Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Peer-reviewed

Research Article

miR-4482 and miR-3912 aim for 3ʹUTR of ERG mRNA in prostate cancer

Abstract

Ets-related gene (ERG) is overexpressed as a fusion protein in prostate cancer. During metastasis, the pathological role of ERG is associated with cell proliferation, invasion, and angiogenesis. Here, we hypothesized that miRNAs regulate ERG expression through its 3ʹUTR. Several bioinformatics tools were used to identify miRNAs and their binding sites on 3ʹUTR of ERG. The selected miRNAs expression was analyzed in prostate cancer samples by qPCR. The miRNAs overexpression was induced in prostate cancer cells (VCaP) to analyze ERG expression. Reporter gene assay was performed to evaluate the ERG activity in response to selected miRNAs. The expression of ERG downstream target genes was also investigated through qPCR after miRNAs overexpression. To observe the effects of selected miRNAs on cell proliferation and migration, scratch assay was performed to calculate the cell migration rate. miR-4482 and miR-3912 were selected from bioinformatics databases. miR-4482 and -3912 expression were decreased in prostate cancer samples, as compared to controls (p<0.05 and p<0.001), respectively. Overexpression of miR-4482 and miR-3912 significantly reduced ERG mRNA (p<0.001 and p<0.01), respectively) and protein (p<0.01) in prostate cancer cells. The transcriptional activity of ERG was significantly reduced (p<0.01) in response to miR-4482 and-3912. ERG angiogenic targets and cell migration rate was also reduced significantly (p<0.001) after miR-4482 and -3912 over-expression. This study indicates that miR-4482 and -3912 can suppress the ERG expression and its target genes, thereby, halt prostate cancer progression. These miRNAs may be employed as a potential therapeutic target for the miRNA-based therapy against prostate cancer.

Citation: Mumtaz S, Usman Rashid M, Khan RU, Malkani N (2023) miR-4482 and miR-3912 aim for 3ʹUTR of ERG mRNA in prostate cancer. PLoS ONE 18(6): e0286996. https://doi.org/10.1371/journal.pone.0286996

Editor: Abdul Qadir Syed, Northwest University, UNITED STATES

Received: January 20, 2023; Accepted: May 29, 2023; Published: June 13, 2023

Copyright: © 2023 Mumtaz et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the paper.

Funding: The author(s) received no specific funding for this work.

Competing interests: The authors have declared that no competing interests exist.

Introduction

ETS-related gene (ERG) is a member of the E-26 transformation specific (ETS) family of transcription factors. It was mapped on chromosome 21 (21q22.2). It encodes a 54 kDa (kilo Dalton) protein (P11308) [1]. ETS proteins are nuclear DNA-binding phosphoproteins that act as activators or repressors of transcription [2]. ERG is expressed in endothelial cells (ECs) [3], particularly in the blood vessels surrounding the neural tube [4], heart vasculature, and the pre-cartilage [5]. It plays a key role in the regulation of tissue-specific processes such as haematopoiesis, vascular inflammation, and angiogenesis [6], by regulating the WNT/β-catenin signaling pathway and the transcriptional control of EC-specific genes including angiopoietin 2, endoglin, von Willebrand factor (vWF), VEGF-A [7] and VE-cadherin [8]. ERG expression increases in various carcinomas and leads to angiogenesis and primary drug resistance [9].

Prostate cancer is the second most common cancer among elderly males worldwide, accounting for 1,414,259 new cases and 375,304 deaths in 2020 [10]. It is a recurrent cancer with high mortality among males worldwide [11]. The majority of these patients are diagnosed with elevated levels of prostate-specific antigen. However, a tissue biopsy is required to confirm this malignancy [10]. The treatment strategy of this cancer includes surveillance, prostatectomy, radiotherapy and hormone therapy [12]. The role of ERG in prostate cancer is well characterized. It is involved in prostate intraepithelial neoplasia, invasion, and metastasis [13]. The up-regulation of ERG is observed in >50% of prostate cancer cases, due to a genetic fusion between trans-membrane serine protease 2 (TMPRSS2) and ERG [14]. This gene fusion activates the ERG oncogenic pathway, which contributes to the disease progression. The ERG rearrangements are reported in 23 of 29 prostate cancer samples. Cell culture experiments revealed that the TMPRSS2 androgen-responsive promoter elements mediate the overexpression of ETS in prostate cancer [13].

