Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Beyond ingredients: Supramolecular structure of lipid droplets in infant formula affects metabolic and brain function in mouse models

  • Annemarie Oosting ,

    Roles Conceptualization, Investigation, Methodology, Supervision, Writing – original draft

    annemarie.oosting@danone.com

    Affiliation Danone Nutricia Research, Utrecht, The Netherlands

    ⨯
  • Louise Harvey,

    Roles Conceptualization, Methodology, Writing – review & editing

    Affiliation Danone Nutricia Research, Utrecht, The Netherlands

    ⨯
  • Silvia Ringler,

    Roles Formal analysis, Methodology, Visualization, Writing – review & editing

    Affiliation Danone Nutricia Research, Utrecht, The Netherlands

    ⨯
  • Gertjan van Dijk,

    Roles Conceptualization, Formal analysis, Investigation, Methodology, Supervision, Writing – review & editing

    Affiliation Groningen Institute for Evolutionary Life Sciences, University of Groningen, Groningen, Netherlands

    ⨯
  • Lidewij Schipper

    Roles Conceptualization, Formal analysis, Investigation, Methodology, Supervision, Writing – original draft

    Affiliations Danone Nutricia Research, Utrecht, The Netherlands, Groningen Institute for Evolutionary Life Sciences, University of Groningen, Groningen, Netherlands

    ⨯

Correction

1 Apr 2025: Oosting A, Harvey L, Ringler S, van Dijk G, Schipper L (2025) Correction: Beyond ingredients: Supramolecular structure of lipid droplets in infant formula affects metabolic and brain function in mouse models. PLOS ONE 20(4): e0321667. https://doi.org/10.1371/journal.pone.0321667 View correction

Abstract

Human milk beneficially affects infant growth and brain development. The supramolecular structure of lipid globules in human milk i.e., large lipid globules covered by the milk fat globule membrane, is believed to contribute to this effect, in addition to the supply of functional ingredients. Three preclinical (mouse) experiments were performed to study the effects of infant formula mimicking the supramolecular structure of human milk lipid globules on brain and metabolic health outcomes. From postnatal day 16 to 42, mouse offspring were exposed to a diet containing infant formula with large, phospholipid-coated lipid droplets (structure, STR) or infant formula with the same ingredients but lacking the unique structural properties as observed in human milk (ingredient, ING). Subsequently, in Study 1, the fatty acid composition in liver and brain membranes was measured, and expression of hippocampal molecular markers were analyzed. In Study 2 and 3 adult (Western-style diet-induced) body fat accumulation and cognitive function were evaluated. Animals exposed to STR compared to ING showed improved omega-3 fatty acid accumulation in liver and brain, and higher expression of brain myelin-associated glycoprotein. Early exposure to STR reduced fat mass accumulation in adulthood; the effect was more pronounced in animals exposed to a Western-style diet. Additionally, mice exposed to STR demonstrated better memory performance later in life. In conclusion, early life exposure to infant formula containing large, phospholipid-coated lipid droplets, that are closer to the supramolecular structure of lipid globules in human milk, positively affects adult brain and metabolic health outcomes in pre-clinical animal models.

Citation: Oosting A, Harvey L, Ringler S, van Dijk G, Schipper L (2023) Beyond ingredients: Supramolecular structure of lipid droplets in infant formula affects metabolic and brain function in mouse models. PLoS ONE 18(8): e0282816. https://doi.org/10.1371/journal.pone.0282816

Editor: Dinh-Toi Chu, International School, Vietnam National University, VIET NAM

Received: February 22, 2023; Accepted: June 28, 2023; Published: August 2, 2023

Copyright: © 2023 Oosting et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the paper.

Funding: This study was funded by Danone Nutricia Research. The funder provided support to the current study by covering research costs and in the form of salaries for authors AO, LH, SR and LS. As these authors are employed by the funder, the funder had a role in the study design, data collection and analysis, decision to publish and preparation of the manuscript.

Competing interests: I have read the journal’s policy and the authors of this manuscript have the following competing interests: This study was funded by Danone Nutricia Research. The funder provided support to the current study by covering research costs and in the form of salaries for authors AO, LH, SR and LS. The funder discloses a granted patent application using data that is also described in the submitted work (EP EP2753191A1 USE OF INFANT FORMULA WITH LARGE LIPID GLOBULES). GvD has collaborated with the funder on part of the submitted work for which his institution is compensated financially. The research is done in relation to development of a product by Danone, which is not yet released in (worldwide) markets. This does not alter our adherence to PLOS ONE policies on sharing data and materials.

Introduction

It is well established that breastfeeding brings many health benefits to both mother [1, 2] and infant. Acute benefits for infants include protection against neonatal morbidity and mortality [3] and against proinflammatory gastrointestinal conditions and infections [4, 5], while long-term effects include reduced incidence of asthma [6] and (food) allergies, improved cardio-metabolic health and reduced obesity risk [7–9], and improved neurocognitive functions [10, 11]. Many aspects of breastfeeding may contribute to these health benefits. Aside from the difference in feeding mode (i.e., breast versus bottle feeding [12–14]) and nutritional composition tailored to age-specific and individual needs [15], human milk (HM) contains bioactive compounds that contribute to its functional benefits [15–17] over infant formula (IF). These compounds include hormones, growth factors, and immunomodulators, which can all contribute to healthy growth, gut maturation, microbiota, and development of the brain and immune system [15].

Selected bioactive compounds can and have been added to IF to bring the nutritional composition of IF closer to that of HM [16, 18]. However, differences between IF and HM remain, including important differences in the dietary lipid fraction. Lipids are an important constituent of milk, providing energy and building blocks that can be used as structural components of cell membranes [19]. In mammalian milk, it is a complex mixture of different types of lipids structured as milk fat globules (MFGs; Fig 1A). These are formed in the mammary epithelial cells and secreted through exocytosis in the alveolar lumen, resulting in globules with a core of triglycerides (TG) and cholesteryl esters (CE) (98% of total lipids) surrounded by a native biological membrane composed mainly of phospholipids, proteins and enzymes, free cholesterol, glycolipids and glycoproteins—the milk fat globule membrane (MFGM). The MFGM accounts for 2–6% of the total MFG mass, of which 25–60% consists of MFGM proteins (1–4% of total milk protein) and polar lipids contributing 0.2–1% to total milk lipid content [20, 21]. The lipid globule size ranges between 1 and 10 μm with an average mode diameter of 4 μm in mature milk [22, 23].

thumbnail
Download:
Fig 1. Schematic overview of lipid globules.

Schematic overview of lipid globules with tri-layer of MFGM in human milk (A), lipid droplet with MFGM fragments at the droplet interface (B; Nuturis), lipid droplet in standard infant formula with MGFM dry blended (C) and standard infant formula without MGFM but with milk proteins at the droplet interface (D). Visual representation of the size and ratios of different MFGM and milk protein molecules does not fully reflect reality.

https://doi.org/10.1371/journal.pone.0282816.g001

In contrast to the complex supramolecular structure observed in HM, lipid droplets in IF have a much smaller mode diameter of approximately 0.4 μm and consist of a triglyceride core with casein and whey milk protein adhering to the globule surface ([22, 24, 25]; Fig 1B). IF may contain low concentrations of vegetable lecithin added as an anti-oxidant and/or as an emulsifier, but contains no or only traces of sphingomyelin nor cholesterol, unless dairy lipids are used as ingredients [22].

