https://orcid.org/0000-0001-8222-4451
Figures
Abstract
Clathrin is a key protein for viruses to enter host cells. Previous studies often use clathrin inhibitors or gene knockdown technology to partially inhibit the function of clathrin, but whether SFTSV can infect host cells without clathrin expression remains unclear. In this research, a clathrin heavy chains (CLTC) knockout A549 cell line was established by CRISPR/Cas9 technology, and the knockout of CLTC was verified by PCR, Western blot, immunofluorescence and T7E1 analysis. The off-target effect was evaluated by PCR combined with Sanger sequencing. Furthermore, this research verified that SFTSV infection was significantly inhibited, but not completely blocked, due to the deletion of CLTC protein. Our research also found that lipid raft inhibitor Filipin, other than macropinocytosis inhibitor EIPA, could significantly reduce SFTSV infection, and the inhibition was more obviously observed when Filipin was used in CLTC knockout cells. These result indicated that clathrin-dependent and lipid raft mediated endocytosis are the major two mode used by SFTSV entry. In conclusion, this study constructed a CLTC knockout cell line, which, for the first time, established a cell model for the study of the function of CLTC protein, and provided direct evidence that SFTSV pendent could still infect cells without clathrin. Additionally, we confirmed that lipid raft mediated endocytosis, as a clathrin-independent pathway, could be another key mode for SFTSV entry.
Citation: Liu T, Li J, Wang X, Huang T, Wu W, Li A, et al. (2023) Knockout of CLTC gene reduces but not completely block SFTSV infection. PLoS ONE 18(8): e0285673. https://doi.org/10.1371/journal.pone.0285673
Editor: Arunava Roy, University of South Florida, UNITED STATES
Received: November 23, 2022; Accepted: April 27, 2023; Published: August 25, 2023
Copyright: © 2023 Liu et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: The data is publicly available at figshare with DOI: 10.6084/m9.figshare.22769159.
Funding: This study is funded by grants from Study on Detection Technology and Clinical Validation of Human Pathogenic Virus Emergency Treatment (ZDZX-2018ZX10711001-001-01(D)). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Clathrin-mediated endocytosis (CME) is the major endocytic pathway in mammalian cells [1]. It is also responsible for the entry of viruses and other pathogens into host cells [2]. CME occurs via the assembly and maturation of clathrin-coated pits (CCP) that concentrate cargo as they invaginate and pinch off to form clathrin-coated vesicles (CCV) [3]. Clathrin molecules, as the major coat proteins of CCP and CCV, have a triskelion structure composed of three noncovalently bound clathrin heavy chains (CLTC) which provide the structural skeleton of clathrin lattice, and three light chains which regulate the formation and decomposition of clathrin lattice [4]. Clathrin is not only crucial in the formation of CCV, but also plays an important role in virus endosomal transport [5].
Severe fever with thrombocytopenia syndrome virus (SFTSV), a novel highly pathogenic bunyavirus, was first discovered in the Dabie Mountains in China [6] and causes severe fever with thrombocytopenia syndrome (SFTS) with an initial case fatality rate of 30%. SFTSV infections have been reported in over 26 provinces in China [7], Japan [8], and South Korea [9]. Similar viruses have also been reported in the US [10]. Currently, due to the lack of study on the mechanism of SFTSV infection, there are still no vaccines or specific antivirals available against SFTSV infection.
The classical endocytic mechanisms for viruses mainly include clathrin-dependent endocytosis, lipid raft-mediated endocytosis, and micropinocytosis [11]. A previous study showed that inhibitors of dynamin [12] caused a significant decrease of SFTSV infection, and another study using quantum dots (QDs) based single particle found that SFTSV infection led to recruitment of clathrin onto the cell surface [13], both suggesting that the entry of SFTSV may be clathrin dependent. However, due to the lack of direct evidence, it was not clear that whether SFTSV can enter host cells without clathrin expression. Therefore, construction of CLTC gene knockout cell line will help to verify this hypothesis so that to deeply analyze the mechanism of endocytosis and provide theoretical support for the discovery of drug targets for SFTSV.
