isolated from hybrid deer (3.30%, 1/30) [24]. However, the rate of MDR in our result is lower than the rate in captive giant pandas (100.00%, 89/89) and non-human primates (49.65%, 494/995) [16, 25], which showed MDR strains from musk deer is not serious compared with giant pandas and non-human primates. Our results showed E. coli from musk deer were mostly resistant to RL (85.99%), AMP (26.11%) and TE (24.84%) and the antibiotic resistance rates are lower than the corresponding resistance rate of E. coli from deer (RL, AMP, TE were 90.63%, 90.63% and 87.50%, respectively) reported in Bangladesh Nature Reserve [26]. This phenomenon may relate to different antibiotic used in the two regions [27, 28]. However, the resistance rate against TE (24.84%), KZ (22.93%), ATM (14.65%), CHL (10.19%), CAZ (8.92%) and CN (6.37%) were higher than the rate previously reported from captive musk deer in Sichuan, China (TE, 20.34%; KZ, 8.47%, ATM, 1.69%; CHL, 6.78%; CAZ, 1.69% and CN, 5.08%) [29]. This implied the antimicrobial resistance rate of E. coli in musk deer has increased [30, 31]. It is worth noting that our results showed that 85.53% of E. coli are resistant to RL, but two farms have not used any sulfonamides in recent years. This also suggests that there are more complex mechanisms for the generation of bacterial drug resistance in addition to antibiotic pressure [32, 33]. The rate of MDR from Barkam is higher than that from Dujiang Yan, indicated antibiotic resistant in Barkam is more severe and more caution should be exercised when choosing antibiotics. The antibiotic resistance rates of Barkam to TE, KZ, CXM, SAM and CIP are significantly higher than that from Dujiang Yan, which may relate to different living environments [34, 35].
The expression of antibiotic resistance genes is an important mechanism of antimicrobial resistance [36]. In our study, 11 ARGs were detected and the most prevalent ARG was blaTEM (91.72%), the occurrence of which is higher than that from another study on musk deer (30.51%) [29]. However, the detection rate of another ESBL-encoding gene blaCTX-M (16.56%) in our present study is lower than the previous result (35.59%) [29]. As important ESBL-encoding genes, blaTEM and blaCTX-M were both detected in E. coli implied feces excretion from musk deer posed a potential harm to environmental safety [37]. The prevalence of tetB (7.01%) and sul3 (10.83%) from musk deer in our study were higher than the prevalence previously reported from other deer in Northeastern China [38]. Moreover, aac(3’)-IId (60.51%), aac(6’)-Ib (8.28%) and qnrA (1.27%) genes were firstly detected in E. coli from musk deer. The above results suggest the carried rate of ARGs in musk deer are increasing. ARGs carried in clinically healthy animal (non-human primates, giant pandas and waterfowl birds) pose a potential threat to the surrounding environment [16, 39, 40]. Our results showed that musk deer carried 11 kinds of ARGs and the surrounding environment was a potential threat by feces of musk deer, suggesting that the feces should be disinfected to reduce the environmental pollution caused by antibiotic-resistant E. coli. High prevalence of ARGs implied that E. coli from musk deer is a reservoir of ARGs, and continuously monitoring the occurrence rate of ARGs in E. coli from musk deer is needed in future.
Previous studies have shown that an association exist between AMR and ARGs in E. coli [41–43]. Our result showed only positive associations (OR > 1) were observed between ARGs and AMRs, no negative associations were observed. This is similar to the another report, where only positive associations between AMRs and ARGs in Urinary tract patient were detected [44]. Our study showed the AMR-ARG pair with the strongest positive association was CHL/floR (OR, 301.167; 95% CI, 46.078–1968.425). This is consistent with the results of E. coli from pigs, since chloramphenicol is positively associated with the corresponding AGRs [45]. Although 9 pairs of AMRs and ARGs showed positive associations in our result, the antibiotic resistance phenotypes did not completely match the ARGs, which is similar to the findings from previous studies [46–48]. In general, the antibiotic resistant phenotype of bacteria is determined by its ARGs [49–51]. In our study, antibiotic resistant phenotype was not completely consistent to the ARGs detected. The reason may relate to the expression level of ARGs, which may not be high enough to exert drug resistance [52]. Moreover, our present study using PCR to detect ARGs, not using whole gene sequencing, which may underestimate the detection rate of ARGs.
