Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Interaction and association analysis of malting related traits in barley

  • Irfan Iqbal,

    Roles Data curation, Formal analysis, Methodology, Validation, Writing – original draft

    Affiliation Plant Science Department, McGill University, Quebec, Canada

  • Zeratsion Abera Desta,

    Roles Formal analysis, Writing – review & editing

    Affiliation Plant Science Department, McGill University, Quebec, Canada

  • Rajiv Kumar Tripathi,

    Roles Methodology

    Affiliation Plant Science Department, McGill University, Quebec, Canada

  • Aaron Beattie,

    Roles Resources

    Affiliation Crop Development Centre, University of Saskatchewan, Saskatoon, Canada

  • Ana Badea,

    Roles Resources, Writing – review & editing

    Affiliation Brandon Research and Development Centre, Agriculture and Agri-Food Canada, Brandon, Canada

  • Jaswinder Singh

    Roles Conceptualization, Funding acquisition, Supervision, Writing – review & editing

    Jaswinder.singh@mcgill.ca

    Affiliation Plant Science Department, McGill University, Quebec, Canada

Abstract

Barley is considered as a foundation of the brewing and malting industry. Varieties with superior malt quality traits are required for efficient brewing and distillation processes. Among these, the Diastatic Power (DP), wort-Viscosity (VIS), β-glucan content (BG), Malt Extract (ME) and Alpha-Amylase (AA) are controlled by several genes linked to numerous quantitative trait loci (QTL), identified for barley malting quality. One of the well-known QTL, QTL2, associated with barley malting trait present on chromosome 4H harbours a key gene, called as HvTLP8 that has been identified for influencing the barley malting quality through its interaction with β-glucan in a redox-dependent manner. In this study, we examined to develop a functional molecular marker for HvTLP8 in the selection of superior malting cultivars. We first examined the expression of HvTLP8 and HvTLP17 containing carbohydrate binding domains in barley malt and feed varieties. The higher expression of HvTLP8 prompted us to further investigate its role as a marker for malting trait. By exploring the 1000 bp downstream 3’ UTR region of HvTLP8, we found single nucleotide polymorphism (SNP) in between Steptoe (feed variety) and Morex (malt variety), which was further validated by Cleaved Amplified Polymorphic Sequence (CAPS) marker assay. Analysis of 91 individuals from the Steptoe x Morex doubled haploid (DH) mapping population revealed CAPS polymorphism in HvTLP8. Highly significant (p<0.001) correlations among ME, AA and DP malting traits were observed. The correlation coefficient (r) between these traits ranged from 0.53 to 0.65. However, the polymorphism in HvTLP8 did not correlate effectively with ME, AA, and DP. Altogether, these findings will help us to further design the experiment regarding the HvTLP8 variation and its association with other desirable traits.

Introduction

Barley is one of the most important cereal crops used globally as food, feed for livestock, and in the brewing industry. Barley grains are the main raw material to produce malts, which in turn are processed to produce beer in the liquor industries. Malting quality traits of barley varieties are highly desirable to produce premium quality beer. Diastatic Power (DP), Viscosity (VIS), β-glucan content (BG), Malt Extract (ME) and Alpha-Amylase (AA) are some of the key parameters for determining the malting quality of the barley [1,2]. ME is composed of all the soluble elements of malt such as carbohydrates, proteins, and their hydrolyzed products. Moreover, it is a key source of fermentable sugars and essential enzymes for the hydrolysis of starch [3]. Mixed linked (1–3, 1–4) β-glucans (hereafter “β-glucan”) constitute the major non-starch polysaccharides component of endosperm and aleurone cell walls of barley seed [4]. Among different cultivars, barley grain is the fundamental source of β-glucan content ranging between 3.4% and 5.7% [5]. β-glucan concentration in barley grains (4–10% w/w) is substantially higher compared to wheat (1% w/w) [6], which also has decent utility in the brewing industry.

Barley varieties with higher β-glucan content are desirable to the food industry as it serves as dietary fiber, which protects against various human health conditions such as lowering the blood cholesterol [7,8]. However, for the production of high-quality products through efficient malting practices, cultivars with low β-glucan concentrations are required by the brewery industries [9]. Higher levels of β-glucan can contribute towards issues like haze formation, viscous wort and reduced wort filtration during the brewing processes [10]. ME is a complex quantitative trait that is controlled by multiple genes and its concentrations can be variable in different cultivars. It is also considered as a mega-trait which is the product of interactions between many sub-trait [11,12].