Altered gene expression is crucial for the maintenance of a disease condition as it changes the overall cellular functions. Gene expression is affected in the cell due to several post-transcriptional modifications. 3ʹ untranslated regions (3ʹUTR) are the mRNA sites that have regulatory elements such as microRNA response elements (MREs), AU-rich elements (AREs), and poly(A) tail [15]. MREs are the sequences where microRNAs (miRNA) bind through their seed sequences and result in the mRNA translational repression. miRNAs are small non-coding RNAs involved in regulating several physiological conditions. The consequences of miRNA binding to 3ʹUTR are the transformed biological pathways resulting in the proliferation, differentiation, and apoptosis of cells [16]. However, miRNA expression dysregulation has been reported in cancers due to deletion, insertion, translocation, or amplification of miRNA genes, loss or defects in miRNA biogenesis, and epigenetic changes. This results in aberrant expression of target gene mRNA which in return causes abnormal cellular processes leading to disease progression [17].

In prostate cancer, several miRNAs regulate the ERG expression such as miR-9 [18], miR-26, miR-182, miR-200b [19], and miR-221 [20]. The change in ERG expression due to these miRNAs leads to irregular apoptosis and cell proliferation. In the current study, we employed bioinformatics prediction tools to identify the potential miRNAs against the 3ʹUTR of ERG. The identified miRNAs were tested in various assays to understand their effects on the ERG expression and targeted processes.

Material and methods

Selection of miRNAs for ERG mRNA

To predict miRNAs binding to 3ʹUTR of ERG, miRDB (http://www.mirdb.org/cgi-bin/search_custom.cgi), miRBase (http://www.mirbase.org/), TargetScan (http://www.targetscan.org/vert_72/) and miRWalk (http://zmf.umm.uni-heidelberg.de/apps/zmf/mirwalk2/) were used. The miRNAs with the highest prediction score (≥ 95) and minimum free energy (MFE) (≈ -25KJ/mol) were selected.

Acquisition of prostate cancer samples and controls

Formalin-fixed paraffin-embedded (FFPE) tissues of prostate cancer samples (n = 25) and controls (n = 20) were collected in thin slices (20μm micron) from the department of pathology, Shaukat Khanum Memorial Cancer Hospital and Research Centre (SKMCH&RC), Lahore, Pakistan. The tissue adjacent to the prostate tumor without any malignancy was considered as control. A qualified pathologist reviewed all slides to identify prostate cancer foci and adjacent normal glandular epithelium.

Ethical approval and consent

The study was approved by Institutional Review Board (IRB) of the SKMCH&RC, Lahore, Pakistan via letter No. EX-05-03-19-04. As the study was retrospective and patient identity was kept confidential by the hospital therefore no verbal or written consent was required.

Cell culture

Epithelial cells of human prostate cancer (VCaP) were cultured and propagated in Dulbecco’s modified MEM medium (DMEM) (Cat#D5648, Sigma-Aldrich, Taufkirchen, Germany) supplemented with penicillin (100 units/mL), streptomycin (100 μg/mL) (Cat#P4333, Sigma-Aldrich, Taufkirchen, Germany), and 10% fetal bovine serum (FBS) (Cat#FBS-22A, Capricorn scientific, Ebsdorfergrund, Germany) with 5% CO2 at 37°C. Human Vascular Endothelial Cells (HUVEC) were isolated and cultured in M199 medium having 10%FBS and endothelial growth factors.

Expression plasmids and transfections

The expression plasmids of miR-4482 and miR-3912 were constructed from the seed sequences (miR-4482: UUUCUAUUUCUCAGUGGGGCUC; miR-3912: AUGUCCAUAUUAUGGGUUAGU) in the pEGFP-C1 vector (6084–1, Clontech, USA Takara Bio USA, Inc). Following primers were used to PCR amplify from human genomic DNA.