Previous studies showed integron plays a vital role in the dissemination of ARGs [30, 53, 54). In our results, class 1 and class 2 integrons were all detected from musk deer, while class 3 integron was not detected. Class 1 integron (10.19%) was more prevalent compared with class 2 integron (1.27%), which is similar to previous reports [55–57). Gene cassette that harbored in integrons-positive isolates is an important media to spread ARGs to the environment [58, 59]. The distribution rate of integron (10.82%) from musk deer in our study is lower than that in other captive animals, such as little penguins (44.70%), Australian sea lion (50.00%) and giant panda (35.71%) [56, 60–62]. Our result showed only dfrA17-aadA5 gene cassettes arrays were detected in class 1 integron-positive isolates. Trimethoprim resistance gene (dfrA17) and aminoglycoside resistance gene (aadA5) was observed for the first time in musk deer in our present study. The type of integron gene cassettes carried by E. coli from forest musk deer are lower than that from other animals, such as giant panda (6 types), yak (11 types) and non-human primates (18 types) [16, 25, 63). The results showed that there were a few kinds of integrons and gene cassettes carried by intestinal E. coli from forest musk deer. Positive results of class 1 and class 2 integrons detected in E. coli from forest musk deer implied drug resistance and horizontal transfer of ARGs cannot be ignored.
5. Conclusion
This is the first study detected the prevalence of antimicrobial resistance, antibiotic resistance genes and integron genes cassettes in E. coli obtained from fecal of musk deer. Positive associations were more common observed among E. coli strains carrying antibiotic resistance genes and antimicrobial resistance. Our results implied musk deer might act as an important reservoir of ARGs and integrons, which may spread into the natural environment and accompanying animals around musk deer.
Supporting information
S1 Table. Resistance profile and integron from musk deer.
https://doi.org/10.1371/journal.pone.0289028.s001
(XLS)
References
- 1. Jiang F, Zhang J, Gao H, Cai Z, Zhou X, Li S, et al. Musk deer (Moschus spp.) face redistribution to higher elevations and latitudes under climate change in China. Sci Total Environ. 2020;704:135335. pmid:31784177
- 2. Yang W, Wang WY, Zhao W, Cheng JG, Wang Y, Yao XP, et al. Preliminary study on the role of novel LysR family gene kp05372 in Klebsiella pneumoniae of forest musk deer. J ZHEJIANG UNIV-SC B. 2020;21(2):137–54.
- 3. Wang Q, Liu X, Li Y, Xin L, Zhou X, Yu F, et al. Genetic diversity of Blastocystis subtypes in the Alpine musk deer (Moschus chrysogaster) in Gansu province, northwestern China. J EUKARYOT MICROBIOL. 2022:e12910. pmid:35325495
- 4. Yasir M, Qureshi AK, Kensarah EA, Bibi F, Al-Zahrani IA, Ghany MAE, et al. Draft genome sequence of colistin-resistant and ESBL-producing multidrug-resistant Escherichia coli isolated from poultry meat. J GLOB ANTIMICROB RE. 2021.