Genetic manipulation and selection of malting quality traits such as ME and β-glucan content are challenging for the breeders due to the complex inheritance nature of these traits.

Quantitative trait loci (QTL) analysis has been utilized as a molecular tool to detect and estimate genomic regions that are associated with traits of interest such as malting quality traits. To date, outcomes of several studies revealed the identification of more than 250 malting quality-related QTLs. Specifically, QTLs with high variance for ME and β-glucan content have been identified and localized on all the different barley chromosomes [11]. From these QTLs, QTL2 on chromosome 4H is reported as a major barley malting quality QTL which contributes 29% and 38% variation for key malting quality parameters such as BG and ME, respectively [13]. Similarly, QTL2 is also known to have an effective influence on other malting quality traits including AA and DP [1,14]. In another study, the telomeric region of chromosome 4H containing the malting quality associated complex was fine mapped, which revealed a total of 15 putative QTLs for BG [2], ME [3], AA [6] and DP [1,4]. Another major QTL, QMe.NaTx-2H was identified by using the doubled haploid (DH) population located on chromosome 2H that accounts for 48.4% of the total phenotypic variation (R2) for the ME [15]. Another QTL, Qme1.1 present on chromosome 1H has contributed with R2 of 21.1% in the ME phenotype [16]. In addition, two closely positioned QTLs were identified on chromosome 4H which accounts for the R2 about 8–13% and 4–10%, respectively [17]. β-glucan is also a very important malting quality trait that is influenced by both the environment and genotypic factors, but the latter has a more significant contribution, relatively [18]. Members of the cellulose synthase-like (CslF) gene family have been reported to play role in the β-glucan synthesis [19,20]. Several efforts have been made to develop molecular markers to select barley varieties with better malting traits such as ME and β-glucan content. For instance, around 1,524 SNPs were genotyped to detect several genes that are associated with six malting traits including β-glucan content and ME [21]. Further, Randomly Amplified Polymorphic DNA (RAPD), Diversity Arrays Technology (DArt) and QTL-related PCR-based makers have been used to screen different barley populations for improved malting quality traits [2,2225].

Recently, QTL2, a locus with a large proportion of variation for ME and β-glucan content, was dissected which harbours a key gene HvTLP8, apparently involved in interacting with β-glucan in a redox-dependent manner [26]. In the present study, we made efforts to characterize HvTLP8 at the molecular level to develop functional markers that can help barley breeders to identify varieties with superior malting traits. These markers include variation at DNA and protein levels. Moreover, we examined the linear association between the marker and the barley malting traits (e.g., ME, AA, and DP) as well as among these traits.

Materials and methods

Plant material and growth conditions

The seeds of barley malt and feed varieties (Table 1) were received from Drs. Aaron Beattie (University of Saskatchewan), Ana Badea (Agriculture and Agri-Food Canada Brandon Research and Development Centre), and Plant Gene Resources of Canada (PGRC).

thumbnail
Table 1. List of barley malt and feed varieties.

https://doi.org/10.1371/journal.pone.0283763.t001

Seeds were grown in the greenhouse under the photoperiod regime of 16 hrs day and 8 hrs night with an average temperature of 20°C. Fresh leaf samples were collected for DNA extraction and stored in -80°C for future use. Mature seeds of two malting (AC Metcalfe and Morex) and two feed (Steptoe and CDC Cowboy) were surface sterilized with a 20% working concentration of bleach followed by three rinses with distilled water. Seeds were germinated at room temperature under dark on wet Whatman filter paper in sterile petri-plates. Samples were collected and flash-frozen in liquid nitrogen at 16 hrs of grain germination stage. The harvested samples were stored at -80°C for future experiments.

Total RNA isolation and DNase I treatment

Total RNA was isolated from the 16 hrs germinated grains using a Spectrum Plant Total RNA kit, following the manufacturer’s protocol (Sigma-Aldrich, St. Louis, MO, USA). Before cDNA synthesis, extracted RNA samples were subjected to DNase I treatment to avoid DNA contamination by using the RQ1 RNase-Free DNase kit (Promega, USA). Reaction mixtures were incubated at 37°C for 30 minutes (mins) followed by the addition of 1μl of RQ1 DNase stop solution for reaction termination. Reactions were further incubated at 65°C for 10 mins to inactivate DNase I.