  1. miR-4482-F: 5’-TCGAAAGCTTGCTGAATCGGAAATGCAGCG-3’ (HindIII)
  2. miR-4482-R: 5’-AGCTGGATCCTCCTCCTTCTTTCATTTCC-3’ (BamHI)
  3. miR-3912-F: 5’-TCGACTCGAGCATTCCTCCTGAAAGAAAGC-3’ (XhoI)
  4. miR-3912-R: 5’-AGTTGGATCCCAGCACTTTGGAAGGCAGAG-3’ (BamHI)

These primers with specific restriction sites were designed by retrieving sequences of precursor miRNA from Ensembl (http://ensembl.org). The amplified PCR product resulted into the inserts of 618 bp and 625 bp for miR-4482 and miR-3912, respectively. The product was gel purified, followed by restriction-enzyme digestion of inserts as well as CMV-eGFP vector and ligation. The ligation mixture was transformed into DH5α cells (chemically competent) and the resultant clones were tested by restriction analysis and sequencing. The positive clones were then selected for further experiments.

1kb of 3ʹUTR (GenBank accession number NG_029732) of wild-type ERG cloned into pMIR-RNL-TK was generously provided by Prof. Sven Wach [21]. All transient transfections were carried out using Turbofect (Cat#R0531, Thermoscientific, USA) according to manufacturer’s protocol.

Quantitative real-time PCR

Quantitative real-time PCR (qRT-PCR) was performed to identify the mRNA expression of ERG, its downstream target genes, and miRNA. Appropriate plasmids were transfected into VCaP or HUVEC, harvested after 48h and total RNA were isolated using TRIzol [22]. Similarly, the FFPE samples of prostate cancer and controls were proceeded for RNA extraction using the method described by Ma et al., 2009 [23]. 1μg RNA was converted to cDNA from each sample using the cDNA synthesis kit (Cat#K1622, Thermoscientific, USA; Cat#G898, Applied Biological Materials, USA), according to the manufacturer’s protocols. qPCR assay was performed in triplicates using 1μl of each cDNA and a SYBR green master mix (Cat#K0222, Thermo Fisher scientific, USA). The data was processed in LinRegPCR software [24] and the Pfaffl equation [25] was used for calculations. U6 and GAPDH were used for data normalization where appropriate. Following primer sequence were used:

  1. miR-4482: Forward: 5’—GTTGGGTTTCTATTTCTCAGTG - 3’
         Reverse: 5’-GTGCAGGGTCCGAGGT-3’
  2. miR-3912: Forward: 5’-GTTTGGGATGTCCATATTATGG-3’
         Reverse: 5’-GTGCAGGGTCCGAGGT-3’
  3. U6: Forward: 5’-CTCGCTTCGGCAGCACA-3’
      Reverse: 5’-GTGCAGGGTCCGAGGT-3’
  4. GAPDH: Forward: 5’-CCTGTTCGACAGTCAGCCG-3’
          Reverse: 5’-CGACCAAATCCGTTGACTCC-3’
  5. ERG: Forward: 5’-AACGAGCGCAGAGTTATCG-3’
       Reverse: 5’-GTGAGCCTCTGGAAGTCGTC-3’
  6. VE-cad: Forward: 5’-TGTGGGCTCTCTGTTTGTTG-3’
        Reverse: 5’-AATGACCTGGGCTGTGTTTC-3’
  7. FZD4: Forward: 5’-CCTCGGCTACAACGTGACC-3’
        Reverse: 5’-TGCACATTGGCACATAAACAGA-3’
  8. EGFL7: Forward: 5’-TGAATGCAGTGCTAGGAGGG-3’
        Reverse: 5’-GCACACAGAGTGTACCGTCT-3’
  9. VEGF: Forward: 5’-AGGGCAGAATCATCACGAAGT-3’
       Reverse: 5’-TGCCATCCAATCGAGACCCT-3’

Western blotting

VCaPs were seeded in 6-well plate (2x105 cells/well), transfected with miR-4482 (2 μg/well) and miR-3912 (2 μg/well) plasmids using turbofect (5 μl/well). Western blotting was performed to analyze the ERG protein expression. Briefly, after 48 h of transfection, cells were lysed in RIPA buffer on ice followed by centrifugation (14,000g for 15 minutes at 4ºC). Total protein concentration in each sample was measured by Bradford method [26]. Equal amount of total proteins from each sample were loaded onto mini-gels for SDS-PAGE, followed by blotting and detection. ERG primary antibody (Cat#97249, Cell Signaling Technology, Danvers, USA) and Anti-rabbit IgG, HRP linked secondary antibody (Cat#7074, Cell Signaling Technology, Danvers, USA) were used at the final dilution of 1:1000 and 1:10,000, respectively. The blots were visualized by enhanced chemiluminescence, and quantified by ImageJ. β-actin (Cat#8459, Cell Signaling Technology, Danvers, USA) was used as a loading control [27].