CRISPR/Cas9 technology, allowing specific DNA editing of targeted genes by RNA-directed Cas9 nuclease with high efficiency of gene knockout, has been applied to various species as the most widely used gene editing technology [14–17]. Until now, it has not been reported to establish clathrin knockout cell lines, or to use clathrin knockout cell line to study the functions of clathrin during virus infections. In this study, a CLTC gene knockout cell line was constructed by CRISPR/Cas9 system combined with lentivirus packaging technology, and the knockout efficiency was confirmed in both DNA and protein levels, and then, the effect of this gene knockout on SFTSV infection was evaluated, which will lay a solid foundation for the future study of clathrin in SFTSV infection.
Materials and methods
Cells and viruses
Cell lines (A549, HeLa, Vero and HEK293FT cells) were initially acquired from the American Type Culture Collection (ATCC; USA), and were cultured at 37°C under 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM; Life Technologies, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Life Technologies, USA) and 1% penicillin/streptomycin (PS, Life Technologies, USA). Cells were passaged every 2 days and digested with 0.05% trypsin–EDTA.
SFTSV strain HB29 was first isolated in our laboratory [6], then passaged in Vero cells as a virus stock, and further utilized to infect A549 cells at an MOI of 0.1 for the gene knockout validation experiments.
Design and synthesis of sgRNA
CLTC gene sequence was searched on GeneBank to determine the distribution of exon region. On the basis of the second exon sequence, the online tool (http://crispr.mit.edu/) was used to design the sgRNA(single guide RNA) sequence. CACC was added to the 5’ end of the sequence. AAAC was added to the 5’ end of the complementary sequence. The sequences were synthesized by RuiBiotech (Beijing, China). The synthesized sgRNA primers were phosphorylated and annealed to form a sgRNA duplex for further study.
Construction of lentiCRISPR v2-sgRNA expression vector
The lentiCRISPR v2 (Addgene No. 52961) was digested by Esp3i, and sticky ends were obtained. The reaction system was as follows: Nuclease-free water, 14μL; 10×FastDigest Green Buffer, 2μL; DTT (20mM), 1μL; lentiCRISPR v2, 2μL; FastDigest enzyme, 1μL, followed by an incubation at 37°C for 5 min。
The product was electrophoresed on a 1% agarose gel and the digested product was recovered. The phosphorylated and annealed sgRNA was ligated to the recovered digested product by a rapid ligase. The ligation product was transferred to ss320 competent cells (Biorise, China), and the clones were screened on ampicillin-resistant LB plates. The positive clones were screened and sequenced by Ruibiotech (Beijing, China). The recombinant plasmid was extracted from the correct clones.
Lentivirus packaging
HEK293FT cells were seeded into 6-well plates, and when the cell density reached 80%, supernatant was sucked off, and 1mL of pre-incubated OPTI-MEM medium was added to each well. Using the Lipofectamine 3000 Transfection Reagent Kit (Invitrogen, USA), The constructed lentiCRISPR v2-sgRNA plasmid and two other lentiviral packaging plasmids psPAX2 (Addgene No. 12260) and pMD2.G (Addgene No. 12259) were co-transfected into HEK293FT cells at a molar ratio of 2:1:1. At 60h after transfection, the lentivirus was harvested and centrifuged in 1.5mL eppendorf tube at 15000×g at 4°C for 5 min. The supernatant was retained and filtered with a 0.45μm filter before being aliquoted and frozen at -80°C.
Acquisition of monoclonal cells
A549 cells were infected with the packaged lentivirus at MOI = 0.2. The next day, 2μg/mL puromycin was added to the cell supernatant for drug screening. Four days later, A549 cells integrated with lentivirus were obtained and were diluted and seeded into 96-well plates with 1 cell per well. After the single cell grew into a cell mass, the monoclonal cell mass was digested and moved to a 6-well plate to continue the culture.
T7E1 analysis for the knockout efficiency of CLTC gene
GeneArt® Genomic Cleavage Detection Kit (Life Technology, USA) was used to evaluate the knockout effieciency. Loci where the gene-specific double-strand breaks occur was amplified by PCR. The PCR product is denatured and reannealed so that mismatches are generated as strands with an indel re-annealed to strands with no indel or a different indel. Then, samples were treated with and without T7 endonuclease 1(T7E1) and the resultant bands are analyzed by gel electrophoresis. A PCR template provided by the kit was used as a positive control.
PCR verification of CLTC gene knockout
DNA was extracted from monoclonal cells and processed PCR amplification with a forward primer sequence of 5’-GGTGGTAATCATTGATATGA-3’, and a reverse primer sequence of 5’-GAATCCAGCTAGCAAAGTA-3’. The PCR reaction condition was as follows: 40 cycles including 95°C for 5 min, 95°C for 30 seconds, 60°C for 30 seconds and 72°C for 30 seconds, followed by a final extension at 72°C for 10 min. The PCR product was then subjected to Sanger sequencing.