cDNA synthesis and quantitative real-time PCR (qRT-PCR) analysis

First-strand cDNA from 1μg of DNase I treated total RNA samples was synthesized by following the recommended protocol of AffinityScript QPCR cDNA Synthesis Kit (Agilent Technologies, USA). Relative transcript levels were measured by qRT-PCR using Wisent advanced qPCR master mix (Wisent Bioproducts, Canada) on Mx30005p qPCR system (Stratagene, USA). The qPCR cycle conditions were 95°C for 2 mins; 40 cycles of 95°C for 5 seconds (sec) and 60°C for 30 secs. For each sample, two independent biological and three technical replicates were used. Relative transcript levels were analyzed by following the 2-ΔΔCq method [27] using HvActin as an internal reference control [28]. The significance of gene expression between different malt and feed varieties was measured by all pairs Tukey test at (P ≤ 0.05). Integrated DNA Technologies (IDT) primer quest tool (https://www.idtdna.com/PrimerQuest/Home/Index) was used to design the primers for HvTLPs (HvTLP8 and HvTLP17). The primer sequences are listed in (Table 2).

thumbnail
Table 2. Primers used for qRT-PCR expression analysis.

https://doi.org/10.1371/journal.pone.0283763.t002

DNA extraction, PCR amplification and gel electrophoresis

Leaf samples (50 mg) were frozen in liquid nitrogen and grounded by using tissue lyser (Qiagen, USA). DNA extraction was performed by following the modified phenol/chloroform method as described by Singh et al. [29]. Primers (HvTLP8_F: ATGCCATTCTTCCTCACCACAG and HvTLP8_R: TCATGGGCAGAAGATGAC) were used to amplify the coding sequence of HvTLP8. Primers (HvTLP8_3’UTR_F: CGAGCACACGGACAAGAATA and HvTLP8_ 3’UTR_R: GCAACGACTCCAGTGAACTTA) targeting the 1000 bp downstream of 3’ UTR region of HvTLP8 were used. PCR amplification was performed in a 20 μl reaction, containing 1 μl of gDNA for each sample. PCR amplification was performed using GoTaq® G2 green master mix (Promega, USA). The PCR conditions were 95°C for 2 min, followed by 36 cycles at 95°C for 30 seconds with the annealing temperature of 56°C. A 20 μl of amplified product was analyzed on 1.2% agarose gel.

Cloning and CAPS assay

Amplified fragments of TLP8 were extracted from agarose gel and purified by using the recommended protocol of the Nucleospin gel and PCR clean-up kit (Takara, USA). Purified TLP8 fragments were ligated into the pGEMT-easy vector by using the manufacturer’s protocol. The ligation mixture was transformed into the DH5α competent cells. Several colonies were inoculated for plasmid isolation. Plasmid extraction was performed by using the modified TIANs method. The quality of plasmid was determined by using the NanoDrop ND-1000 (NanoDrop Technologies, Wilmington, DE, USA). Next, the clones were confirmed by PCR and restriction digestion. The positive clones were further sent for Sanger sequencing to Genome Quebec (https://cesgq.com). Sequence alignments were performed by using the Multiple Sequence Comparison by Log-Expectation (MUSCLE; ebi.ac.uk/Tools/msa/muscle/) tool with the default settings. For CAPS assay, the amplified fragments of all samples were digested with the MwoI enzyme (NEB, USA). Digested products were electrophorized on 2% agarose gel to visualize the polymorphism.

Malting traits data and HvTLP8 variation

A doubled haploid (DH) mapping population (Table 3) derived from a cross between Steptoe (S) x Morex (M) [30] was used to investigate the polymorphism in HvTLP8. These two parents (Steptoe and Morex) were grown in controlled environment as described above. The young leaves were collected for DNA extraction. The protocols for DNA extraction, PCR amplification, CAPS assay was performed as described in the previous method sections above. Morex (malting variety) and Steptoe (feed variety) are two contrasting parents used for the traits under investigation. Morex has higher ME, AA and DP as compared to Steptoe. Data of DHs based on means for three different malting traits (ME, AA, and DP) over nine environments was retrieved from the GrainGenes database (https://wheat.pw.usda.gov/ggpages/SxM/phenotypes.html). Correlation analysis between TLP8 marker and malting quality traits as well as other traits described above was performed as described in [31].

thumbnail
Table 3. Information about the S x M lines and HvTLP8 allele variation in the S x M DH mapping population.