- 5. Tunyong W, Arsheewa W, Santajit S, Kong-Ngoen T, Pumirat P, Sookrung N, et al. Antibiotic Resistance Genes Among Carbapenem-resistant Enterobacterales (CRE) Isolates of Prapokklao Hospital, Chanthaburi Province, Thailand. INFECT DRUG RESIST. 2021;14:3485–94. pmid:34511940
- 6. Zhang S, Abbas M, Rehman MU, Huang Y, Zhou R, Gong S, et al. Dissemination of antibiotic resistance genes (ARGs) via integrons in Escherichia coli: A risk to human health. ENVIRON POLLUT. 2020;266(Pt 2):115260. pmid:32717638
- 7. Leekitcharoenphon P, Johansson MHK, Munk P, Malorny B, Skarzynska M, Wadepohl K, et al. Genomic evolution of antimicrobial resistance in Escherichia coli. SCI REP-UK. 2021;11(1):15108. pmid:34301966
- 8. Nowaczek A, Dec M, Stępień-Pyśniak D, Urban-Chmiel R, Marek A, Różański P. Antibiotic Resistance and Virulence Profiles of Escherichia coli Strains Isolated from Wild Birds in Poland. Pathogens (Basel, Switzerland). 2021;10(8). pmid:34451523
- 9. Nadella RK, Panda SK, Badireddy MR, Kurcheti PP, Raman RP, Mothadaka MP. Multi-drug resistance, integron and transposon-mediated gene transfer in heterotrophic bacteria from Penaeus vannamei and its culture environment. Environ Sci Pollut Res Int. 2022. pmid:35066837
- 10. Zhang S, Yang H, Rehman MU, Yang K, Dong M, Yang J, et al. Class 1 integrons as predominant carriers in Escherichia coli isolates from waterfowls in Hainan, China. Ecotoxicol Environ Saf. 2019;183:109514. pmid:31394374
- 11. Weiss D, Wallace RM, Rwego IB, Gillespie TR, Chapman CA, Singer RS, et al. Antibiotic-Resistant Escherichia coli and Class 1 Integrons in Humans, Domestic Animals, and Wild Primates in Rural Uganda. APPL ENVIRON MICROB. 2018;84(21). pmid:30171005
- 12. Tang B, Ma Y, He X, Zhou Q, Chang J, Qian M, et al. Similar Antimicrobial Resistance of Escherichia coli Strains Isolated from Retail Chickens and Poultry Farms. FOODBORNE PATHOG DIS. 2021;18(7):489–96. pmid:34037429
- 13. Laconi A, Tolosi R, Mughini-Gras L, Mazzuccato M, Ferrè N, Capolongo F, et al. Beehive products as bioindicators of antimicrobial resistance contamination in the environment. Sci Total Environ. 2021:151131. pmid:34695463
- 14. Kim H, Kim YA, Seo YH, Lee H, Lee K. Prevalence and Molecular Epidemiology of Extended-Spectrum-β-Lactamase (ESBL)-Producing Escherichia coli from Multiple Sectors of Poultry Industry in Korea. Antibiotics-Basel. 2021;10(9).
- 15. Luiken RE, Heederik DJ, Scherpenisse P, Van Gompel L, van Heijnsbergen E, Greve GD, et al. Determinants for antimicrobial resistance genes in farm dust on 333 poultry and pig farms in nine European countries. ENVIRON RES. 2022;208:112715. pmid:35033551
- 16. Zhu Z, Jiang S, Qi M, Liu H, Zhang S, Liu H, et al. Prevalence and characterization of antibiotic resistance genes and integrons in Escherichia coli isolates from captive non-human primates of 13 zoos in China. SCI TOTAL ENVIRON. 2021;798:149268. pmid:34333432
- 17. Zhang S, Chen S, Abbas M, Wang M, Jia R, Chen S, et al. High incidence of multi-drug resistance and heterogeneity of mobile genetic elements in Escherichia coli isolates from diseased ducks in Sichuan province of China. Ecotoxicol Environ Saf. 2021;222:112475. pmid:34243112
- 18.
CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 29th edition. Clinical and Labora tory Standards Institute (CLSI), M100.