Although the primary function of MFGM is to allow the TG core to be secreted in the alveolar lumen and remain in a stable emulsion in the milk, it has been suggested that its constituents are involved in many biological functions, including cell signalling and growth, anti-microbial and anti-viral defence, apoptosis, differentiation, myelination and energy metabolism [20, 21]. For this reason, adding MFGM fragments as an ingredient to IF could potentially contribute to improved neurodevelopment, gut maturation, metabolism and immunity of formula fed (FF) infants, bringing their developmental trajectory closer to that of BF infants [26, 27]. Indeed, a recent meta-analysis by Ambrozej et al [28] showed, despite limited clinical evidence, that MFGM-supplemented formula reduced otitis media infection incidence and improved cognitive development compared to non-supplemented formula. These reported clinical benefits suggest that adding MFGM narrows the gap between HM and IF composition and function.

However, it is important to highlight that there is more to the structure of human MFG than only MFGM. While the sole addition of MFGM fragments to IF provides functional membrane lipids and proteins, it does not result in the same MFG structure as found in HM. Isolating dairy MFGM from bovine milk disrupts the membrane and results in ingredients enriched in MFGM fragments [29, 30]. Subsequent additions of a MFGM ingredient to standard IF will result in small lipid droplets, with the MFGM fragments remaining mainly in the aqueous phase, with only limited amounts of phospholipids at the interface of the lipid droplets ([31, 32], Fig 1C). It is thought that both globule size and the MFGM at the interface of the MFG affect lipid digestion and absorption kinetics, proteolysis, plasma TG appearance and β-oxidation [33–35]. Given the dependence of organs and tissues in early life on dietary lipids as energy and building blocks, differential bioavailability of these components after ingestion may impact an infant’s developmental trajectory and (long-term) function. Thus, the supramolecular structure of lipid droplets in infant nutrition is hypothesized to affect infant metabolic and neurocognitive development and (long-term) function, possibly contributing to some of the developmental differences observed between BF and FF infants.

A concept IF (Nuturis) was developed to narrow the gap between standard IF and human MFG structure by addressing both the size and the interfacial composition. The concept IF more closely mimics the human MFG, with lipid droplets with associated HM lipid components (such as phospholipids, cholesterol and MFGM fragments) and a volume-weighted mode diameter of 3–5 μm (in line with that of human milk, despite not providing a true tri-layer MFGM) ([22, 24, 25]; Fig 1D). We performed three mouse experiments, using either egg or milk derived phospholipids, to establish the distinct effects of early life exposure to supramolecular lipid structure on brain and metabolic health outcomes, while excluding the potential effect of added phospholipids.

Materials and methods

Three separate studies were conducted, using mouse models with a similar design, at three different laboratories in the Netherlands. All studies included an exposure to experimental diets varying in lipid droplet structure during a standardized period early in life, but other experimental conditions (e.g., diets, husbandry), experimental designs, and readout parameters, differed per study (see below for more detail). Study 1 aimed to investigate the impact of lipid droplet structure on bioavailability of fatty acids (FA) and their incorporation in functional membranes. Study 2 and 3 investigated the long-term effects of early life exposure to lipid droplet structure on adult metabolic health and cognitive function, respectively.

Animals & care

All animal procedures were performed according to general guidelines for the care and use of experimental animals, and the experiments were compliant to the EU Directive on the protection of animals used for scientific purposes and the Dutch Animal Welfare Act (Wod), by means of review by an external independent Animal Ethics Committee, approval by the Competent Authority and the internal animal welfare body. All animals were housed in Makrolon type III cages, containing Aspen wood shavings, a shelter and nestlets in a controlled environment (12/12 light/dark cycle with lights on at 08:00, 21±2°C) with ad libitum access to food (see below) and tap-water. Experimental animals were bred in-house. As the body weight, body composition and behavior of mice can vary between sexes, and it was beyond scope of these studies to compare male and female groups, only animals of one sex (male offspring) were used as experimental animals. Dams and female offspring were present during breeding and after birth and were removed from the study at weaning age.

Primiparous breeder dams and males were obtained from a commercial breeder (Study 1 and 2: C57Bl/6JOlaHsd, Envigo, The Netherlands; Study 3: C57Bl/6J, Charles River Laboratories, Germany). Prior to breeding, females were housed in pairs and males were housed individually to prevent fighting. Breeding was performed by introducing one (Study 3) or two females (Study 1 and 2) into the cage of a male mouse for three consecutive days; all animals were thereafter returned to their home cage. Females were individually housed from 14 days after breeding and were provided with nest material (Nestlet) and left undisturbed until birth of the litter. The day that the litter was born was considered postnatal day (PN) 0.

Experimental design and outcome parameters

Study 1.

To induce impaired n-3 accumulation in the offspring brain, at four weeks prior to breeding, females were switched to a semi-synthetic American Institute of Nutrition-93 Growth (AIN-93G; [36]) based rodent diet with 7% lipids containing 2.58% C18:2n-6 and 0.01% C18:3n-3 as source of n-6 and n-3 PUFAs respectively (n-3 deficient diet; n-3DEF1.). The n-3DEF1 diet was continued throughout pregnancy and lactation. Male breeders were kept on AIN-93 Maintenance (AIN-93M). At PN2, litters were culled to six pups per dam (each litter containing at least two males and two females). From PN16 onwards, litters (with dam) were randomly assigned to receive either an experimental diet with added egg phospholipids as ingredient (ingredient, ING1) or a diet with the same composition, but with an adapted supramolecular lipid structure (structure, STR1). At PN21 the dams and female offspring were removed and the male offspring (ING1, n = 4 litters [12 offspring]; STR1, n = 5 litters [15 offspring]) remained housed with their littermates and their respective diets continued. At PN28 the offspring were housed individually. At P42, animals were euthanized by deep anesthesia (isoflurane N2O-O2) followed by decapitation.

The liver and brain were harvested and the hippocampus was isolated from one hemisphere. All tissues were snap frozen (-80° C). Frozen livers and intact brain hemispheres were homogenized in phosphate buffered saline (PBS), and tissue fatty acid composition was analyzed using gas chromatography, as previously described [37]. Tissue fatty acid classes and individual fatty acid species were expressed as a percentage of total fatty acids (% FA). As exploratory readouts, mRNA expression of myelin-associated glycoprotein (MAG), synaptophysin (SYP) and ionized calcium binding adaptor molecule 1 (Iba1) were measured in the hippocampus as molecular markers for myelin integrity, synaptic plasticity and microglia activation, respectively; these are also known to be disrupted by n-3 deficiency during development [38–40]. Total ribonucleic acid (RNA) from the hippocampus was isolated with the RNeasy mini kit (©QIAGEN) according to the manufacturer’s instructions. Isolated RNA was used to synthesize complementary deoxyribonucleic acid (cDNA) with the iScripttm cDNA Synthesis Kit (Bio-Rad) according to the manufacturer’s instructions. Quantitative polymerase chain reaction (qPCR) was performed with the obtained cDNA, SYBR™ Select Master Mix (Applied Biosystems™), and validated primers to quantify gene expression of MAG (F- CCTGGATCTGGAGGAGGTGA, R- TTCACTGTGGGCTTCCAAGG), IBA1 (F- GATTTGCAGGGAGGAAAAGCT, R- AACCCCAAGTTTCTCCAGCAT), SYP (F- GAGGGACCCTGTGACTTCAG, R- AGCCTGTCTCCTTGAACACG) and housekeeping genes 18s, Gusb, HPRT1, B2M, TBP, Tubb3, and Actin. Gene expression of MAG, IBA1 and SYP was analysed relative to housekeeping genes with the qBase+ software (biogazelle version 3.3).