https://doi.org/10.1371/journal.pone.0283763.t003

Results

Differential expression of HvTLPs in malt and feed varieties

Our previous genome-wide analysis of the barley genome identified 19 TLPs some of which possesses carbohydrate binding domain (CBD) [32]. The role of carbohydrate binding domain in TLP8 has been documented for its interaction with beta-glucan [26]. Therefore, we selected CBD containing TLPs, HvTLP17 and HvTLP8 to examine the expression during germination. The expression of HvTLP8 was higher in malting (AC Metcalfe & Morex) varieties as compared to feed varieties. Among malting varieties, the highest HvTLP8 expression was observed for Morex. However, lower and similar expression was observed for both of the feed varieties Steptoe and CDC Cowboy. In the case of HvTLP17, we have observed higher expression in only one malt (AC Metcalfe) variety and lower expression in feed varieties at the 16 hrs stage of grain germination (Fig 1).

thumbnail
Fig 1. Expression analysis of HvTLP8 and HvTLP17 in malt (AC Metcalfe and Morex) and feed (CDC Cowboy and Steptoe) varieties at 16 hrs of grain germination.

Asterisks (*) represent the significance of gene expression in different malt and feed varieties by measured by all pairs Tukey test at (P ≤ 0.05).

https://doi.org/10.1371/journal.pone.0283763.g001

Variation in the coding sequence and in 3’ UTR region of HvTLP8

Based on HvTLP8/17 expression data we decided to explore HvTLP8 as the marker for malting quality. First, we PCR amplified the coding regions of HvTLP8 from malt and feed varieties and sequenced. Alignment of the sequenced amplified fragments from different malt and feed varieties indicated no polymorphism for the HvTLP8 coding region (data not shown). Next, we decided to sequence the un-translated regions (UTRs) of HvTLP8. We searched for polymorphism to the 1000 bp downstream of the 3’ UTR region and were unable to identify any conserved variation specific to malting or feed varieties in this region (Fig 2). However, the sequencing results indicated differences in the sequence of HvTLP8 3’ UTR region in between Steptoe (six-row feed) and Morex (six-row malt), which was striking. Polymorphism included eight single bp SNPs, a two bp deletion in Morex and a six bp difference in Steptoe, which resulted in additional site development of MwoI restriction enzyme (Fig 3). When amplified fragments of the HvTLP8- 3’ -UTR region was subjected to digestion with MwoI electrophoresed samples indicated a clear discriminative banding pattern in Steptoe and Morex varieties (Fig 4). Digestion of Steptoe PCR amplified HvTLP8 fragments generated four bands of 81 bp, 125 bp, 232 bp and 314 bp sizes, whereas Morex HvTLP8 fragments produced three bands of 125 bp, 229 bp and 390 bp sizes (Fig 3).

thumbnail
Fig 2. Multiple sequence alignment of 1000 bp downstream 3’ UTR region of HvTLP8 from different malt and feed varieties.

https://doi.org/10.1371/journal.pone.0283763.g002

thumbnail
Fig 3.

(A) Alignment of 1000bp downstream 3’ UTR region of HvTLP8 in Steptoe (six-row feed) and Morex (six-row malt) varieties. The red box indicates the difference that resulted in the additional MwoI restriction site in Steptoe. Black boxes indicate SNPs. (B) Digestion of 1000 bp downstream 3’ UTR region of HvTLP8 fragment with MwoI in Steptoe and Morex. UD: Undigested PCR product. M: 1kb plus marker.

https://doi.org/10.1371/journal.pone.0283763.g003

thumbnail
Fig 4. Digestion of 1000 bp downstream 3’ UTR region of HvTLP8 fragment with MwoI in different barley malt and feed varieties (1: Champion, 2: CDC Maverick, 3: CDC Bow, 4: CDC Meredith, 5: CDC Austenson, 6: CDC Fraser, 7: AC Metcalfe, 8: CDC Copeland, 9: CDC Cowboy, 10: CDC McGwire, 11: TR12735, 12: CDC Kindersley, 13: CDC Polarstar, 14: AAC Synergy).

D: Digested PCR product. M: 1kb plus marker.

https://doi.org/10.1371/journal.pone.0283763.g004

Association of SNP variation present in 3’ UTR of HvTLP8 with malting quality traits

Our discovery of SNP variation present between the 3’ UTR of HvTLP8 of Steptoe and Morex (Fig 3A), prompted us to elucidate the genetic variation of these SNPs in different mapping populations. We used a DH mapping population generated from the cross between S x M genotypes to analyze the SNP variation for HvTLP8. By performing the CAPS assay on 91 DHs and the parents, we found polymorphism for HvTLP8 among lines (Fig 5A and 5B). Individuals mimicked 52.75% of the allele A genotype of Steptoe (P1), whereas 47.25% of individuals demonstrated the allele B genotype, which corresponded to Morex (P2) (Table 3).

thumbnail
Fig 5.