- 19. Luo X, Wang P, Cheng JG, Luo Y, Dai L, Zhou X, et al. Characterization of Virulence Genes and Antimicrobial Resistance of Lung Pathogenic Escherichia Coli Isolates in Forest Musk Deer (Moschus Berezovskii). J Zoo Wildl Med. 2016;47(2):540–50. pmid:27468027
- 20. Tamamura-Andoh Y, Tanaka N, Sato K, Mizuno Y, Arai N, Watanabe-Yanai A, et al. A survey of antimicrobial resistance in Escherichia coli isolated from wild sika deer (Cervus nippon) in Japan. J Vet Med Sci. 2021;83(5):754–8. pmid:33692233
- 21. Yang Y, Ashworth AJ, Willett C, Cook K, Upadhyay A, Owens PR, et al. Review of Antibiotic Resistance, Ecology, Dissemination, and Mitigation in U.S. Broiler Poultry Systems. FRONT MICROBIOL. 2019;10:2639. pmid:31803164
- 22. Yu B, Zhang Y, Yang L, Xu J, Bu S. Analysis of antibiotic resistance phenotypes and genes of Escherichia coli from healthy swine in Guizhou, China. ONDERSTEPOORT J VET. 2021;88(1):e1–e8. pmid:33764151
- 23. Smith S, Wang J, Fanning S, McMahon BJ. Antimicrobial resistant bacteria in wild mammals and birds: a coincidence or cause for concern? IRISH VET J. 2014;67(1):8. pmid:24795805
- 24. Carroll D, Wang J, Fanning S, McMahon BJ. Antimicrobial Resistance in Wildlife: Implications for Public Health. ZOONOSES PUBLIC HLTH. 2015;62(7):534–42. pmid:25639901
- 25. Zou W, Li C, Yang X, Wang Y, Cheng G, Zeng J, et al. Frequency of antimicrobial resistance and integron gene cassettes in Escherichia coli isolated from giant pandas (Ailuropoda melanoleuca) in China. Microb Pathog. 2018;116:173–9. pmid:29414607
- 26. Sarker MS, Ahad A, Ghosh SK, Mannan MS, Sen A, Islam S, et al. Antibiotic-resistant Escherichia coli in deer and nearby water sources at Safari parks in Bangladesh. Vet World. 2019;12(10):1578–83. pmid:31849419
- 27. de Lagarde M, Fairbrother JM, Archambault M, Dufour S, Francoz D, Massé J, et al. Impact of a Regulation Restricting Critical Antimicrobial Usage on Prevalence of Antimicrobial Resistance in Escherichia coli Isolates From Fecal and Manure Pit Samples on Dairy Farms in Québec, Canada. FRONT VET SCI. 2022;9:838498.
- 28. Lugsomya K, Chatsuwan T, Niyomtham W, Tummaruk P, Hampson DJ, Prapasarakul N. Routine Prophylactic Antimicrobial Use Is Associated with Increased Phenotypic and Genotypic Resistance in Commensal Escherichia coli Isolates Recovered from Healthy Fattening Pigs on Farms in Thailand. MICROB DRUG RESIST. 2018;24(2):213–23. pmid:28604274
- 29. Li Y. Isolation and identification of Escherichia coli from intestinal and enclosure soil of musk deer and detection of its antibiotic resistance gene. Acta Agriculturae Boreali-Occidentalis Sinica. 2020;29:1492–501.
- 30. Che Y, Yang Y, Xu X, Břinda K, Polz MF, Hanage WP, et al. Conjugative plasmids interact with insertion sequences to shape the horizontal transfer of antimicrobial resistance genes. PNAS. 2021;118(6). pmid:33526659
- 31. Tarabai H, Wyrsch ER, Bitar I, Dolejska M, Djordjevic SP. Epidemic HI2 Plasmids Mobilising the Carbapenemase Gene bla(IMP-4) in Australian Clinical Samples Identified in Multiple Sublineages of Escherichia coli ST216 Colonising Silver Gulls. Microorganisms. 2021;9(3). pmid:33801844
- 32. Milano A, Sulejmani A, Intra J, Sala MR, Leoni V, Carcione D. Antimicrobial Resistance Trends of Escherichia coli Isolates from Outpatient and Inpatient Urinary Infections over a 20-Year Period. MICROB DRUG RESIST. 2021.
- 33. Wang H, Wang H, Yu X, Zhou H, Li B, Chen G, et al. Impact of antimicrobial stewardship managed by clinical pharmacists on antibiotic use and drug resistance in a Chinese hospital, 2010–2016: a retrospective observational study. BMJ open. 2019;9(8):e026072. pmid:31377693
- 34. Adams RJ, Kim SS, Mollenkopf DF, Mathys DA, Schuenemann GM, Daniels JB, et al. Antimicrobial-resistant Enterobacteriaceae recovered from companion animal and livestock environments. ZOONOSES PUBLIC HLTH. 2018;65(5):519–27. pmid:29575700
- 35. Nweze JA, Mbaoji FN, Huang G, Li Y, Yang L, Zhang Y, et al. Antibiotics Development and the Potentials of Marine-Derived Compounds to Stem the Tide of Multidrug-Resistant Pathogenic Bacteria, Fungi, and Protozoa. MAR DRUGS. 2020;18(3). pmid:32121196
- 36. Zhang T, Lv K, Lu Q, Wang L, Liu X. Removal of antibiotic-resistant genes during drinking water treatment: A review. J ENVIRON SCI (China). 2021;104:415–29. pmid:33985744
- 37. Dirar MH, Bilal NE, Ibrahim ME, Hamid ME. Prevalence of extended-spectrum β-lactamase (ESBL) and molecular detection of blaTEM, blaSHV and blaCTX-M genotypes among Enterobacteriaceae isolates from patients in Khartoum, Sudan. PAN AFR MED J. 2020;37:213.