Western blotting analysis for the verification of CLTC gene knockout
Expression of CLTC protein in the sgRNA control, CLTC knockdown and CLTC knockout cells was subjected to Western blotting analysis. Cells were rinsed once with ice-cold PBS, trypsinized, resuspended in PBS, and lysed by RIPA regent, and the supernatant was centrifuged. After the sample protein concentration was determined, an equal amount of protein sample was subjected for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Separated proteins were transferred to a polyvinylidene difluoride (PVDF) membrane (Bio-Rad, USA) which had been blocked with 5% skim milk in PBS for 1h. The membrane was incubated overnight at 4°C with a rabbit polyclonal antibody directed against CLTC (Abcam, USA), and then washed three times with PBST [18]. β-actin detected with rabbit anti-β-actin antibody (Cell Signaling Technology, USA)was used as loading control. The membrane was then incubated with an HRP-conjugated secondary antibody for 1h and washed three times with PBST for 10 min each [18].
Immunofluorescence analysis for the verification of CLTC gene knockout
For preparation for Immunofluorescence analysis, A549 cells were loaded into 8-well glass slides until an 80% confluence. Then cells were fixed with 4% paraformaldehyde and permeabilized with 0.25% Triton X-100 for 30 min at room temperature and blocked with PBS containing 3% bovine serum albumin for 1h. Then, cells were stained overnight at 4°C with a rabbit polyclonal antibody against CLTC (Abcam, USA) and an anti-rabbit IgG antibody conjugated with Alexa Fluor 488 (Invitrogen, USA) was utilized as the secondary antibody [18].
Evaluation of off-target effect and cell proliferation activity detection
According to the designed sgRNA sequence, the online off-target effect prediction tool (CRISPOR) was used to obtain the top 10 sites that were most likely to be off-target. The 10 sites were amplified by PCR and sequenced. BioEdit software was used to compare the amplified sequence with the wild-type gene sequence to verify the existence of variation.
The wild-type cells and CLTC gene knockout cells were seeded into a 96-well plate with 5 replicates for each kind of cells. Cell proliferation detection reagent MTT Cell Assay Kit (Biotium, USA) was added to the cell supernatant and the absorbance value was detected at 570nm by a Multiskan SkyHigh microplateReader (Thermo Fisher, USA). The OD570 values of the two kinds of cells were compared to determine whether there was a difference in the proliferation activity of the two kinds of cells.
SFTSV infection essay and detection of replication kinetic of SFTSV
A549 cells of wild-type and CLTC knockout were seeded into 6-well plates, followed by SFTSV infection with MOI = 0.1, cells infected with SFTSV and the supernants were collected at 0h, 24h, 36h and 48h after infection. RT-PCR was used to detect the viral RNA in the cells at four time points as described above. Ratios of log (viral RNA copies) of tested samples to those of GADPH were used to compare relative levels of RNA levels of SFTSV. The error bars represent the means ± standard deviation with 95% confidence interval (n = 10 each). The p value was calculated by the unpaired two-tailed t-test.
ELISA(Enzyme-Linked Immunosorbent Assay) and Western blotting analysis were used to detect the expression of SFTSV nucleoprotein in the supernant and in the cells, respectively. For ELISA analysis, 96-well plates were coated with a rabbit polyclonal antibody directed against SFTSV (500ng per well); Culture supernatants, which were diluted by 1:1 and 1:10 respectively, together with mixture of TritonX-100 and NP40 reagent, were added to 96-well plates followed by an incubation at 37°C for 1 h. Horseradish peroxidase (HRP)-labeled mouse monoclonal antibody against SFTSV nucleoprotein was added, followed by an incubation at 37°C for 1 h. Then, plates were washed five times, and substrate tetramethylbenzidine (TMB) in citrate buffer was added to each well. The addition of 2 NH2SO4 stopped the reactions, then optical densities (at 450 nm) were determined with an ELISA reader (Thermo Scientific, USA) [18]. The lower limit of positivity(cut-off) was deemed to be the mean OD plus two standard deviations of the three negative control samples. Ratios of OD450 value of tested samples to mean value of OD450 of negative controls were used to compare relative levels of nucleoproteins of SFTSV.