Due to the experimental design in this study involving maternal diet exposure during pregnancy and lactation, the litters rather than individual pups were regarded as experimental units. Tissue fatty acids and gene expression levels were therefore expressed per litter (i.e., average of all individuals within litter). A group of offspring born from n-3DEF1 dams and kept on n-3DEF1 diet until PN42 were included in the study as a deficient reference group (DEF1, n = 2 litters [7 offspring]) for tissue fatty acid composition.

In addition, a group of mice born from dams that were kept during (pre-) pregnancy and lactation on an n-3-sufficient control diet (AIN-93G based rodent diet with 7% fat containing 2.63% C18:2n-6 and 0.45% C18:3n-3 as source of n-6 and n-3 PUFAs, respectively), and exposed to a diet containing standard infant formula between PN16 and PN42, was included in the study as a reference for tissue fatty acid composition of (non-deficient) male C57Bl/6J mice (REF1, n = 6 litters [17 offspring]).

Study 2.

To study effects of early life dietary lipid structure on adult sensitivity to diet-induced obesity, an experimental design was used as previously published [41]. In short, breeding females were kept on semi-synthetic AIN-93G diet starting two weeks prior to breeding. At PN2, litters were randomized and culled to 6 pups per dam (2 females, 4 males) to standardize litter size and composition as these factors may affect sensitivity to later in life (diet induced) obesity [42]. From PN16 onwards, litters (with dam) were randomly assigned to receive either an experimental diet with added MFGM as ingredient (ING2) or a diet with the same composition and adapted supramolecular lipid structure (STR2). At PN21, male offspring (ING2, n = 12; STR2, n = 12) were weaned and housed in pairs (with littermate) for the remainder of the study. The animals were maintained on their respective experimental diet until PN42 and were thereafter exposed to a semi-synthetic Western-style diet (WSD, 20%, w/w fat) until the end of the study at PN98. Food intake of the animals was measured (per cage) from PN42 onwards by weighing the food on the rack every other week. At PN42, PN70 and PN98, animals were briefly anaesthetized (isoflurane N2O-O2) to allow body composition analysis using dual-energy X-ray absorptiometry scanning (fat mass and lean mass; DEXA, PIXImus imager, GE Lunar). Relative fat mass was calculated as a percentage of body weight (% fat). Directly following the DEXA scan at PN98, anaesthetized mice were euthanized using cervical dislocation. Subcutaneous (inguinal) and visceral (epididymal, retroperitoneal and perirenal) white adipose tissues were dissected and weighed and subcutaneous/visceral white adipose tissue ratio was calculated.

A group of mice, raised on a diet containing standard infant formula between PN16 and PN42 and exposed to a standard low fat maintenance diet (AIN93-M) during adulthood, was included in the study as a reference (REF2, n = 12) for normal body composition development of male C57Bl/6J mice on standard (low fat) semi-synthetic diet [41].

Study 3.

Breeder animals were kept on a standard grain based rodent diet (Altromin 1310M, Germany) during breeding and lactation. At PN2, litter size was standardized to 3 pups per dam (2 males, 1 female or 1 male, 2 females), which is considered a small litter size for C57Bl/6J mice. Small litter rearing in rodents is a paradigm known to induce a predisposition towards obesity [42]. From PN16 onwards litters (with dam) were randomly assigned to receive an experimental diet with added MFGM as ingredient (ING3) or a diet with the same composition and adapted supramolecular lipid structure (STR3). At PN21 male offspring were weaned and housed in pairs (with littermate) for the remainder of the study (ING3, n = 10; STR3, n = 12). Animals were kept on their respective experimental diet until PN42 and were thereafter exposed to AIN-93M diet until PN98, the end of the study. Food intake of the animals was measured (per cage) from PN42 onwards by weighing the food on the rack every other week. At PN42 and PN98 the body composition of the mice was determined by EchoMRI Whole Body Composition Analyser (EchoMRI, Houston, FL, USA). Relative fat mass was calculated as a percentage of body weight (% fat).

At PN70 and PN71 exploratory activity was assessed during the light phase using an open field test (OF) and memory performance was assessed using a novel object recognition test (NOR) as previously described [43], with some adaptations to protocols. Briefly, the OF test comprised a five-minute trial in which mice were introduced to the center of a square test area (50 x 50 cm) and allowed to explore the area. The total distance moved, and the time spent in the center square of the arena, were recorded using Ethovision® XT 11.5 (Noldus, Wageningen, The Netherlands), using the nose, center and tail base of the mouse for tracking. Prior to each test, mice were housed individually for 30 minutes, in a clean cage in the room where behavior testing took place. Cage mates were tested consecutively, but cages with mice were taken at random from the animal room. Mice were returned to their home cage after the tests. During the first trial of the NOR, which started 60 min after the OF, mice were introduced again to the same test area in which there were now two identical objects, placed in opposite corners of the area. Mice were allowed to explore the area and the objects for five minutes and were returned to their home cage thereafter. On the next day (test trial), this procedure was repeated, but one of the two objects in the test area was replaced by a new object which was different in shape but similar in size and material. The time that was spent exploring each object during the test trial was recorded. Performance was evaluated by calculating a recognition index: (N/(N+F)) where N is time spent exploring the novel object and F is time spent exploring the familiar object. A higher index reflects better memory performance.

A group of mice that were raised in a normal size litter before weaning (n = 6 pups per litter and litters containing at least 2 males and 2 females) and exposed to a diet containing standard infant formula between PN16 and PN42, followed by AIN-93M during adulthood, was included in the study as a reference (REF3, n = 12) for normal body composition development of male C57Bl/6J mice.

Experimental diets

All diets used in Study 1 were supplied by Sniff Spezialdiäten (Soest, Germany), whilst diets used in Studies 2 and 3 were supplied by Research Diet Services (Wijk bij Duurstede, the Netherlands), unless specified otherwise. The experimental diets were provided to the animals in the form of a soft dough ball that was prepared fresh each day and placed on the cage floor to allow easy access for the animals. The ING and STR experimental diets were semi-synthetic with a macronutrient composition according to AIN-93G as previously described [37, 41, 44]. In short, the experimental diets consisted of 28.3% w/w IF powder complemented with additional protein, carbohydrates and micronutrients to mimic AIN-93G macronutrient composition. Micronutrients were similar in both diets, and compliant to requirements of AIN-93G, but not exactly similar to micronutrient levels in AIN-93G due to the addition of the IF powders. The lipid fraction in the experimental diets was entirely derived from the IF powders. The IF powders contained phospholipids (PL, 0.4 g/100g powder) either sourced from egg yolk (Study 1) or MFGM-rich beta-serum and were produced in a pilot plant (Danone Nutricia Research, Utrecht, The Netherlands) using the same recipe and ingredients per study. ING and STR experimental diets were always equal in nutrient composition but differed from each other only in the supramolecular structure of lipid droplets as a result of an adapted manufacturing process for the IF powder, as previously described [44, 45]. Lipid droplets in STR diets were large in size, with thin interfaces likely covered by phospholipids, while ING diets comprised small lipid droplets (Table 1); although phospholipids were present, the interface of the lipid droplets was composed of proteins (Fig 2).

thumbnail
Download:
Fig 2.