(A) Digestion of 1000 bp downstream 3’ UTR region of HvTLP8 fragment with MwoI in DHs from S x M mapping population. (B) Digestion of mapping population parents. M: 1 kb plus marker.

https://doi.org/10.1371/journal.pone.0283763.g005

S x M DH mapping population is well studied for malting traits especially for ME, AA and DP [12]. HvTLP8 demonstrated polymorphism in the S x M mapping population, which intrigued us to examine its relationship with ME, AA, and DP. Regression analysis indicates that HvTLP8 did not explain the variation for these traits. The observed R2 values were 1.32, 0.94 and 0.29 for AA, ME, and DP respectively (Table 4). Similarly, correlation analysis revealed that HvTLP8 was insignificantly associated with these traits; however, the correlation among AA, ME and DP were highly significant (p<0.001; Fig 6). The highest correlation was found between AA and ME (0.65). The correlation coefficient (r) between traits ranged from 0.53 to 0.65 (Fig 6).

thumbnail
Fig 6. Correlations (r) between HvTLP8 and malting quality traits along with the correlation between traits for DH mapping population.

The scatter plot matrix (below diagonal), the histogram distributions are in the diagonal, and the correlation values are above diagonal. The (*) represents labels of significances (***) shows highly significant correlation (p<0.001) and values without asterisks are insignificantly correlated.

https://doi.org/10.1371/journal.pone.0283763.g006

thumbnail
Table 4. The proportion of variation (%) shared between the malting traits of S x M mapping population.

https://doi.org/10.1371/journal.pone.0283763.t004

Discussion

The molecular basis of barley malting quality trait plasticity is poorly understood. Here we study the behaviour of TLP8 as a marker for barley malting quality. In our earlier report, HvTLP8 was identified as a key gene that influences the malting quality via interaction with β-glucan in a redox-dependent manner [32]. We observed that TLP8 contained the carbohydrate-binding motif and its expression was differential in different barley malting and feed varieties at both mRNA and protein levels, respectively [26]. Our other recent finding reported 19 HvTLPs in the barley genome other than HvTLP8 and only two germination specific TLPs, HvTLP8, and HvTLP17 contained the carbohydrate-binding motif (CQTGDCQG) and can have a possible interaction with the β-glucan [33]. In addition to these two TLPs, HvTLP14 also possesses partial carbohydrate binding motif [32] as glycine (G) was substituted to glutamine (Q), therefore removed from further investigations. Thus, we examined the mRNA expression of HvTLP8 and HvTLP17 (Fig 1). The expression analysis data indicated that HvTLP17 has a higher gene expression level in the malting variety, AC Metcalfe, than in the Morex. However, the expression of HvTLP8 was higher in malt than in feed varieties. The expression pattern of HvTLP17 was different from HvTLP8 in this study and also in the earlier report [26]. However, HvTLP17 has a carbohydrate binding motif similar to HvTLP8 [33]. It is possible that HvTLP17 might be binding with other carbohydrates but not with beta-glucan. These results indicated that HvTLP8 might be a good candidate gene to develop a potential molecular marker that can differentiate between malt and feed barley varieties. To investigate this, we analysed the full-length coding regions (CDS) of HvTLP8 to find potential SNPs that can be associated with malting. We could not observe SNPs between the CDS region of HvTLP8 in different malt and feed varieties. Nevertheless, we found differences at gene expression level for HvTLP8 in different malt and feed varieties, when the regions from the CDS and 3’ UTR were targeted [26]. Next, we expanded our SNP exploration targeting the 1000 bp downstream of HvTLP8 3’ UTR regions in different malt and feed varieties. Interestingly, we observed SNP polymorphism in two six-row varieties Steptoe and Morex (Figs 2, 3A and 3B). We observed several polymorphic SNPs in HvTLP8 of Steptoe and Morex. However, a six bp deletion in the 3’UTR region of HvTLP8 in Morex was one of the major polymorphic sites identified. Previous investigation on SNP discovery in the reference genome of barley by using 16,127 assemblies have reported higher SNP density in the 5’UTR region compared to the 3’ UTR region [34]. In another study, SNP polymorphism analysis of the HvP5CS1 gene revealed 16 SNPs, from which 7 SNPs were found in the 3’ downstream sequence of the non-coding region [35]. Likewise, our results of SNP discovery in the HvTLP8 3’ UTR also exist in the downstream region as found in these reports.

