Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

The association between gingivitis and oral spirochetes in young cats and dogs

  • Seiya Yamaki,

    Roles Conceptualization, Formal analysis, Investigation, Resources, Writing – original draft

    Affiliations Amica Pet Clinic, Yamaguchi, Japan, Joint Graduate School of Veterinary Medicine, Yamaguchi University, Yamaguchi, Japan

  • Masato Tachibana,

    Roles Conceptualization, Formal analysis, Investigation, Writing – original draft

    Affiliation Organization for Research Initiatives, Yamaguchi University, Yamaguchi, Japan

  • Hisae Hachimura,

    Roles Resources

    Affiliation Amica Pet Clinic, Yamaguchi, Japan

  • Masao Ogawa,

    Roles Resources

    Affiliation Amica Pet Clinic, Yamaguchi, Japan

  • Shinya Kanegae,

    Roles Resources

    Affiliation Amica Pet Clinic, Yamaguchi, Japan

  • Hirokazu Amimoto,

    Roles Resources

    Affiliation Amica Pet Clinic, Yamaguchi, Japan

  • Takashi Shimizu,

    Roles Formal analysis

    Affiliations Joint Graduate School of Veterinary Medicine, Yamaguchi University, Yamaguchi, Japan, Joint Faculty of Veterinary Medicine, Laboratory of Veterinary Public Health, Yamaguchi University, Yamaguchi, Japan

  • Kenta Watanabe,

    Roles Investigation, Writing – original draft

    Affiliations Joint Graduate School of Veterinary Medicine, Yamaguchi University, Yamaguchi, Japan, Joint Faculty of Veterinary Medicine, Laboratory of Veterinary Public Health, Yamaguchi University, Yamaguchi, Japan

  • Masahisa Watarai ,

    Roles Conceptualization, Formal analysis, Investigation, Writing – review & editing

    watarai@yamaguchi-u.ac.jp

    Affiliations Joint Graduate School of Veterinary Medicine, Yamaguchi University, Yamaguchi, Japan, Joint Faculty of Veterinary Medicine, Laboratory of Veterinary Public Health, Yamaguchi University, Yamaguchi, Japan

  • Akiteru Amimoto

    Roles Conceptualization, Formal analysis, Writing – review & editing

    Affiliation Amica Pet Clinic, Yamaguchi, Japan

Abstract

Although gingivitis frequently occurs in young cats, spirochetes are often found in the early stages of periodontal disease. This study was conducted to determine the association between gingivitis and oral spirochetes in young cats and dogs. The degree of gingivitis was evaluated in a total of 68 cats and 31 dogs under one year of age, and plaques were collected from each carnassial. To detect spirochetes or Porphyromonas gulae in plaque samples, 16S rRNA gene was amplified by polymerase chain reaction (PCR) using specific primers. All data were analyzed using Fisher’s exact probability test and odds ratio (OR) with a 95% confidence interval (95% CI). The prevalence of gingivitis was significantly higher in young cats (92.6%) than in young dogs (45.2%). The positive rate of spirochetes by PCR in gingivitis cases was 85.4% in young cats and 15.4% in young dogs, and the positive rate of P. gulae was 66.7% in young cats and 15.4% in young dogs. Both results were significantly higher in young cats than in young dogs. In young cats, spirochetes were significantly associated with gingivitis (OR = 7.95; 95% CI = 1.17, 53.83; P < 0.05), but P. gulae was not (OR = 2.44; 95% CI = 0.38, 15.66; P = 0.23). These results suggest that spirochetes may be associated with the early stages of periodontal disease in cats.

Introduction

Gingivitis is a reversible inflammation confined to the gingiva, and it is described as an initial stage of periodontal disease [1]. Periodontal disease is a common disease in cats and dogs [2,3] and is thought to be initiated by oral bacteria in the plaque that adhere to the teeth. Recent studies have revealed a large diversity of bacterial species in the subgingival plaque of cats and dogs. There are also extensive differences between the microbiome identified in companion animals and humans [46]. Although healthy animals of the same species have similar composition of the oral microbiome, it changes with periodontal disease [7].