Transmission electron microscopy (TEM) images of experimental diets STR (A) and ING (B). A1-3: Large sized fat droplets displaying a thin interface mainly, indicating the presence of phospholipids. A2-3: a close-up on the interface of a lipid droplet with few associated casein micelles. B1: Small sized lipid droplets aggregated by proteins with MFGM fragments in the aqueous phase (B2). B3: A close-up on clustering of lipid droplets and their interfaces composed of protein. Solid arrows point to large casein/protein aggregates, clustering lipid droplets; dashed arrows point to interfacial proteins; dotted arrows point to MFGM fragments or vesicles in the aqueous phase. Sample preparation and TEM imaging was performed as previously described [45].

https://doi.org/10.1371/journal.pone.0282816.g002

thumbnail
Download:
Table 1. Particle size distribution of lipid droplets in experimental diets.

https://doi.org/10.1371/journal.pone.0282816.t001

Sample size and statistical analysis

The data presented in Study 1 was exploratory in nature and a small sample size was used for experimental groups based on the number of litters that were generated after breeding. To determine the sample sizes required for the experimental groups in Study 2 and 3, power calculations were performed based on published data from previous experiments with comparable design and diet interventions [44, 46]. Using an error-probability of 5% and power of 80% the sample sizes were calculated to be 12 animals per group for both studies. In study 3, one animal in the ING3 group was taken out of the experiment shortly after weaning due to malocclusion; its cage mate was removed as well, resulting in a group size of 10.

Data were analyzed by an experimenter blind to the group allocation. All data were analyzed with SPSS 19.0 software (SPSS Benelux, Gorinchem, The Netherlands). In Study 1, data were analyzed using one way ANOVA with litters regarded as experimental unit rather than individual animals due to the maternal exposure to n-3 deficient diet. For each litter values were calculated based on the average of all experimental animals within the litter. In Study 2 and 3, individual animals were considered as experimental units and data were analyzed using linear mixed models that included litter of origin and/or home cage i.e., the shared environment between individuals within groups, as random factor in the model. Fixed factors for all studies included group, and for Study 2 additional fixed factors were time (repeated) and its interaction with experimental diet.

When applicable, significant main effects of group and/or group interaction effects were followed by post-hoc comparisons (Least Squares Difference, LSD) between experimental groups. Direct comparisons between experimental diet groups and reference groups were omitted as these comparisons were not meaningful due to different nutrient composition of the diets. All data are presented as mean ± SEM, differences between ING and STR are considered significant at p < 0.05.

Results

Study 1

At P42, groups did not differ in body weight (g) (n-3DEF1, 23.2 ± 0.27; ING1, 22.0 ± 1.67; STR1, 22.3 ± 0.45; REF1, 22.9 ± 0.51) or brain weight (mg) (n-3DEF1, 414.0 ± 5.01; ING1, 414.2 ± 8.31; STR1, 408.0 ± 8.34; REF1, 411.3 ± 2.95). Liver and brain tissue fatty acid composition are presented in Tables 2 and 3, respectively. Exposure to n-3DEF1 diet resulted in lower tissue levels of linoleic acid (LA) and n-3 long chain polyunsaturated [(LC)PUFA] species and increased in n-6 docosapentaenoic acid (DPA) and other n-6 PUFA species in brain specifically. Animals that were kept on STR1 compared to ING1 diet after maternal alpha-linolenic (ALA) deficiency showed significantly higher levels of LA and the n-3 PUFA species ALA, eicosapentaenoic acid (EPA) and n-3 DPA in liver tissue (Table 2). In brain, STR1 resulted in higher total n-3 (LC)PUFA, including DHA, and lower total n-6 (LC)PUFA levels, including arachidonic acid and n-6 DPA (Table 3). mRNA expression of myelin-associated glycoprotein (MAG) in the hippocampus appeared to be increased in animals on STR1 compared to ING1 (F(1,7) = 6.74, p = 0.04, Fig 3A), but hippocampal expression of synaptophysin (SYP) and ionized calcium-binding adaptor molecule 1 (Iba 1) remained unaffected by diet (Fig 3B and 3C).

thumbnail
Download:
Fig 3. Relative mRNA expression of MAG, SYP and Iba 1 in hippocampus of mice exposed to experimental diets following previous maternal n-3 deficiency.

Relative mRNA expression in hippocampus of mice exposed to experimental diet (P16-42) with added phospholipid ingredient (ING, n = 4 litters [12 mice]) and experimental diet with adapted supramolecular lipid structure (STR1, n = 5 litters [15 mice]). MAG, myelin-associated glycoprotein, Syp, Synaptophysin; Iba 1, ionized calcium-binding adaptor molecule 1; ING1, group receiving diet with altered ingredient (Study 1, egg phospholipids); STR, group receiving diet with altered structure. Data are means ± SEM; * significant difference between ING and STR group (p < 0.05).

https://doi.org/10.1371/journal.pone.0282816.g003

thumbnail
Download:
Table 2. Fatty acid composition in liver.

https://doi.org/10.1371/journal.pone.0282816.t002

thumbnail
Download:
Table 3. Fatty acid composition in brain tissue.

https://doi.org/10.1371/journal.pone.0282816.t003

Study 2

At P42, the final day of the early life diet intervention, there were no differences between groups exposed to ING2 and STR2 in body weight (g) and body composition. However, body weight gain on WSD diet during adulthood (from P42 to P98) was lower in the group that had previously been exposed to STR2 compared to ING2 (diet*week interaction (F(4,33) = 15.689, p < 0.01), Fig 4A). DEXA scans revealed that, while lean mass development over time was not significantly different (Fig 4B), animals that were raised on STR2 showed reduced adult body fat accumulation compared to animals that had been raised on ING2 (diet*week interaction: fat mass, [F(4,33) = 12.455, p < 0.01]; relative fat mass, [F(4,33) = 8.483, p < 0.01], Fig 4C and 4D). At PN98, the subcutaneous to visceral white adipose tissue ratio was significantly lower in animals previously exposed to STR2 compared to ING2 ((F(2,15) = 7.834, p = 0.005), ING2, 2.84 ± 0.11; STR2, 2.37 ± 0.17; REF2, 2.06 ± 0.09). Average daily energy intake between PN42 and 98 was comparable between groups (ING2, 56.3 ± 1.20; STR2, 55.3 ± 1.98; REF2, 53.7 ± 1.93 kJ/day/animal).

thumbnail
Download:
Fig 4. Body weight and body composition development during WSD challenge (week 6–14) of mice that had previously been exposed to experimental diets.