Varieties having higher ME, DP, AA, and lower BG traits are considered malting varieties which are an absolute requirement for the malting industry. The malting quality of barley depends on the interaction of various malting traits and the genetic architecture of genotypes. To fish out the genes for malting, numerous malting quality associated QTLs have been identified in barley. Among these QTLs, QTL2 accounts for 37.6% of the variation for the malt extract [13]. The HvTLP8, resides on the QTL2 present on chromosome 4H of the barley genome. Steptoe and Morex are two contrasting six-row barley varieties for malting traits such as ME, DP, AA, and BG. The polymorphism observed in the 3’UTR of HvTLP8 was further tested on S x M DH mapping population that is well studied for the malting traits [1,12,30]. We performed CAPS marker assay on 91 DHs and found polymorphism for HvTLP8 in 1000 bp downstream of the 3’ UTR region (Figs 4, 5A and 5B). A total of 52.75% of DHs showed a closer relationship with Steptoe, while 47.25% were related to Morex (Table 3). Furthermore, our regression analysis on malt quality parameters demonstrated low variance of HvTLP8 with changing AA, DP, and ME (Table 4). Similarly, correlation data indicated a low association of HvTLP8 with these malting traits. However, a significant correlation was observed between AA, DP, and ME (Fig 6). QTL2 is a complex genetic region harbouring genes for different malting traits, which are known to interact with each other [30] and HvTLP8 may only be associated with soluble beta-glucan content, which has not been considered in this study. Polymorphism identified in the HvTLP8 could be correlated with other traits such as beta-glucan content mapped in the QTL2 region to develop potential genetic markers. Our data analysis showed very low deviation for the AA and DP values, as it was reported by Ulrich et al. [12]. However, the correlation values between traits were found to be higher (Fig 6) when compared to the results (r = 0.56** and 0.39**) reported by Ulrich et al. [12] referring to the correlations between AA and ME as well as between DP and ME, respectively. This could be due to the availability of analysis tools having better algorithms and the way of analysis which have been used (p<0.001) for comparison (p<0.01) as reported by Ulrich et al. [12].

Our current data and previous studies [32,33] suggested that the coding sequence of HvTLP8 is completely similar in different malt and feed varieties. However, expression of this gene varies greatly between malt and feed varieties. Difference in the gene expression needs further investigation to identify regulatory elements in the promoter region, which may provide further information about its transcriptional regulation. We also noticed that purified HvTLP8 was interacting with carbohydrate moiety at the protein level [26], therefore any marker technology which differentiate gene and protein expression could be utilized for selection of better malting quality barley genotypes. For example, markers, that deploy proteins and enzymes (e.g., ELISA-based) could provide better options. ELISA-based markers have been used for the screening of traits like lysine content in wheat [36], levels of deoxynivalenol (DON) [37] and Hordein (Gluten) [38] in beer samples. In future, development of HvTLP8 specific antibodies to develop an ELISA based biochemical marker will help the barley malting breeding community for selection of superior barley malting varieties.

Conclusion

In this study, we have explored the CDS and 3’ UTR (1000 bp downstream region) of HvTLP8 for SNP variation in different malting and feed varieties that can be linked to malting. We found SNP variation in the 3’ UTR downstream region of HvTLP8 of Steptoe and Morex. Importantly, we found a six bp deletion in the Morex variety as a key variation. Similarly, we found polymorphism while exploring the 3’ UTR of HvTLP8 (1000 bp downstream) in the DH population. Our correlation analysis indicated that HvTLP8 was insignificantly correlated with malting traits (ME, AA, and DP), however, highly significant correlations were recorded for these traits at (p<0.001). The identified SNPs in the HvTLP8 can be further characterized to reveal their possible association with the malting traits. In future, the 5’ UTR upstream region could be explored for the potential HvTLP8 variation that may have a possible association with key malting traits.

Acknowledgments

We are grateful to Dr. Pat Hayes, Oregon State University, for his guidance about the availability of malting traits data in the DH population.