For Western blotting analysis, cells were collected in PBS, centrifuged and resuspended in RIPA buffer. Equal amount of each sample was fractionated by 10% SDS-PAGE gel. Separated proteins were transferred to a polyvinylidene difluoride (PVDF) membrane (Bio-Rad, USA) followed by blockage with 3% bovine serum albumin, incubated overnight at 4°C with a mouse antibody directed against SFTSV nucleoprotein, and an anti-mouse second antibody was added, followed by incubation with an HRP-conjugated secondary antibody for 1 h and washed three times [18].
Filipin(Biovision, USA), a lipid raft inhibitor, and EIPA(Apexbio, USA) a macropinocytosis inhibitor, were added to cell culture supernatant, respectively, followed by incubation at 37°C for 4 h and rinsed with PBS for three times before SFTSV infection, according to manufacturer’s instruction.
Confocal microscopy analysis
For preparation for confocal microscopy, CLTC knockout and the wild-type cells were loaded into 8-well glass slides and infected with SFTSV at an MOI of 100 after they had grown to 80% confluence. Then, cells were fixed with 4% paraformaldehyde at 36 h post infection. Then, cells were permeabilized with 0.25% Triton X-100 for 30 min at room temperature and blocked with PBS containing 3% bovine serum albumin for 1 h at room temperature. Cells were then stained overnight at 4°C with a mouse monoclonal antibody targeted at SFTSV GP [18], then stained with a secondary anti-mouse IgG antibody conjugated with Alexa Fluor 488 for 30 min at room temperature. Finally, cells were observed with a Leica TCS SP8 laser scanning confocal microscope (Leica, Germany).
Results
Construction and identification of recombinant expression vector LentiCRISPR-sgRNA
There are totally 32 exons in coding region of CLTC gene, and the sgRNA sequence of GCTGAAATTGGTCTTCGAAT followed by a PAM (Protospacer adjacent motif) sequence of TGG was obtained using the online tool according to the second exons (Fig 1A). The specific targeting position were shown in Fig 1B. The designed sgRNA sequence was then cloned into the lentiCRISPR v2 plasmid with a puromycin resistance and Cas9 gene, and the vector information and cloning position were shown in Fig 1C. Finally, constructed plasmid was subjected to Sanger sequencing, which showed the sgRNA sequence inserted was completely consistent with the designed sequence(Fig 1D). These data indicated the fragment was cloned successfully.
A Schematic diagram of CLTC sgRNA targeting location. Blue boxes indicates exons of CLTC gene, Blue font indicates the sgRNA sequence followed by a PAM sequence of TGG. B Sequence of the sgRNA targeting exon, Blue font indicates the exact location of sgRNA targeting. C Schematic diagram of the structure of LentiCRISPR-sgRNA. D Identification of the insertion of CLTC-sgRNA into lentiCRISPR v2 vector by Sanger sequencing. Sequence with a black background represents the inserted sgRNA.
Generation and verification of CLTC gene knockout cell lines
A total of 7 monoclonal cell lines were obtained from a 96-well plate, and expanded to 6-well plates. Genomic DNA was extracted, and fragments containing sgRNA targeting sequences were amplified by PCR and subjected for Sanger sequencing, and 4 monoclonal cell lines among 7 were detected to be wild-type cells.
Among the other 3 cell lines whose targeted sequences were interfered, only one cell line showed no CLTC protein expression and one showed decreased expression by western blotting analysis(Fig 2A). The CLTC knockout cell line was also verified by Immunofluorescence analysis (Fig 2B). Sanger sequencing results of CLTC knockout cell line showed there were over-lap peaks after the targeted sequence, and the base sequences after the targeted sequence were completely different from the sgRNA control cells (Fig 2C). Since there was no CLTC protein expression in the CLTC knockout cell line, our results demonstrated that the CLTC genes in the two homologous chromosomes were both disrupted by sgRNA guided Cas9 nuclease with different repair mode between the two homologous chromosomes, leading to the appearance of the over-lap peaks. In general, the CLTC gene knockout cell line was successfully constructed and verified.
A Verification of CLTC gene knockout by western blotting analysis using sgRNA control, CLTC knockout and CLTC knockdown cells. β-actin was used as the loading control. B Verification of CLTC gene knockout by Immunofluorescence assay. C Verification of CLTC gene knockout by Sanger sequencing. CLTC-KO represents CLTC gene knockout cell line. D T7E1 essay for the knockout efficiency. Loci where the gene-specific double-strand breaks occur was amplified by PCR. The product is denatured and reannealed so that mismatches are generated. Then, samples were treated with and without T7 endonuclease 1(T7E1) and the resultant bands are analyzed by gel electrophoresis. A PCR template provided by the kit was used as a positive control.