- 38. Li R, He L, Hao L, Wang Q, Zhou Y, Jiang H. Genotypic and phenotypic characterization of antimicrobial-resistant Escherichia coli from farm-raised diarrheic sika deer in Northeastern China. PLoS One. 2013;8(9):e73342. pmid:24039919
- 39. Yang H, Rehman MU, Zhang S, Yang J, Li Y, Gao J, et al. High prevalence of CTX-M belonging to ST410 and ST889 among ESBL producing E. coli isolates from waterfowl birds in China’s tropical island, Hainan. Acta tropica. 2019;194:30–5. pmid:30853356
- 40. Fan S, Jiang S, Luo L, Zhou Z, Wang L, Huang X, et al. Antibiotic-Resistant Escherichia coli Strains Isolated from Captive Giant Pandas: A Reservoir of Antibiotic Resistance Genes and Virulence-Associated Genes. Veterinary sciences. 2022;9(12). pmid:36548866
- 41. Li X, Stokholm J, Brejnrod A, Vestergaard GA, Russel J, Trivedi U, et al. The infant gut resistome associates with E. coli, environmental exposures, gut microbiome maturity, and asthma-associated bacterial composition. Cell host & microbe. 2021;29(6):975–87.e4.
- 42. Khezri A, Avershina E, Ahmad R. Plasmid Identification and Plasmid-Mediated Antimicrobial Gene Detection in Norwegian Isolates. Microorganisms. 2020;9(1). pmid:33375502
- 43. Jarocki VM, Reid CJ, Chapman TA, Djordjevic SP. Escherichia coli ST302: Genomic Analysis of Virulence Potential and Antimicrobial Resistance Mediated by Mobile Genetic Elements. FRONT MICROBIOL. 2019;10:3098. pmid:32063891
- 44. Rahman MM, Hossain MMK, Rubaya R, Halder J, Karim ME, Bhuiya AA, et al. Association of Antibiotic Resistance Traits in Uropathogenic Escherichia coli (UPEC) Isolates. Can J Infect Dis Med Microbiol. 2022;2022:4251486. pmid:35340918
- 45. Rosengren LB, Waldner CL, Reid-Smith RJ. Associations between antimicrobial resistance phenotypes, antimicrobial resistance genes, and virulence genes of fecal Escherichia coli isolates from healthy grow-finish pigs. APPL ENVIRON MICROB. 2009;75(5):1373–80. pmid:19139228
- 46. Liu X, Boothe DM, Thungrat K, Aly S. Mechanisms accounting for fluoroquinolone multidrug resistance Escherichia coli isolated from companion animals. VET MICROBIOL. 2012;161(1–2):159–68. pmid:22877517
- 47. Fukuda A, Usui M, Okamura M, Dong-Liang H, Tamura Y. Role of Flies in the Maintenance of Antimicrobial Resistance in Farm Environments. MICROB DRUG RESIST. 2019;25(1):127–32. pmid:29708845
- 48. Furlan JPR, da Silva Ferreira ME, Stehling EG. Genetic Diversity of Multidrug-Resistant CMY-Producing Escherichia coli from Feces and Soil in a Small-Scale Pig Farm. MICROB DRUG RESIST. 2020;26(11):1365–71. pmid:32379997
- 49. Laconi A, Mughini-Gras L, Tolosi R, Grilli G, Trocino A, Carraro L, et al. Microbial community composition and antimicrobial resistance in agricultural soils fertilized with livestock manure from conventional farming in Northern Italy. Sci Total Environ. 2021;760:143404. pmid:33199005
- 50. Park SY, Lee K, Cho Y, Lim SR, Kwon H, Han JE, et al. Emergence of Third-Generation Cephalosporin-Resistant Morganella morganii in a Captive Breeding Dolphin in South Korea. ANIMALS-BASEL. 2020;10(11).