References

  1. 1. Gao W, Clancy J, Han F, Jones B, Budde A, Wesenberg D, et al. Fine mapping of a malting-quality QTL complex near the chromosome 4H S telomere in barley. Theoretical and applied genetics. 2004;109(4):750–60. pmid:15164174
  2. 2. Cu ST, March TJ, Stewart S, Degner S, Coventry S, Box A, et al. Genetic analysis of grain and malt quality in an elite barley population. Molecular Breeding. 2016;36(9):1–16.
  3. 3. Burger W, LaBerge D. Malting and brewing quality. Barley. 1985;26:367–401.
  4. 4. Houston K, Russell J, Schreiber M, Halpin C, Oakey H, Washington JM, et al. A genome wide association scan for (1, 3; 1, 4)-β-glucan content in the grain of contemporary 2-row Spring and Winter barleys. BMC genomics. 2014;15(1):1–15.
  5. 5. Henry R. Genetic and environmental variation in the pentosan and β-glucan contents of barley, and their relation to malting quality. Journal of Cereal Science. 1986;4(3):269–77.
  6. 6. Burton R, Fincher G. Current challenges in cell wall biology in the cereals and grasses. Frontiers in plant science. 2012;3:130. pmid:22715340
  7. 7. Ames N, Storsley J, Thandapilly SJ. Functionality of beta-glucan from oat and barley and its relation with human health. Cereal grain-based functional foods 2018. p. 147–66.
  8. 8. Cosola C, De Angelis M, Rocchetti MT, Montemurno E, Maranzano V, Dalfino G, et al. Beta-glucans supplementation associates with reduction in P-cresyl sulfate levels and improved endothelial vascular reactivity in healthy individuals. PloS one. 2017;12(1):e0169635. pmid:28107445
  9. 9. Gupta M, Abu‐Ghannam N, Gallaghar E. Barley for brewing: Characteristic changes during malting, brewing and applications of its by‐products. Comprehensive reviews in food science and food safety. 2010;9(3):318–28. pmid:33467816
  10. 10. McClear BV, Glennie‐Holmes M. Enzymic quantification of (1→ 3)(1→ 4)‐β‐d‐glucan in barley and malt. Journal of the Institute of Brewing. 1985;91(5):285–95.
  11. 11. Fang Y, Zhang X, Xue D. Genetic analysis and molecular breeding applications of malting quality QTLs in Barley. Frontiers in Genetics. 2019;10:352. pmid:31068969
  12. 12. Ullrich S, Han F, Jones B. Genetic complexity of the malt extract trait in barley suggested by QTL analysis. Journal of the American Society of Brewing Chemists. 1997;55(1):1–4.
  13. 13. Han F, Romagosa I, Ullrich S, Jones B, Hayes P, Wesenberg D. Molecular marker-assisted selection for malting quality traits in barley. Molecular Breeding. 1997;3(6):427–37.
  14. 14. Han F. Mapping of quantitative trait loci associated with malting quality in barley. Barley Genet Newsl. 1993;23:84–97.
  15. 15. Wang X, Zhang X, Cai S, Ye L, Zhou M, Chen Z, et al. Genetic diversity and QTL mapping of thermostability of limit dextrinase in barley. Journal of agricultural and food chemistry. 2015;63(14):3778–83. pmid:25816850
  16. 16. Laidò G, Barabaschi D, Tondelli A, Gianinetti A, Stanca AM, Li Destri Nicosia O, et al. QTL alleles from a winter feed type can improve malting quality in barley. Plant breeding. 2009;128(6):598–605.
  17. 17. Walker CK, Ford R, Muñoz-Amatriaín M, Panozzo JF. The detection of QTLs in barley associated with endosperm hardness, grain density, grain size and malting quality using rapid phenotyping tools. Theoretical and Applied Genetics. 2013;126(10):2533–51. pmid:23884598
  18. 18. Jamar C, du Jardin P, Fauconnier M-L. Cell wall polysaccharides hydrolysis of malting barley (Hordeum vulgare L.): a review. Biotechnologie, Agronomie, Société et Environnement. 2011;15(2):301–13.
  19. 19. Burton RA, Wilson SM, Hrmova M, Harvey AJ, Shirley NJ, Medhurst A, et al. Cellulose synthase-like CslF genes mediate the synthesis of cell wall (1, 3; 1, 4)-ß-D-glucans. Science. 2006;311(5769):1940–2.
  20. 20. Taketa S, Yuo T, Tonooka T, Tsumuraya Y, Inagaki Y, Haruyama N, et al. Functional characterization of barley betaglucanless mutants demonstrates a unique role for CslF6 in (1, 3; 1, 4)-β-D-glucan biosynthesis. Journal of experimental botany. 2012;63(1):381–92.