(A) body weight, (B) lean mass, (C) fat mass and (D) relative fat mass of adult mice on Western-style diet (weeks 6–14) that were previously exposed (postnatal day 16–42) to experimental diet with added phospholipid ingredient (ING2, n = 12) or experimental diet with adapted supramolecular lipid structure (STR2, n = 12). A group of mice that were raised on a neutral diet and exposed to low fat AIN-93-M were monitored and included as a reference for body weight and body composition development under non-challenged conditions (REF2, n = 12). ING2, group receiving diet with altered ingredient (Study 2, milk fat globule membrane); STR2, group receiving diet with altered structure; REF2, reference diet; P, postnatal day. Data are means ± SEM; *significant difference between ING and STR group (p < 0.05).

https://doi.org/10.1371/journal.pone.0282816.g004

Study 3

At P42, there were no differences between the ING3 and STR3 exposed groups in body weight or body composition (Fig 5A–5D). While body weight and lean body mass were not different between groups in adulthood at PN98 and the difference between groups on fat mass did not reach significance (Fig 5A–5C respectively), the relative fat mass of STR3 exposed animals at P98 was lower compared to that of ING3 ([F(1, 9) = 6.869, p = 0.028], Fig 5D). Average daily energy intake between PN42 and 98 was comparable between groups (ING3, 59.6 ± 1.85; STR3, 58.8 ± 1.37; REF3, 57.8 ± 1.45 kJ/day/animal). During the open field test at PN 70 body weight was not different between diet groups (ING3, 27.1 ± 0.76 g; STR 28.6 ± 0.31 g) and groups did not display differences in distance travelled or time (%) spent in the center square (Fig 6A and 6B). The recognition index during the novel object recognition test at P71 was, however, significantly higher in animals previously exposed to STR3 compared to ING3 (F(2,31) = 3.364, p = 0.48, Fig 6C).

thumbnail
Download:
Fig 5. Body weight and body composition at day 98.

(A) body weight, (B) lean body mass (C) fat mass (D) relative fat mass of adult male mice that had previously been exposed (postnatal day P16-42) to experimental diet with added ingredient (ING3, n = 10) or experimental diet with adapted structure (STR3, n = 12). ING3, group receiving diet with altered ingredient (Study 3, milk fat globule membrane); STR3, group receiving diet with altered structure; REF3, reference diet; P, postnatal day. Data are means ± SEM; * = significant difference between ING3 and STR3 (p < 0.05).

https://doi.org/10.1371/journal.pone.0282816.g005

thumbnail
Download:
Fig 6. Exploration behavior in the open field test and memory performance in novel object recognition test.

(A) total distance moved in open field, (B) relative time spent in center of the open field and (C) novel object recognition index of adult that had previously been exposed (postnatal day 16–42) to experimental diet with added ingredient (ING3, n = 10) or experimental diet with adapted structure (STR3, n = 12). ING3, group receiving diet with altered ingredient (Study 3, milk fat globule membrane); STR3, group receiving diet with altered structure. Data are means ± SEM; * = significant difference between ING3 and STR3 (p < 0.05).

https://doi.org/10.1371/journal.pone.0282816.g006

Discussion

Here, we have demonstrated for the first time that the supramolecular structure of lipids in the early life diet has the capacity to impact various (long-term) health outcomes. Mice that were exposed in early life to IF in which lipids were organized as large, phospholipid-coated lipid droplets showed better incorporation of n-3 (LC)PUFA in liver and brain tissue during development compared to mice that had been exposed to IF in which the exact same ingredients were present, but that lacked the complex supramolecular lipid structure. Moreover, adult body fat accumulation was reduced in different obesity models and adult cognitive function was improved, compared to mice that had been exposed to IF in which the exact same ingredients were present, but that lacked the complex supramolecular lipid structure. In other words, when the composition, size and structure of the lipids was closer to the structure of human MFG, health benefits resulted. These data suggest that the typical supramolecular structure of lipid globules themselves may be a significant factor contributing to the lifelong advantages observed in BF compared to FF infants.

In previous studies, using similar nutritional programming models, we have comprehensively shown that early life exposure to concept IFs containing large, MFGM coated lipid droplets resulted in beneficial effects on later life body composition [41, 44, 47, 48], metabolic health [49–54] and brain outcomes [43, 46, 55, 56], when compared to IFs with small lipid droplets and no MFGM added. However, due to the experimental design of these studies, the effects of the mere presence of MFGM versus effects of the complex supramolecular lipid droplet structure with large lipid droplets and MFGM fragments at the interface could not be distinguished. The results from the current experiments suggest that these previous findings were, in part, mediated by the modified dietary lipid structure and that we should not underestimate the role that the supramolecular lipid droplet structure of IF plays in programming later life health.

Interestingly, as exploratory finding in Study 1, we observed that the hippocampal gene expression of MAG appeared to be increased in STR compared to ING exposed animals, while expression of Iba 1 and SYP, genetic markers related to neuroinflammatory processes and neuronal plasticity respectively, appeared to remain unaffected by dietary lipid structure. In human infants, MAG expression is increased in brain tissue during postnatal myelination [57], and several imaging studies report a positive association between breastfeeding and infant white matter development [58, 59]. Although, to date, clinical evidence to associate the consumption of human milk to the expression of genes related to neuronal plasticity and neuroinflammation is lacking, it is hypothesized that environmental factors, including diet, may also modify these developmental processes [60]. Indeed, several preclinical studies in rodents suggest that MFGM as added ingredient to the early life diet may target genetic markers for these processes in brain tissue [61, 62]. While the results on hippocampal gene expression should be interpreted with care because of their explorative nature, the results suggest that the specific structural properties of HM lipid globules may contribute specifically to myelination but not to neuroinflammation or neuronal plasticity during infant brain development. Future studies are warranted to confirm these findings and to further investigate the potential underlying mechanisms. Clinical studies with IFs supplemented with MFGM have shown promising effects on brain and immune outcomes, yet the evidence base is still small and heterogeneous due to differences in: MGFM sources, formula composition, intervention duration and methodologies used to measure outcomes at different timepoints [28]. Some studies have shown effects of supplementation with MGFM, sometimes with other added bioactive ingredients, on neurocognitive and language scores at 6 [63] and 12 months [64–66], and at 4 years of age [67]. Although there are some ambiguous outcomes, there is also clinical evidence on reductions in otitis media, upper respiratory tract infections and antipyretic use [28]. The clinical growth equivalence and tolerance studies published to date show that MGFM, as an ingredient, can be safely added to IF, yet there is no evidence that the mere presence of MFGM in IF modulates infant growth trajectories or has a protective effect against overweight or metabolic disturbances. Several studies show similar growth patterns, both weight and height, at 4, 6, 12 and 18 months [64–66, 68–70]. In addition, some studies show differences in plasma cholesterol and plasma and erythrocyte polar lipids between experimental and control IF, but these differences were no longer observed at 12 months [71]. The current experiments suggest that, aside from the beneficial impact of MFGM as an ingredient on cognitive and immune outcomes, the specific supramolecular lipid structure in IF with large, MFGM-coated lipid droplets contributes to the wealth of neurocognitive, body composition and metabolic health benefits previously reported [44, 46, 47, 51, 52, 54, 56].

The precise mechanisms by which the supramolecular structure of dietary lipid droplets influences (later life) body composition, metabolic health and neurocognitive function remain to be elucidated, but there are indications from several studies that lipid structure impacts absorption and digestion kinetics, resulting in a different appearance of lipids and (postprandial) hormones in the bloodstream after ingestion [33, 72, 73]. Such different bioavailability of lipids may alter their metabolic fate; this is hypothesized to program adipocyte energy metabolism towards reduced lipid storage in white adipose tissue [74]. Moreover, any differences in bioavailability of lipids and circulating hormones to the developing brain is hypothesized to affect brain development and neurocognitive function. Circulating lipids, including (n-3) LCPUFAs, are incorporated into neuronal tissue early in life and drive key neurodevelopmental processes, such as myelination, and hormones derived from other organs and tissues may be used as neurodevelopmental signals [75]. Thus, early exposure to a more human-like MFG structure may support brain development and cognitive function via bioavailability of lipids, and program metabolic homeostasis via alterations in energy storage and expenditure.