Luciferase reporter assay

Reporter gene assay was performed to assess the transcription activity of ERG as a result of miRNAs binding. VCaP cells were transfected in 12-well plates (1x105 cells/well) with a reporter plasmid (ERG3ʹUTR-pMIR-RNL-TK), β-galactosidase and miR-4482 or miR-3912 plasmids in triplicates. The cells were lysed after 24 h of transfection and centrifuged at 14,000rpm for 20 minutes. The supernatant (20 μl) was mixed with assay buffer (50 μl) and luciferin (50 μl) in 96-well plate and luminescence were measured. After measurement of luminescence 50 μl of Chlorophenol-red β-d-galactopyranoside (CPRG) (Cat#59767, Sigma-Aldrich, Taufkirchen, Germany) substrate was added in each well, incubated for 2 minutes and measured at 595 nm. Change in CPRG color from yellow to orange/red indicated the activity of β -galactosidase which was used to normalize the luciferase activity [28].

Scratch assay

The scratch assay was performed to analyze the cell migration. HUVEC were seeded in 12-wells and transfected with miR-4482, miR-3912, and pEGFP-C1 control vectors. A scratch was made in each well with a sterile 20 μl micropipette tip. At the 4 h interval, scratch closure was observed till 48 h. The cell migration was evaluated as the percentage of scratch closure by measuring the difference of cell-free surface of the scratch at various time intervals using ImageJ [27].

Results

miRNAs bind to 3ʹUTR of ERG

The miRDB and TargetScan database analyses showed that the 3′UTR of ERG is a highly ranked potential target of miR-4482 and miR-3912. miR-4482 has two binding sites with a 96-target score and MFE of -25.8KJ/mol. miR-3912 also binds on two sites at 3′UTR with a 95-target score and MFE of -23.5KJ/mol (Fig 1). The miRBase and miRwalk databases did not predict miR-3912 binding to the 3′UTR of ERG. We further explored these miRNAs due to the strong prediction score of miR-4482 and miR-3912 for ERG in the first two databases. A list of other miRNAs predicted by these databases is provided in S1 Table.

thumbnail
Download:
Fig 1. Binding of miR-4482 (-372+, - 445+), and miR-3912(-214+, -565+) at 3′UTR of ERG (3381bp).

https://doi.org/10.1371/journal.pone.0286996.g001

Expression of miR-4482 and miR-3912 in prostate cancer

The miR-4482 and miR-3912 expression was significantly reduced in prostate cancer samples as compared to controls (p < 0.001 and p < 0.05), respectively. All patients with prostate cancer presented with Gleason score of 4/5 (Fig 2a and 2b).

thumbnail
Download:
Fig 2. Expression of miR-4482 (a) and miR-3912 (b) in prostate cancer samples with Gleason score 4/5.

Data expressed as mean ± SEM, *p < 0.05; ***p < 0.001.

https://doi.org/10.1371/journal.pone.0286996.g002

Ectopic expression of selected miRs influences ERG expression

VCaPs were separately transfected with miR-4482 and miR-3912, and the ERG expression was analyzed 48 h after transfection in comparison to control cells. The ERG expression of ERG mRNA and protein was significantly reduced (p < 0.001 and p < 0.01) in response to miR-4482 and miR-3912, respectively (Fig 3a and 3b).

thumbnail
Download:
Fig 3. Ectopic expression of miR-4482 and miR-3912 (a) reduced ERG mRNA expression relative to GAPDH (b) and ERG Protein expression relative to β-actin (c).