To better understand the knockout efficiency in our research, we performed a T7E1 assay. The targeted sites where the gene-specific double-strand breaks occur are amplified by PCR. The mismatches are subsequently detected and cleaved by T7 endonuclease 1 and then the resultant bands are analyzed by gel electrophoresis. The result showed that there was only one obvious parental band(500bp) in sgRNA control cells when T7 endonuclease 1 was added, while there were no parental bands but two cleaved bands(350bp and 150bp) in CLTC knockout cells, as shown in Fig 2D, which indicated that the CLTC gene was successfully knocked out in this research.
Evaluation of off-target effects and cell proliferation activity
The sgRNA sequence was input to CRISPOR website to obtain the off-target sites that may be caused by this sgRNA. The top 10 sites that are most likely to have off-target effects were selected, and their accession number, off-target score and mismatch positions were listed in Table 1.
According to the site information from CRISPOR, primers were designed respectively for each of these sites, and PCR amplification and Sanger sequencing was then performed to compare the sequences of CLTC gene knockout cells with the genome of wild-type cell. The results showed that the sequences of 10 targeted sequences of CLTC knockout cells were completely consistent with the gene sequences of wild-type cells, the alignment of 10 sites were shown in Fig 3A, which demonstrated that there were no off-target effect at these sites using this sgRNA. Therefore, to some extent, our result preliminarily provided an evaluation of off-target effect for the knockout of CLTC gene.
A Alignment results of top 10 off-target sites sequences in CLTC knockout cell line and wild-type cells. B CLTC knockout caused a decrease in cell proliferation activity. OD570 represents the absorbance value detected at 570nm. *p<0.05, **p<0.01.
To explore the cell proliferation which is the key foundation to obtain a stable cell line, cell proliferation detection reagent was added to the cell supernatant respectively at 0h, 24h, 36h and 48h after the cells were seeded into 96-well plate. The absorbance value was detected at 570nm. The results showed that the OD570 values of CLTC-KO cells were lower than those of wild-type cells at three time points (Fig 3B), which indicated that the knockout of CLTC gene caused a slight decrease in the cell proliferation activity.
CLTC knockout caused a significant decrease of SFTSV infection in A549 cells
Cells of the wild-type and CLTC-KO were infected with SFTSV followed by detection of viral nucleoprotein in the supernant with dilution of 1:1 and 1:10. ELISA analysis showed that SFTSV nucleoprotein expression significantly decreased in CLTC-KO cells at three time points in both 1:10 group (Fig 4A, left panel) and1:1 group (Fig 4A, right panel). SFTSV RNA of the infected cells were also isolated followed by RT-PCR detection, which showed that the relative expression of SFTSV RNA significantly decreased in CLTC-KO cells compared with that in wild-type cells (Fig 4B).
A Comparison of SFTSV nucleoprotein in supernatant for CLTC-KO and wild-type cells. Culture supernatants were collected at 0h, 24h, 36h and 48h after infection, and subjected for ELISA detection for SFTSV nucleoprotein. Supernatants without SFTSV infection was used as negative control. B Comparison of SFTSV RNA level in cells for CLTC-KO and wild-type. *p<0.05, **p<0.01, ***p<0.005. C Replication kinetic of SFTSV nucleoprotein detected by Western blotting analysis. Strips of SFTSV NP in CLTC-KO and the wild-type cells were from the same one PVDF membrane. D Confocal microscopy for the distribution of SFTSV glycoprotein. CLTC-KO and wild-type cells were infected with SFTSV, stained with a mouse monoclonal antibody targeted at SFTSV GP, and a secondary anti-mouse IgG antibody conjugated with Alexa Fluor 488(Invitrogen, A11001). Cell nucleus were stained with DAPI(Beyotime, c1002). E Filipin inhibited SFTSV infection. Filipin solution was added to cell culture supernatant, followed by incubation at 37°C for 4 h, rinsed with PBS for three times before SFTSV infection, RT-PCR detection was performed as those described above.