Across three separate but linked studies, we demonstrate that early life exposure to large lipid droplets with a complex membrane at the interface, which closely mimics the human MFG structure, programs adult brain and metabolic health outcomes in pre-clinical animal models. These effects were not generated through the addition of MFGM as an ingredient nor via other differences in dietary composition. Moving beyond the addition of MFGM as an ingredient in IF to a more nuanced physical alteration in the supramolecular structure of lipid droplets in IF offers new opportunities for nutrition during infancy to program later life health.

References

  1. 1. Chowdhury R, Sinha B, Sankar MJ, Taneja S, Bhandari N, Rollins N, et al. Breastfeeding and maternal health outcomes: a systematic review and meta-analysis. Acta Paediatr. 2015;104(467):96–113. pmid:26172878
  2. 2. Tschiderer L, Seekircher L, Kunutsor SK, Peters SAE, O’Keeffe LM, Willeit P. Breastfeeding Is Associated With a Reduced Maternal Cardiovascular Risk: Systematic Review and Meta-Analysis Involving Data From 8 Studies and 1 192 700 Parous Women. J Am Heart Assoc. 2022;11(2):e022746.
  3. 3. Khan J, Vesel L, Bahl R, Martines JC. Timing of breastfeeding initiation and exclusivity of breastfeeding during the first month of life: effects on neonatal mortality and morbidity—a systematic review and meta-analysis. Matern Child Health J. 2015;19(3):468–79. pmid:24894730
  4. 4. Salone LR, Vann WF Jr., Dee DL. Breastfeeding: an overview of oral and general health benefits. J Am Dent Assoc. 2013;144(2):143–51. pmid:23372130
  5. 5. Frank NM, Lynch KF, Uusitalo U, Yang J, Lonnrot M, Virtanen SM, et al. The relationship between breastfeeding and reported respiratory and gastrointestinal infection rates in young children. BMC Pediatr. 2019;19(1):339. pmid:31533753
  6. 6. Lodge CJ, Tan DJ, Lau MX, Dai X, Tham R, Lowe AJ, et al. Breastfeeding and asthma and allergies: a systematic review and meta-analysis. Acta Paediatr. 2015;104(467):38–53. pmid:26192405
  7. 7. Ip S, Chung M, Raman G, Trikalinos TA, Lau J. A summary of the Agency for Healthcare Research and Quality’s evidence report on breastfeeding in developed countries. Breastfeed Med. 2009;4 Suppl 1:S17–30. pmid:19827919
  8. 8. Owen CG, Martin RM, Whincup PH, Smith GD, Cook DG. Does breastfeeding influence risk of type 2 diabetes in later life? A quantitative analysis of published evidence. Am J Clin Nutr. 2006;84(5):1043–54. pmid:17093156
  9. 9. Owen CG, Whincup PH, Kaye SJ, Martin RM, Davey Smith G, Cook DG, et al. Does initial breastfeeding lead to lower blood cholesterol in adult life? A quantitative review of the evidence. Am J Clin Nutr. 2008;88(2):305–14. pmid:18689365
  10. 10. Anderson JW, Johnstone BM, Remley DT. Breast-feeding and cognitive development: a meta-analysis. Am J Clin Nutr. 1999;70(4):525–35. pmid:10500022
  11. 11. Hernandez-Luengo M, Alvarez-Bueno C, Martinez-Hortelano JA, Cavero-Redondo I, Martinez-Vizcaino V, Notario-Pacheco B. The relationship between breastfeeding and motor development in children: a systematic review and meta-analysis. Nutr Rev. 2022;80(8):1827–35. pmid:35325229
  12. 12. Keim SA, Sullivan JA, Sheppard K, Smith K, Ingol T, Boone KM, et al. Feeding Infants at the Breast or Feeding Expressed Human Milk: Long-Term Cognitive, Executive Function, and Eating Behavior Outcomes at Age 6 Years. J Pediatr. 2021;233:66–73 e1.
  13. 13. Boone KM, Geraghty SR, Keim SA. Feeding at the Breast and Expressed Milk Feeding: Associations with Otitis Media and Diarrhea in Infants. J Pediatr. 2016;174:118–25. pmid:27174145
  14. 14. DiSantis KI, Hodges EA, Fisher JO. The association of breastfeeding duration with later maternal feeding styles in infancy and toddlerhood: a cross-sectional analysis. Int J Behav Nutr Phys Act. 2013;10:53. pmid:23621981
  15. 15. Ballard O, Morrow AL. Human milk composition: nutrients and bioactive factors. Pediatr Clin North Am. 2013;60(1):49–74. pmid:23178060
  16. 16. Almeida CC, Mendonca Pereira BF, Leandro KC, Costa MP, Spisso BF, Conte-Junior CA. Bioactive Compounds in Infant Formula and Their Effects on Infant Nutrition and Health: A Systematic Literature Review. Int J Food Sci. 2021;2021:8850080. pmid:34095293
  17. 17. Haschke F, Haiden N, Thakkar SK. Nutritive and bioactive proteins in breastmilk. Annals of Nutrition and Metabolism. 2017;69(2):17–26.
  18. 18. Demmelmair H, Prell C, Timby N, Lonnerdal B. Benefits of Lactoferrin, Osteopontin and Milk Fat Globule Membranes for Infants. Nutrients. 2017;9(8).
  19. 19. Delplanque B, Gibson R, Koletzko B, Lapillonne A, Strandvik B. Lipid Quality in Infant Nutrition: Current Knowledge and Future Opportunities. J Pediatr Gastroenterol Nutr. 2015;61(1):8–17. pmid:25883056
  20. 20. Lee H, Padhi E, Hasegawa Y, Larke J, Parenti M, Wang A, et al. Compositional Dynamics of the Milk Fat Globule and Its Role in Infant Development. Front Pediatr. 2018;6:313. pmid:30460213
  21. 21. Manoni M, Di Lorenzo C, Ottoboni M, Tretola M, Pinotti L. Comparative Proteomics of Milk Fat Globule Membrane (MFGM) Proteome across Species and Lactation Stages and the Potentials of MFGM Fractions in Infant Formula Preparation. Foods. 2020;9(9). pmid:32906730
  22. 22. Michalski MC, Briard V, Michel F, Tasson F, Poulain P. Size distribution of fat globules in human colostrum, breast milk, and infant formula. Journal of dairy science. 2005;88(6):1927–40. pmid:15905422
  23. 23. Thum C, Wall C, Day L, Szeto IMY, Li F, Yan Y, et al. Changes in Human Milk Fat Globule Composition Throughout Lactation: A Review. Front Nutr. 2022;9:835856. pmid:35634409
  24. 24. Fave G, Coste TC, Armand M. Physicochemical properties of lipids: new strategies to manage fatty acid bioavailability. Cell Mol Biol (Noisy-le-grand). 2004;50(7):815–31. pmid:15672466
  25. 25. Michalski MC, Calzada C, Makino A, Michaud S, Guichardant M. Oxidation products of polyunsaturated fatty acids in infant formulas compared to human milk—a preliminary study. Mol Nutr Food Res. 2008;52(12):1478–85. pmid:18792926