Data expressed as mean ± SEM, **p < 0.01; ***p < 0.001.

https://doi.org/10.1371/journal.pone.0286996.g003

miRs regulates ERG transcription at 3′UTR

To determine whether miR-4482 and miR-3912 binding on the 3′UTR of ERG affect the transcription activity of ERG, a luciferase reporter assay was performed with pMIR-RNL-TK-3′UTR ERG, co-expressed with β-galactosidase plasmid and miR-4482 or miR-3912 in VCaP cells. Cells transfected with miR-4482 or miR-3912 showed significantly reduced reporter gene activity (p < 0.01). Appropriate transfection control was used for comparison (Fig 4).

thumbnail
Download:
Fig 4. Luciferase reporter gene assay in VCaP cells with 3′UTR of ERG co-expressed with miR-4482 or miR-3912 showed reduced transcriptional activity of ERG.

n = 3. Data expressed as mean ± SEM, **p < 0.01.

https://doi.org/10.1371/journal.pone.0286996.g004

Ectopic expression of miRs affect ERG target genes

To determine the ERG target genes expression, HUVEC were transfected with miR-4482 and miR-3912 using electroporation [29]. After 48 h cells were lysed and proceeded for mRNA detection through qPCR. The ERG target genes were significantly reduced in miRs transfected cells as compared to control cells (p<0.001). GAPDH was used for normalization (Fig 5).

thumbnail
Download:
Fig 5. mRNA expression of ERG targets genes altered in miR-4482 and miR-3912 transfected HUVEC.

Data expressed as mean ± SEM, *** p < 0.001.

https://doi.org/10.1371/journal.pone.0286996.g005

miRs mediated suppression of cell migration

A scratch assay was performed to evaluate the miR-4482 and miR-3912 effect on cell migration. HUVEC were independently transfected with miR-4482 and miR-3912. miRs transfected cells showed reduced migration rate in comparison to control cells (GFP transfected). Cell migration and proliferation were observed for 48 h after applying the scratch. In control cells, the cell-free area was closed within 48 h, while in miR-4482 and miR-3912 transfected cells a gap was still visible after 48 h. The cell-free area was quantified over time and expressed as a percentage of the initial scratch area (Fig 6).

thumbnail
Download:
Fig 6. HUVEC transfected with miR-4482 and miR-3912 reduced the migration of cells.

n = 3 Data expressed as percentage of cell free area. Data expressed as mean ± SEM, *p < 0.05, **p < 0.01, *** p < 0.001.

https://doi.org/10.1371/journal.pone.0286996.g006

Discussion

ERG is a transcription factor with diverse functions in endothelium and several malignancies including prostate cancer. In prostate cancer, ERG overexpression leads to ductal dysplasia, PIN [30] metastasis, and advanced disease which may be related to the role of ERG in promoting angiogenesis. The ERG overexpression leads to increased cell proliferation, and invasion. ERG also modifies prostate epithelium by repressing epithelium-specific genes such as Prostein and Prostate Specific Antigen [31]. The molecular crosstalk between ERG and androgen receptor (AR) has implications in the complex network of prostate cancer signaling pathways [32]. Based on these varied consequences of ERG overexpression, it is logical to use therapeutic agents that can target ERG in prostate cancer. In this regard, miRNAs can present significant prospects. Previously, miR-145 and miR-196 expressions are shown to downregulate ERG expression in prostate cancer [33] and leukemia, respectively [20]. In the current study, we have identified two miRNAs (miR-4482 and miR-3912) which efficiently targeted the 3ʹUTR of ERG and resulted in the decreased expression of ERG mRNA and protein. ERG downstream gene targets expression was also decreased and hence the transcription and migration functions related to ERG were modulated in response to the miRs binding. These results showed that ERG function was modulated as miRs bind to its mRNA, thereby supporting the notion that these miRNAs can be used as therapeutic agents to modulate ERG functions in prostate cancer.

In the current study, miR-4482 and miR-3912 expression in prostate cancer samples was significantly decreased as compared to the controls. The bioinformatics databases revealed that both these miRNAs have high potential to bind to the 3ʹUTR of ERG mRNA. In-vitro assays further confirmed that this binding influences ERG expression. Moreover, ERG mRNA and protein were significantly reduced in prostate cancer cells (VCaP). The reduced transcription activity of ERG as a result might help to reduce inflammation in the prostate. The downregulation of ERG influenced the ERG functions by downregulating its target gene expression involved in cell migration and adhesion (Fig 5).

miR-4482 has been previously reported to have differential expression in several diseases such as pediatric embryonal central nervous system neoplasms [34], immune thrombocytopenia [35, 36], and infections [37]. Similarly, miR-3912 is differentially expressed in papillary thyroid cancer patients [38] and pediatric embryonal central nervous system neoplasms [34]. It is shown to bind to 3ʹUTR of NEIL2 (Nei Like DNA Glycosylase 2) to contribute to age related cataracts by interfering with the DNA repair mechanism [39]. Moreover, in esophageal squamous cell carcinoma RALYL (RALY RNA Binding Protein-like) is targeted by miR-3912 to hinder transcriptional and post-transcriptional regulatory processes [40].