In addition, Western blotting analysis was used to explore the replication kinetic of SFTSV nucleoprotein which were collected at 0h, 24h, 36h and 48h after infection. The result showed that the expression of SFTSV nucleoprotein increased along with time, both in wild-type and CLTC-KO cells. Meanwhile, compared with wild-type cells, the nucleoprotein expression of CLTC-KO cells were also significant decreased at three time points (Fig 4C), which was consistent with the result of RT-PCR and ELISA described above.
To verify this phenomenon in CLTC knockdown cells, we selected the CLTC knockdown cell line obtained in Fig 2A with Sanger sequencing results shown in S1A Fig. Then, we performed SFTSV infection using this cell line and RT-PCR to detect SFTSV RNA in the infected cells, and the result showed that the knockdown of CLTC protein can still lead to a significant decrease of SFTSV infection at 24h, 36h and 48h post infection (S1B Fig). Therefore, we, for the first time, using cell model with CLTC protein deletion, confirmed that CLTC protein deletion did not completely block SFTSV infection.
SFTSV enter host cells using both clathrin-dependent and independent endocytosis
In order to preliminarily explore the mechanism of blocked SFTSV infection, we performed a confocal microscopic analysis at 24h after SFTSV infection in wild-type and CLTC-knockout cells. The result showed a stronger fluorescence intensity and a uniform distribution of SFTSV glycoprotein in the cytoplasm of wild-type cells, while it showed a weaker fluorescence intensity of glycoproteins in the CLTC-knockout cells, as shown in Fig 4D. These results, to some extent, may provide a clue that the deletion of clathrin may block the entry process of SFTSV into cytoplasm from cell membrane.
To further investigate which endocytosis mode except CME could be used during SFTSV entry, Filipin, a lipid raft inhibitor and EIPA, a macropinocytosis inhibitor were added to the cell culture supernatant, respectively, followed by SFTSV infection and RT-PCR experiment to detect SFTSV RNA at different time points post infection. Our results showed that SFTSV infection was significantly decreased at 24h, 48h and 72h in cells with Filipin treatment compared with the wild-type cells, and more significantly, it was decreased in Filipin treated CLTC-KO cells (Fig 4E), while it was not significantly decreased in wild-type cells with EIPA treatment, as shown in S2 Fig. This result demonstrated that lipid raft could also be used by SFTSV to enter host cells, and since the infection was almost completely blocked in this group, CME and lipid raft mediated entry may be the major two endocytosis for SFTSV. In conclusion, using CLTC-KO cell line, our study demonstrated that SFTSV may enter host cells via both clathrin dependent and independent endocytosis.
Discussion
Clathrin plays a crucial role in the process of viral endocytosis. There have been many functional studies on clathrin [19, 20], but these researches have certain limitations, because the use of clathrin inhibitors or gene knockdown methods could not delete the protein completely [21–23]. Since CLTC gene knockout has not been reported before, this study attempted to establish CLTC gene knockout cell line to find direct evidence for the functional study of clathrin.
Lentivirus-based CRISPR gene editing technology can integrate the sgRNA sequence into the genome of the cell, and stably and continuously express with cell proliferation [24, 25]. Therefore, compared with plasmid transfection, this method can obtain more stable cell lines [14, 26]. In addition, due to the wider spectrum of cells infected by lentivirus and the ability to avoid cytotoxic effects, the application of lentivirus-based CRISPR gene editing technology is becoming more and more widespread. However, there are certain defects for this method, for example, the integrated sequence may have possibility to cause gene mutagenesis and carcinogenesis, and the process of lentivirus packaging is time-consuming, cumbersome, and requires high technical requirements for laboratory personnel.
In this study, Sanger sequencing, Western blotting and immunofluorescence analysis were used to verify the knockout effect of CLTC protein at DNA and protein levels, and the off-target effect of sgRNA was evaluated by sequencing the 10 sites that were most likely to have off-target effect, which ensured the reliability of this gene knockout cell line and provided a methodological reference for researchers to construct CLTC knockout cells. This cell line we established has been passaged for 34 times, and there was still no CLTC protein expression.
In fact, when CRISPR/Cas9 is used for gene knockout, the probability of constructing a homozygous knockout cell line is very low, because a homozygous cell line requires that the knockout status of two homologous chromosomes be exactly the same, while the host cell repair the incision in a random manner. Although the cell lines established in this study were not homozygous, the results of Western blot and Immunofluorescence assay showed that CLTC protein was no longer expressed, which indicated that heterozygous gene knockout cell lines can also be used for protein functional studies.