- 51. Bich VTN, Thanh LV, Thai PD, Van Phuong TT, Oomen M, Driessen C, et al. An exploration of the gut and environmental resistome in a community in northern Vietnam in relation to antibiotic use. ANTIMICROB RESIST IN. 2019;8:194.
- 52. Batalha de Jesus AA, Freitas AAR, de Souza JC, Martins N, Botelho LAB, Girao VBC, et al. High-Level Multidrug-Resistant Escherichia coli Isolates from Wild Birds in a Large Urban Environment. Microbial drug resistance (Larchmont, NY). 2019;25(2):167–72.
- 53. Sabbagh P, Rajabnia M, Maali A, Ferdosi-Shahandashti E. Integron and its role in antimicrobial resistance: A literature review on some bacterial pathogens. IRAN J BASIC MED SCI. 2021;24(2):136–42. pmid:33953851
- 54. Chainier D, Barraud O, Masson G, Couve-Deacon E, François B, Couquet CY, et al. Integron Digestive Carriage in Human and Cattle: A "One Health" Cultivation-Independent Approach. FRONT MICROBIOL. 2017;8:1891. pmid:29021787
- 55. Sharifi H, Pouladfar G, Shakibaie MR, Pourabbas B, Mardaneh J, Mansouri S. Prevalence of β-lactamase genes, class 1 integrons, major virulence factors and clonal relationships of multidrug-resistant Pseudomonas aeruginosa isolated from hospitalized patients in southeast of Iran. IRAN J BASIC MED SCI. 2019;22(7):806–12.
- 56. Zhu Z, Pan S, Wei B, Liu H, Zhou Z, Huang X, et al. High prevalence of multi-drug resistances and diversity of mobile genetic elements in Escherichia coli isolates from captive giant pandas. Ecotoxicol Environ Saf. 2020;198:110681. pmid:32361498
- 57. Racewicz P, Majewski M, Biesiada H, Nowaczewski S, Wilczyński J, Wystalska D, et al. Prevalence and characterisation of antimicrobial resistance genes and class 1 and 2 integrons in multiresistant Escherichia coli isolated from poultry production. SCI REP-UK. 2022;12(1):6062. pmid:35410349
- 58. Dong P, Cui Q, Fang T, Huang Y, Wang H. Occurrence of antibiotic resistance genes and bacterial pathogens in water and sediment in urban recreational water. J ENVIRON SCI (China). 2019;77:65–74. pmid:30573107
- 59. Pérez-Etayo L, Berzosa M, González D, Vitas AI. Prevalence of Integrons and Insertion Sequences in ESBL-Producing E. coli Isolated from Different Sources in Navarra, Spain. Int J Environ Res Public Health. 2018;15(10). pmid:30347800
- 60. Massella E, Reid CJ, Cummins ML, Anantanawat K, Zingali T, Serraino A, et al. Snapshot Study of Whole Genome Sequences of Escherichia coli from Healthy Companion Animals, Livestock, Wildlife, Humans and Food in Italy. Antibiotics (Basel, Switzerland). 2020;9(11). pmid:33172096
- 61. Lundback IC, McDougall FK, Dann P, Slip DJ, Gray R, Power ML. Into the sea: Antimicrobial resistance determinants in the microbiota of little penguins (Eudyptula minor). Infect Genet Evol. 2021;88:104697. pmid:33370595
- 62. Delport TC, Harcourt RG, Beaumont LJ, Webster KN, Power ML. Molecular Detection of Antibiotic-Resistance Determinants in Escherichia Coli Isolated from the Endangered Australian Sea Lion (Neophoca Cinerea). J WILDLIFE DIS. 2015;51(3):555–63. pmid:25919463
- 63. Yang X, Zou W, Zeng J, Xie S, An T, Luo X, et al. Prevalence of antimicrobial resistance and integron gene cassettes in Escherichia coli isolated from yaks (Poephagus grunniens) in Aba Tibetan Autonomous Prefecture, China. Microb Pathog. 2017;111:274–9. pmid:28888884