In this study, we have shown that miR-4482 and miR-3912 negatively influence the cell migration potential by targeting 3ʹUTR of ERG. Also, the angiogenic target genes of ERG are also down-regulated in response to the over-expression of these miRs. Angiogenesis is a crucial step leading to metastasis and ERG regulates this process by regulating the expression of Ve-cadherin, eNOS, and VEGF [41]. It stabilizes the vasculature and ensures nutrient supply to the growing tumor. ERG inhibition reduced the expression of VE-cadherin and EGFL7 that may result in decreased proliferation and increased apoptosis due to junction instability, hence, inhibit tumor metastasis. Moreover, the downregulation of vascular endothelial growth factor (VEGF), a mediator of angiogenesis, and Frizzled Class Receptor 4 (FZD4), may also contribute to further reducing invasiveness and cancer progression.

miRNAs’ potential to act as therapeutic agents should be further explored as their cellular expression can be regulated to adjust the expression of their gene targets. Several miRNAs are undergoing clinical trials to be designated as anticancer drugs [42]. miR-145 is associated to prostate cancer progression [43] and a therapeutic molecule (MGN-2677) based on miR-145 cluster is in preclinical trials [42]. miR-29b is also known to involve in the suppression of prostate cancer metastasis [44]. The miRNAs regulating ERG expression should be explored and tested for their drug potential in those conditions where aberrant ERG expression of is a major cause. The miR-4482 and miR-3912 can bind to ERG mRNA at definite sequences in 3ʹUTR and may act as potential tumor suppressors.

Conclusion

In conclusion this is the first study investigating that miR-4482 and miR-3912 suppress the ERG expression and its target genes, and thereby halt the prostate cancer progression. 3ʹUTR of ERG plays a significant role in the modulation of ERG expression and function in prostate cancer by providing binding sites to miRNAs. miR-4482 and miR-3912 should be further investigated as potential therapeutic targets for prostate cancer.

Acknowledgments

The authors are thankful to Dr. Johannes Schmid (MUW, Austria) and Dr. Abdul Wajid (VU, Pakistan) for providing laboratory facilities.