This research found that CLTC knockout caused a significant decrease in SFTSV infection, which supports the conclusion that SFTSV enters host cells via clathrin dependent endocytosis. However, it was noted that, after CLTC knockout, SFTSV could still infect A549 cells in a small amount, indicating that CME is not the only way of SFTSV entry. By completely deleting the CLTC protein, our study provided direct evidence that SFTS virus can enter host cells without clathrin expression. However, we cannot rule out the possibility of delayed infection in CLTC-KO cells rather than a reduction in infection. Besides, our research demonstrated that macropinocytosis inhibitor EIPA could not reduce SFTSV infection, but lipid raft inhibitor Filipin could significantly reduce SFTSV infection, which indicated that SFTSV could use lipid raft mediated endocytosis to enter host cells.
There are some certain limitations in this research. For example, only one sgRNA targeting the exon of CLTC was designed in this study, while two or more sgRNAs were used in the knockout of other genes whose knockout efficiency may be higher [27, 28]. Besides, the method in which only top 10 sites were detected for the off-target effect, was to some extent one-sided, and the evaluation of off-taget effect based on whole genome sequencing was more comprehensive and convincing. In addition, a 96-well plate limited dilution method was used to obtain single cloned cells, which was time-consuming and labor-intensive to obtain a monoclonal cells and it would be more convenient and accurate if Flow cytometry was used to seed single cells into each well of 96-well plates.
In conclusion, this study for the first time, established a CLTC gene knockout cell line, which provided a technical reference for researchers to establish CLTC knockout cell line. In addition, this research confirmed that SFTSV could infect cells without clathrin expression despite a significant decrease, and lipid raft mediated endocytosis, as a clathrin-independent pathway, could be another key mode for SFTSV entry. Therefore, our research laid a solid foundation for study on the mechanism of endocytosis and provide theoretical support for the discovery of drug targets for SFTSV.
Supporting information
S1 Fig. Knockdown of CLTC protein inhibited SFTSV infection.
https://doi.org/10.1371/journal.pone.0285673.s001
(TIF)
S2 Fig. Macropinocytosis inhibitor EIPA did not reduce SFTSV infection.
https://doi.org/10.1371/journal.pone.0285673.s002
(TIF)
References
- 1. Wu M, Wu X. A kinetic view of clathrin assembly and endocytic cargo sorting. Current opinion in cell biology. 2021; 71:130–8. pmid:33865229.
- 2. Robinson MS. Forty Years of Clathrin-coated Vesicles. Traffic. 2015; 16(12):1210–38. pmid:26403691.
- 3. Mettlen M, Chen PH, Srinivasan S, Danuser G, Schmid SL. Regulation of Clathrin-Mediated Endocytosis. Annual review of biochemistry. 2018; 87:871–96. pmid:29661000.
- 4. Brodsky F. Living with clathrin: its role in intracellular membrane traffic. Science. 1988; 242(4884):1396–402. pmid:2904698.
- 5. Mousavi SA, Malerd L, Berg T, Kjeken R. Clathrin-dependent endocytosis. Biochemical Journal. 2004; 377(Pt 1):1–16. pmid:14505490.
- 6. Yu XJ, Liang MF, Zhang SY, Liu Y, Li JD, Sun YL, et al. Fever with thrombocytopenia associated with a novel bunyavirus in China. The New England journal of medicine. 2011; 364(16):1523–32. pmid:21410387.
- 7. Chen X, Ye H, Li S, Jiao B, Wu J, Zeng P, et al. Severe fever with thrombocytopenia syndrome virus inhibits exogenous Type I IFN signaling pathway through its NSs in vitro. PloS one. 2017; 12(2):e0172744. pmid:28234991.
- 8. Takahashi T, Maeda K, Suzuki T, Ishido A, Shigeoka T, Tominaga T, et al. The first identification and retrospective study of Severe Fever with Thrombocytopenia Syndrome in Japan. The Journal of infectious diseases. 2014; 209(6):816–27. Epub 11/14. pmid:24231186.
- 9. Park SW, Han MG, Yun SM, Chan P, Lee WJ, Ryou J. Severe Fever with Thrombocytopenia Syndrome Virus, South Korea, 2013. Emerging infectious diseases. 2014; 20(11):1880–2. pmid:25341085.