  26. 26. Brink LR, Lonnerdal B. Milk fat globule membrane: the role of its various components in infant health and development. J Nutr Biochem. 2020;85:108465. pmid:32758540
  27. 27. Fontecha J, Brink L, Wu S, Pouliot Y, Visioli F, Jimenez-Flores R. Sources, Production, and Clinical Treatments of Milk Fat Globule Membrane for Infant Nutrition and Well-Being. Nutrients. 2020;12(6). pmid:32486129
  28. 28. Ambrozej D, Dumycz K, Dziechciarz P, Ruszczynski M. Milk Fat Globule Membrane Supplementation in Children: Systematic Review with Meta-Analysis. Nutrients. 2021;13(3). pmid:33668227
  29. 29. Contarini G, Povolo M. Phospholipids in milk fat: composition, biological and technological significance, and analytical strategies. Int J Mol Sci. 2013;14(2):2808–31. pmid:23434649
  30. 30. Gallier S, Gragson D, Jimenez-Flores R, Everett D. Using confocal laser scanning microscopy to probe the milk fat globule membrane and associated proteins. J Agric Food Chem. 2010;58(7):4250–7. pmid:20218614
  31. 31. Pan Y, Liu L, Tian S, Li X, Hussain M, Li C, et al. Comparative analysis of interfacial composition and structure of fat globules in human milk and infant formulas. Food Hydrocolloids. 2022;124.
  32. 32. Wei W, Yang J, Yang D, Wang X, Yang Z, Jin Q, et al. Phospholipid Composition and Fat Globule Structure I: Comparison of Human Milk Fat from Different Gestational Ages, Lactation Stages, and Infant Formulas. J Agric Food Chem. 2019;67(50):13922–8. pmid:31746600
  33. 33. Bourlieu C, Menard O, De La Chevasnerie A, Sams L, Rousseau F, Madec MN, et al. The structure of infant formulas impacts their lipolysis, proteolysis and disintegration during in vitro gastric digestion. Food Chem. 2015;182:224–35. pmid:25842331
  34. 34. Bourlieu C, Deglaire A, de Oliveira SC, Ménard O, Le Gouar Y, Carrière F, et al. Towards infant formula biomimetic of human milk structure and digestive behaviour. Ocl. 2017;24(2).
  35. 35. Nilsson A, Duan RD. Absorption and lipoprotein transport of sphingomyelin. J Lipid Res. 2006;47(1):154–71. pmid:16251722
  36. 36. Reeves PG, Nielsen FH, Fahey GC Jr., AIN-93 purified diets for laboratory rodents: final report of the American Institute of Nutrition ad hoc writing committee on the reformulation of the AIN-76A rodent diet. J Nutr. 1993;123(11):1939–51. pmid:8229312
  37. 37. Schipper L, Oosting A, Scheurink AJ, van Dijk G, van der Beek EM. Reducing dietary intake of linoleic acid of mouse dams during lactation increases offspring brain n-3 LCPUFA content. Prostaglandins Leukot Essent Fatty Acids. 2016;110:8–15. pmid:27255638
  38. 38. Hajjar T, Goh YM, Rajion MA, Vidyadaran S, Li TA, Ebrahimi M. Alterations in neuronal morphology and synaptophysin expression in the rat brain as a result of changes in dietary n-6: n-3 fatty acid ratios. Lipids Health Dis. 2013;12:113. pmid:23886338
  39. 39. Leyrolle Q, Decoeur F, Dejean C, Briere G, Leon S, Bakoyiannis I, et al. N-3 PUFA deficiency disrupts oligodendrocyte maturation and myelin integrity during brain development. Glia. 2022;70(1):50–70. pmid:34519378
  40. 40. Madore C, Leyrolle Q, Morel L, Rossitto M, Greenhalgh AD, Delpech JC, et al. Essential omega-3 fatty acids tune microglial phagocytosis of synaptic elements in the mouse developing brain. Nat Commun. 2020;11(1):6133. pmid:33257673
  41. 41. Baars A, Oosting A, Engels E, Kegler D, Kodde A, Schipper L, et al. Milk fat globule membrane coating of large lipid droplets in the diet of young mice prevents body fat accumulation in adulthood. Br J Nutr. 2016;115(11):1930–7. pmid:27040581
  42. 42. Parra-Vargas M, Ramon-Krauel M, Lerin C, Jimenez-Chillaron JC. Size Does Matter: Litter Size Strongly Determines Adult Metabolism in Rodents. Cell Metab. 2020;32(3):334–40. pmid:32814016
  43. 43. van Heijningen S, Karapetsas G, van der Beek EM, van Dijk G, Schipper L. Early Life Exposure to a Diet With a Supramolecular Lipid Structure Close to That of Mammalian Milk Improves Early Life Growth, Skeletal Development, and Later Life Neurocognitive Function in Individually and Socially Housed Male C57BL/6J Mice. Front Neurosci. 2022;16:838711. pmid:35573304
  44. 44. Oosting A, van Vlies N, Kegler D, Schipper L, Abrahamse-Berkeveld M, Ringler S, et al. Effect of dietary lipid structure in early postnatal life on mouse adipose tissue development and function in adulthood. Br J Nutr. 2014;111(2):215–26. pmid:23845308
  45. 45. Gallier S, Vocking K, Post JA, Van De Heijning B, Acton D, Van Der Beek EM, et al. A novel infant milk formula concept: Mimicking the human milk fat globule structure. Colloids Surf B Biointerfaces. 2015;136:329–39. pmid:26432620
  46. 46. Schipper L, van Dijk G, Broersen LM, Loos M, Bartke N, Scheurink AJ, et al. A Postnatal Diet Containing Phospholipids, Processed to Yield Large, Phospholipid-Coated Lipid Droplets, Affects Specific Cognitive Behaviors in Healthy Male Mice. J Nutr. 2016;146(6):1155–61. pmid:27146919
  47. 47. Oosting A, Kegler D, Wopereis HJ, Teller IC, van de Heijning BJ, Verkade HJ, et al. Size and phospholipid coating of lipid droplets in the diet of young mice modify body fat accumulation in adulthood. Pediatr Res. 2012;72(4):362–9. pmid:22850409
  48. 48. Teller IC, Hoyer-Kuhn H, Bronneke H, Nosthoff-Horstmann P, Oosting A, Lippach G, et al. Complex lipid globules in early-life nutrition improve long-term metabolic phenotype in intra-uterine growth-restricted rats. Br J Nutr. 2018;120(7):763–76. pmid:30109842
  49. 49. Jelenik T, Kodde A, Pesta D, Phielix E, Oosting A, Rohbeck E, et al. Dietary lipid droplet structure in postnatal life improves hepatic energy and lipid metabolism in a mouse model for postnatal programming. Pharmacol Res. 2022;179:106193. pmid:35358682
  50. 50. Kodde A, Mischke M, Rakhshandehroo M, Voggel J, Fink G, Nusken E, et al. The effect of dietary lipid quality in early life on serum LysoPC(18:2) levels and their association with adult blood glucose levels in intrauterine growth restricted rats. Nutr Metab (Lond). 2021;18(1):101. pmid:34838065