References

  1. 1. Reddy ES, Rao VN, Papas TS. The erg gene: a human gene related to the ets oncogene. Proc Natl Acad Sci USA. 1987;84: 6131e5. pmid:3476934
  2. 2. Gutierrez-Hartmann A, Duval DL, Bradford AP. ETS transcription factors in endocrine systems. Trends Endocrinol Metab. 2007;18: 150–158. pmid:17387021
  3. 3. Haber MA, Iranmahboob A, Thomas C, Liu M, Najjar A, Zagzag D. ERG is a novel and reliable marker for endothelial cells in central nervous system tumors. Clin Neuropathol. 2015;34: 117–27. pmid:25881913
  4. 4. Vlaeminck-Guillem V, Carrere S, Dewitte F, Stehelin D, Desbiens X, Duterque- Coquillaud M. The ETS family member ERG gene is expressed in mesodermal tissues and neural crests at fundamental steps during mouse embryogenesis. Mech Dev. 2000;91: 331–335. pmid:10704859
  5. 5. Schachterle W, Rojas A, Xu S-M, Black BL. ETS-dependent regulation of a distal Gata4 cardiac enhancer. Dev Biol. 2012; 361: 439–449. pmid:22056786
  6. 6. Seth A, Watson DK. ETS transcription factors and their emerging roles in human cancer. Eur J Can. 2005;41: 2462–2478. pmid:16213704
  7. 7. Meadows SM, Salanga MC, Krieg PA. Krüppel-like factor 2 cooperates with the ETS family protein ERG to activate Flk1 expression during vascular development. Development. 2009;136: 1115–1125. pmid:19244281
  8. 8. Birdsey GM, Shah AV, Dufton N, Reynolds LE, Almagro LO, Yang Y et al. The endothelial transcription factor ERG promotes vascular stability and growth through Wnt/β-catenin signaling. Dev Cell. 2015;32: 82–96. pmid:25584796
  9. 9. Mochmann LH, Neumann M, Eva K, Nowak V, Kühl AA, Ortiz-Tanchez J, et al. ERG induces a mesenchymal-like state associated with chemoresistance in leukemia cells. Oncotarget. 2014;5: 351. pmid:24504051
  10. 10. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71: 209–249. pmid:33538338
  11. 11. Zhou CK, Young D, Yeboah ED, Coburn SB, Tettey Y, Biritwum RB, et al. TMPRSS2:ERG Gene Fusions in Prostate Cancer of West African Men and a Meta-Analysis of Racial Differences. Am J Epidemiol. 2017;186: 1352–1361. pmid:28633309
  12. 12. Teo MY, Rathkopf DE, Kantoff P. Treatment of Advanced Prostate Cancer. Annu Rev Med. 2019;70: 479–499. pmid:30691365
  13. 13. Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R, Sun XW, et al. Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science. 2005;310: 644–8. pmid:16254181
  14. 14. Zhou E, Zhang B, Zhu K, Schaafsma E, Kumar RD, Cheng C. A TMPRSS2-ERG gene signature predicts prognosis of patients with prostate adenocarcinoma. Clin Transl Med. 2020;10: e216. pmid:33377652
  15. 15. O’Brien J, Hayder H, Zayed Y, Peng C. Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation. Front Endocrinol (Lausanne). 2018;9: 402. pmid:30123182
  16. 16. Ratti M, Lampis A, Ghidini M, Salati M, Mirchev MB, Valeri N, et al. MicroRNAs (miRNAs) and Long Non-Coding RNAs (lncRNAs) as New Tools for Cancer Therapy: First Steps from Bench to Bedside. Target Oncol. 2020;15: 261–278. pmid:32451752
  17. 17. Croce CM. Causes and consequences of microRNA dysregulation in cancer. Nat Rev Genet. 2009;10: 704–14. pmid:19763153
  18. 18. Zoni E, Karkampouna S, Thalmann GN, Kruithof-de Julio M, Spahn M. Emerging aspects of microRNA interaction with TMPRSS2-ERG and endocrine therapy. Mol Cell Endocrinol. 2018;462(Pt A): 9e16. pmid:28189568
  19. 19. Zhang Z, Lanz RB, Xiao L, Wang L, Hartig SM, Ittmann MM, et al. The tumor suppressive miR-200b subfamily is an ERG target gene in human prostate tumors. Oncotarget. 2016;7(25): 37993e8003. pmid:27191272
  20. 20. Coskun E, von der Heide EK, Schlee C, Kühnl A, Gökbuget N, Hoelzer D, et al. The role of microRNA-196a and microRNA-196b as ERG regulators in acute myeloid leukemia and acute T-lymphoblastic leukemia. Leuk Res. 2011;35: 208e13. pmid:20570349
  21. 21. Hart M, Wach S, Nolte E, Szczyrba J, Menon R, Taubert H, et al. The proto‐oncogene ERG is a target of micro RNA miR‐145 in prostate cancer. FEBS J. 2013;280: 2105–2116. pmid:23480797
  22. 22. Rio DC, Ares M, Hannon GJ, Nilsen TW. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. 2010; pdb-prot5439. pmid:20516177