  21. 21. Muñoz-Amatriaín M, Xiong Y, Schmitt MR, Bilgic H, Budde AD, Chao S, et al. Transcriptome analysis of a barley breeding program examines gene expression diversity and reveals target genes for malting quality improvement. BMC genomics. 2010;11(1):1–15. pmid:21092286
  22. 22. Ovesná J, Leisova L, Kucera L, Langer I. Characterisation of barley (Hordeum vulgare) varieties and breeding lines using RAPD and QTL associated PCR markers. Rostlinna Vyroba-UZPI (Czech Republic). 2001.
  23. 23. Coventry S, Collins H, Barr A, Jefferies S, Chalmers K, Logue S, et al. Use of putative QTLs and structural genes in marker assisted selection for diastatic power in malting barley (Hordeum vulgare L.). Australian Journal of Agricultural Research. 2003;54(12):1241–50.
  24. 24. Emebiri L, Michael P, Moody D, Ogbonnaya F, Black C. Pyramiding QTLs to improve malting quality in barley: gains in phenotype and genetic diversity. Molecular Breeding. 2009;23(2):219–28.
  25. 25. Fechter I, Rath F, Voetz M. A single PCR marker predicting the activity levels of various enzymes responsible for malting quality. Journal of the American Society of Brewing Chemists. 2010;68(1):41–7.
  26. 26. Singh S, Tripathi RK, Lemaux PG, Buchanan BB, Singh J. Redox-dependent interaction between thaumatin-like protein and β-glucan influences malting quality of barley. Proceedings of the National Academy of Sciences. 2017;114(29):7725–30.
  27. 27. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. methods. 2001;25(4):402–8.
  28. 28. Singh Manjit, and Singh Jaswinder. "Seed development-related expression of ARGONAUTE4_9 class of genes in barley: possible role in seed dormancy." Euphytica 188 1 (2012): 123–129.
  29. 29. Singh S, Tan HQ, Singh J. Mutagenesis of barley malting quality QTLs with Ds transposons. Functional & integrative genomics. 2012;12(1):131–41. pmid:22105861
  30. 30. Hayes P, Liu B, Knapp S, Chen F, Jones B, Blake T, et al. Quantitative trait locus effects and environmental interaction in a sample of North American barley germ plasm. Theoretical and Applied Genetics. 1993;87(3):392–401. pmid:24190268
  31. 31. Desta ZA, de Koning D-J, Ortiz R. Molecular mapping and identification of quantitative trait loci for domestication traits in the field cress (Lepidium campestre L.) genome. Heredity. 2020;124(4):579–91. pmid:32076125
  32. 32. Singh S, Tripathi RK, Lemaux PG, Buchanan BB, Singh J. Redox-dependent interaction between thaumatin-like protein and β-glucan influences malting quality of barley. Proceedings of the National Academy of Sciences. 2017:201701824.
  33. 33. Iqbal I, Tripathi RK, Wilkins O, Singh J. Thaumatin-like Protein (TLP) gene family in barley: Genome-wide exploration and expression analysis during germination. Genes. 2020;11(9):1080. pmid:32947963
  34. 34. Duran C, Appleby N, Vardy M, Imelfort M, Edwards D, Batley J. Single nucleotide polymorphism discovery in barley using autoSNPdb. Plant biotechnology journal. 2009;7(4):326. pmid:19386041
  35. 35. Xia Y, Li R, Bai G, Siddique KH, Varshney RK, Baum M, et al. Genetic variations of HvP5CS1 and their association with drought tolerance related traits in barley (Hordeum vulgare L.). Scientific reports. 2017;7(1):1–10.
  36. 36. Singh J, Sharp PJ, Skerritt JH. A new candidate protein for high lysine content in wheat grain. Journal of the Science of Food and Agriculture. 2001;81(2):216–26.
  37. 37. Niessen L, Böhm-Schrami M, Vogel H, Donhauser S. Deoxynivalenol in commercial beer—screening for the toxin with an indirect competitive ELISA. Mycotoxin Research. 1993;9(2):99–109. pmid:23606176
  38. 38. Tanner GJ, Colgrave ML, Blundell MJ, Goswami HP, Howitt CA. Measuring hordein (gluten) in beer–a comparison of ELISA and mass spectrometry. PLoS One. 2013;8(2):e56452. pmid:23509606