  51. 51. Kodde A, van der Beek EM, Phielix E, Engels E, Schipper L, Oosting A. Supramolecular structure of dietary fat in early life modulates expression of markers for mitochondrial content and capacity in adipose tissue of adult mice. Nutr Metab (Lond). 2017;14:37. pmid:28616059
  52. 52. Ronda O, van de Heijning BJM, de Bruin A, Jurdzinski A, Kuipers F, Verkade HJ. Programming effects of an early life diet containing large phospholipid-coated lipid globules are transient under continuous exposure to a high-fat diet. Br J Nutr. 2019;122(12):1321–8. pmid:31439052
  53. 53. Ronda O, van de Heijning BJM, Martini I, Gerding A, Wolters JC, van der Veen YT, et al. Effects of an early life diet containing large phospholipid-coated lipid globules on hepatic lipid metabolism in mice. Sci Rep. 2020;10(1):16128. pmid:32999305
  54. 54. Ronda O, van de Heijning BJM, Martini IA, Koehorst M, Havinga R, Jurdzinski A, et al. An early-life diet containing large phospholipid-coated lipid globules programmes later-life postabsorptive lipid trafficking in high-fat diet- but not in low-fat diet-fed mice. Br J Nutr. 2021;125(9):961–71. pmid:32616081
  55. 55. Abbink MR, Schipper L, Naninck EFG, de Vos CMH, Meier R, van der Beek EM, et al. The Effects of Early Life Stress, Postnatal Diet Modulation, and Long-Term Western-Style Diet on Later-Life Metabolic and Cognitive Outcomes. Nutrients. 2020;12(2). pmid:32098348
  56. 56. Ruigrok SR, Abbink MR, Geertsema J, Kuindersma JE, Stoberl N, van der Beek EM, et al. Effects of Early-Life Stress, Postnatal Diet Modulation and Long-Term Western-Style Diet on Peripheral and Central Inflammatory Markers. Nutrients. 2021;13(2). pmid:33498469
  57. 57. Natu VS, Rosenke M, Wu H, Querdasi FR, Kular H, Lopez-Alvarez N, et al. Infants’ cortex undergoes microstructural growth coupled with myelination during development. Commun Biol. 2021;4(1):1191. pmid:34650227
  58. 58. Deoni SC, Dean DC 3rd, Piryatinsky I, O’Muircheartaigh J, Waskiewicz N, Lehman K, et al. Breastfeeding and early white matter development: A cross-sectional study. Neuroimage. 2013;82:77–86. pmid:23721722
  59. 59. Kar P, Reynolds JE, Grohs MN, Bell RC, Jarman M, Dewey D, et al. Association between breastfeeding during infancy and white matter microstructure in early childhood. Neuroimage. 2021;236:118084. pmid:33882345
  60. 60. Ambrose N, Rodriguez M, Waters KA, Machaalani R. Microglia in the human infant brain and factors that affect expression. Brain Behav Immun Health. 2020;7:100117. pmid:34589874
  61. 61. Yuan Q, Gong H, Du M, Li T, Mao X. Milk fat globule membrane supplementation to obese rats during pregnancy and lactation promotes neurodevelopment in offspring via modulating gut microbiota. Front Nutr. 2022;9:945052. pmid:36046136
  62. 62. Brink LR, Gueniot JP, Lonnerdal B. Effects of milk fat globule membrane and its various components on neurologic development in a postnatal growth restriction rat model. J Nutr Biochem. 2019;69:163–71. pmid:31096073
  63. 63. Gurnida DA, Rowan AM, Idjradinata P, Muchtadi D, Sekarwana N. Association of complex lipids containing gangliosides with cognitive development of 6-month-old infants. Early Hum Dev. 2012;88(8):595–601. pmid:22289412
  64. 64. Li F, Wu SS, Berseth CL, Harris CL, Richards JD, Wampler JL, et al. Improved Neurodevelopmental Outcomes Associated with Bovine Milk Fat Globule Membrane and Lactoferrin in Infant Formula: A Randomized, Controlled Trial. J Pediatr. 2019;215:24–31 e8. pmid:31668885
  65. 65. Timby N, Domellof E, Hernell O, Lonnerdal B, Domellof M. Neurodevelopment, nutrition, and growth until 12 mo of age in infants fed a low-energy, low-protein formula supplemented with bovine milk fat globule membranes: a randomized controlled trial. Am J Clin Nutr. 2014;99(4):860–8. pmid:24500150
  66. 66. Xia Y, Jiang B, Zhou L, Ma J, Yang L, Wang F, et al. Neurodevelopmental outcomes of healthy Chinese term infants fed infant formula enriched in bovine milk fat globule membrane for 12 months—A randomized controlled trial. Asia Pac J Clin Nutr. 2021;30(3):401–14. pmid:34587700
  67. 67. Nieto-Ruiz A, Dieguez E, Sepulveda-Valbuena N, Catena E, Jimenez J, Rodriguez-Palmero M, et al. Influence of a Functional Nutrients-Enriched Infant Formula on Language Development in Healthy Children at Four Years Old. Nutrients. 2020;12(2). pmid:32092927
  68. 68. Hedrick J, Yeiser M, Harris CL, Wampler JL, London HE, Patterson AC, et al. Infant Formula with Added Bovine Milk Fat Globule Membrane and Modified Iron Supports Growth and Normal Iron Status at One Year of Age: A Randomized Controlled Trial. Nutrients. 2021;13(12). pmid:34960093
  69. 69. Jiang B, Xia Y, Zhou L, Liang X, Chen X, Chen M, et al. Safety and tolerance assessment of milk fat globule membrane-enriched infant formulas in healthy term Chinese infants: a randomised multicenter controlled trial. BMC Pediatr. 2022;22(1):465. pmid:35918695
  70. 70. Nieto-Ruiz A, Garcia-Santos JA, Bermudez MG, Herrmann F, Dieguez E, Sepulveda-Valbuena N, et al. Cortical Visual Evoked Potentials and Growth in Infants Fed with Bioactive Compounds-Enriched Infant Formula: Results from COGNIS Randomized Clinical Trial. Nutrients. 2019;11(10). pmid:31615134
  71. 71. Timby N, Lonnerdal B, Hernell O, Domellof M. Cardiovascular risk markers until 12 mo of age in infants fed a formula supplemented with bovine milk fat globule membranes. Pediatr Res. 2014;76(4):394–400. pmid:25116230
  72. 72. Baumgartner S, van de Heijning BJM, Acton D, Mensink RP. Infant milk fat droplet size and coating affect postprandial responses in healthy adult men: a proof-of-concept study. Eur J Clin Nutr. 2017;71(9):1108–13. pmid:28422122
  73. 73. Michalski MC, Genot C, Gayet C, Lopez C, Fine F, Joffre F, et al. Multiscale structures of lipids in foods as parameters affecting fatty acid bioavailability and lipid metabolism. Prog Lipid Res. 2013;52(4):354–73. pmid:23624223
  74. 74. van der Beek EM, Oosting A. Nutritional programming in early life: the role of dietary lipid quality for future health. Ocl. 2020;27.
  75. 75. Schipper L, van Dijk G, van der Beek EM. Milk lipid composition and structure; The relevance for infant brain development. Ocl. 2020;27.