  23. 23. Ma Z, Lui WO, Fire A, Dadras SS. Profiling and discovery of novel miRNAs from formalin-fixed, paraffin-embedded melanoma and nodal specimens. J Mol Diagn. 2009;11: 420–9. pmid:19710399
  24. 24. Ruijter JM, Ramakers C, Hoogaars WMH, Karlen Y, Bakker O, Van den Hoff MJB, et al. Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res. 2009;37: e45–e45. pmid:19237396
  25. 25. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29: e45. pmid:11328886
  26. 26. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72: 248–54. pmid:942051
  27. 27. Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods. 2012;9: 671–5. pmid:22930834
  28. 28. Hoesel B, Malkani N, Hochreiter B, Basílio J, Sughra K, Ilyas M, et al. Sequence-function correlations and dynamics of ERG isoforms. ERG8 is the black sheep of the family. Biochim Biophys Acta (BBA)-Molecular Cell Research. 2016;1863: 205–218. pmid:26554849
  29. 29. Jordan ET, Collins M, Terefe J, Ugozzoli L, Rubio T. Optimizing electroporation conditions in primary and other difficult-to-transfect cells. J Biomol Tech. 2008;19: 328–34. pmid:19183796.
  30. 30. St John J, Powell K, Conley-Lacomb MK, Chinni SR. TMPRSS2-ERG Fusion Gene Expression in Prostate Tumor Cells and Its Clinical and Biological Significance in Prostate Cancer Progression. J Cancer Sci Ther. 2012;4: 94–101. pmid:23264855
  31. 31. Adamo P, Ladomery MR. The oncogene ERG: a key factor in prostate cancer. Oncogene. 2016;35: 403–14. pmid:25915839
  32. 32. Bastus NC, Boyd LK, Mao X, Stankiewicz E, Kudahetti SC, Oliver RT, et al. Androgen-induced TMPRSS2:ERG fusion in nonmalignant prostate epithelial cells. Cancer Res. 2010;70: 9544–8. pmid:20947519
  33. 33. Fuse M, Nohata N, Kojima S, Sakamoto S, Chiyomaru T, Kawakami K, et al. Restoration of miR-145 expression suppresses cell proliferation, migration and invasion in prostate cancer by targeting FSCN1. Int J Oncol. 2011;38: 1093–101. pmid:21258769
  34. 34. Braoudaki M, Lambrou GI, Giannikou K et al. Microrna expression signatures predict patient progression and disease outcome in pediatric embryonal central nervous system neoplasms. J Hematol Oncol. 2014;7: 96. pmid:25551588
  35. 35. Zhao Y, Cui S, Wang Y, Xu R. The Extensive Regulation of MicroRNA in Immune Thrombocytopenia. Clin Appl Thromb Hemost. 2022;28: 10760296221093595. pmid:35536600
  36. 36. Garabet L, Ghanima W, Rangberg A, Teruel-Montoya R, Martinez C, Lozano ML, et al. Circulating microRNAs in patients with immune thrombocytopenia before and after treatment with thrombopoietin-receptor agonists. Platelets. 2020;31: 198–205. pmid:30885035
  37. 37. Rotival M, Siddle KJ, Silvert M, Pothlichet J, Quach H, Quintana-Murci L. Population variation in miRNAs and isomiRs and their impact on human immunity to infection. Genome Biol. 2020;21: 187. pmid:32731901
  38. 38. Yi W, Liu J, Qu S, Fan H, Lv Z. An 8 miRNA-Based Risk Score System for Predicting the Prognosis of Patients With Papillary Thyroid Cancer. Technol Cancer Res Treat. 2020;19: 1533033820965594. pmid:33054579
  39. 39. Kang L, Zou X, Zhang G, Xiang J, Wang Y, Yang M, et al. A variant in a microRNA binding site in NEIL2 3’UTR confers susceptibility to age-related cataracts. FASEB J. 2019;33: 10469–10476. pmid:31253066
  40. 40. Jia X, Zhang Z, Wei R, Li B, Chen Y, Li J. Comprehensive analysis of transcriptome-wide m6A methylome in intermediate-stage Esophageal squamous cell carcinoma. Pathol Res Pract. 2022;237: 154055. pmid:36007412
  41. 41. Malkani N, Rashid MU, Mumtaz S, Sohail MI. Regulation of angiogenesis in tumor metastasis via Ets-related ERG and micro-RNAs; one hand washes the other. In: Farooqi et al (ed) Unraveling the Complexities of Metastasis, Academic Press, 2022; pp 301–315.
    • 42. Chakraborty C, Sharma AR, Sharma G, Lee SS. Therapeutic advances of miRNAs: A preclinical and clinical update. J Adv Res. 2020;28: 127–138. pmid:33364050
    • 43. Zaman M, Chen Y, Deng G, Shahryari V, Suh SO, Saini S, et al. The functional significance of microRNA-145 in prostate cancer. Br J Cancer. 2010;103: 256–264. pmid:20588276
    • 44. Ru P, Steele R, Newhall P, Phillips NJ, Toth K, Ray RB. miRNA-29b suppresses prostate cancer metastasis by regulating epithelial-mesenchymal transition signaling. Mol Cancer Ther. 2012;1: 1166–73. pmid:22402125