- 10. McMullan LK, Folk SM, Kelly AJ, Macneil A, Goldsmith CS, Metcalfe MG, et al. A new phlebovirus associated with severe febrile illness in Missouri. The New England journal of medicine. 2012; 367(9):834–41. pmid:22931317.
- 11. Huotari J, Helenius A. Endosome maturation. The EMBO journal. 2011; 30(17):3481–500. pmid:21878991.
- 12. Hofmann H, Li X, Zhang X, Liu W, Kuhl A, Kaup F, et al. Severe fever with thrombocytopenia virus glycoproteins are targeted by neutralizing antibodies and can use DC-SIGN as a receptor for pH-dependent entry into human and animal cell lines. Journal of virology. 2013; 87(8):4384–94. pmid:23388721.
- 13. Liu J, Xu M, Tang B, Hu L, Deng F, Wang H, et al. Single-Particle Tracking Reveals the Sequential Entry Process of the Bunyavirus Severe Fever with Thrombocytopenia Syndrome Virus. Small. 2019; 15(6):e1803788. pmid:30589216.
- 14. Zhang F. CRISPR-Cas9: Prospects and Challenges. Human gene therapy. 2015; 26(7):409–10. pmid:26176430.
- 15. Suzuki K, Tsunekawa Y, Hernandez-Benitez R, Wu J, Zhu J, Kim EJ, et al. In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016; 540(7631):144–9. pmid:27851729.
- 16. Gupta D, Bhattacharjee O, Mandal D, Sen MK, Ghosh D. CRISPR-Cas9 system: A new-fangled dawn in gene editing. Life Sciences. 2019; 232:116636. pmid:31295471.
- 17. Yi L, Li J. CRISPR-Cas9 therapeutics in cancer: promising strategies and present challenges. BBA—Reviews on Cancer. 2016; 1866(2):197–207. pmid:27641687.
- 18. Liu T, Li J, Liu Y, Qu Y, Li A, Li C, et al. SNX11 Identified as an Essential Host Factor for SFTS Virus Infection by CRISPR Knockout Screening. Virologica Sinica. 2019; 34(5):508–20. pmid:31215001.
- 19. Helenius A. Virus Entry: Looking Back and Moving Forward. Journal of molecular biology. 2018; 430(13):1853–62. pmid:29709571.
- 20. Albornoz A, Hoffmann AB, Lozach PY, Tischler ND. Early Bunyavirus-Host Cell Interactions. Viruses. 2016; 8(5). pmid:27213430.
- 21. Wan Z, Zhao L, Lu F, Gao X, Liu L. Mononuclear phagocyte system blockade improves therapeutic exosome delivery to the myocardium. Theranostics. 2020; 10(1):218–30. pmid:31903116.
- 22. Caballero-Díaz D, Bertran E, Peuelas-Haro I, Moreno-Càceres J, Fabregat I. Clathrin switches transforming growth factor-β role to pro-tumorigenic in liver cancer. Journal of Hepatology. 2020; 72(1):125–34. pmid:31562907.
- 23. Denies MS, Rosselli-Murai LK, Schnell S, Liu AP. Clathrin Heavy Chain Knockdown Impacts CXCR4 Signaling and Post-translational Modification. Frontiers in Cell and Developmental Biology. 2019; 7. pmid:31139626.
- 24. Joung J, Konermann S, Gootenberg JS, Abudayyeh OO, Platt RJ, Brigham MD, et al. Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening. Nature Protocols. 2017; 12(4):828. pmid:28333914.
- 25. Shalem O, Sanjana NE, Zhang F. High-throughput functional genomics using CRISPR-Cas9. Nature reviews Genetics. 2015; 16(5):299–311. pmid:25854182.
- 26. Ong SH, Li Y, Koike-Yusa H, Yusa K. Optimised metrics for CRISPR-KO screens with second-generation gRNA libraries. Scientific reports. 2017; 7(1):7384. pmid:28785007.
- 27. Dong S, Lin J, Held NL, Clem RJ, Passarelli AL, Franz AW. Heritable CRISPR/Cas9-mediated genome editing in the yellow fever mosquito, Aedes aegypti. PloS one. 2015; 10(3):e0122353. pmid:25815482.
- 28. White MK, Kaminski R, Wollebo H, Hu W, Malcolm T, Khalili K. Gene Editing for Treatment of Neurological Infections. Neurotherapeutics: the journal of the American Society for Experimental NeuroTherapeutics. 2016; 13(3):547–54. pmid:27150390.