In dogs and cats, the incidence and severity of periodontal disease, especially periodontitis, are known to increase with age [8,9]. Conversely, although periodontitis is rarely seen in dogs or cats under one year old, gingivitis is a common diagnosis. Previous epidemiological studies showed that dogs aged between 0.5 and 1.5 years had no gingivitis [10] whereas approximately 50% of cats below one year of age have established gingivitis [11]. Thus, it is expected that the prevalence of gingivitis in young cats is higher than that in young dogs.

In humans, many bacterial species have been associated with the diagnosis of periodontal disease. Among them, Treponema denticola, a type of spirochete, belongs to the red complex species related to periodontal disease because of its virulence factors, along with Tannerella forsythia and Porphyromonas gingivalis [12,13]. Conversely, in dogs and cats, Porphyromonas gulae has been found to be the predominant species leading to periodontal disease [1416], and research focusing on the role of spirochete is limited. However, recent reports have shown that the plaque from mild feline periodontitis contained a much larger number of Treponema species than those in dogs’ plaque [17,18].

We speculate that there may be an association between the high incidence of gingivitis in cats of an early age and the high incidence of spirochetes in cats with mild periodontal disease. Therefore, this study assessed the difference in the prevalence of gingivitis between young cats and dogs, clarifying the relationship between gingivitis and oral spirochetes in young cats.

Materials and methods

Subjects and ethical statement

Examination and sampling of the subjects were performed between April 2020 and March 2022 at Amica Pet Clinic, Yamaguchi, Japan. Cats and dogs younger than one year old were randomly examined. Cats and dogs were excluded from this study as samples if they had systemic underlying diseases that affect the oral cavity or oral diseases other than periodontal inflammatory diseases, or antibiotic treatment in the past month. Dental plaque was sampled and the oral cavity was checked, when the animals were anesthetized. Subgingival and supragingival samples were collected from all 99 animals.

Prospectively, the Yamaguchi University Ethical Committee on Animal Research counseled that because samples were obtained as a part of medical treatment, an Ethical Committee on Animal Research protocol was not required. All owners had given their written consent prior to participating in the study. No adverse events resulting from tissue acquisition were documented.

Clinical evaluation of subjects

Gingiva was evaluated based on the clinical characteristics of the Gingival Index (GI) system [19], classified in four levels from zero to three (Fig 1 and Table 1). The same evaluator determined the GI values for all samples. When determining only the presence or absence of gingivitis, it was regarded that GI 1–3 was positive and GI 0 was negative.

thumbnail
Fig 1. Examples of gingivitis determination according to the criteria for the GI systems in cats and dogs.

The right maxillary fourth premolars (108) are compared.

https://doi.org/10.1371/journal.pone.0281126.g001

thumbnail
Table 1. Criteria for the Gingival Index (GI) systems.

https://doi.org/10.1371/journal.pone.0281126.t001

Sample collection and preparation of examination

One site of the carnassials (maxillary fourth premolars or mandibular first molars) with the strongest gingival inflammation was targeted. A microbrush (TPC Disposable Micro Applicators Fine) was rubbed firmly five times on the gingival sulcus and the adjacent enamel of the buccal surface of the targeted tooth of each animal.

A part of the plaque sample attached to the microbrush was applied to a new, uncontaminated glass slide and stained with Hemacolor® (Merck, Germany) for microscopic examination. The remaining sample was placed in a tube containing 500 μL of phosphate-buffered saline (PBS) for DNA preparation. PBS samples were stored at −4°C until DNA extraction.

DNA was extracted and purified using a DNeasy Blood & Tissue Kit (QIAGEN, Netherlands) according to the manufacturer’s protocol for the polymerase chain reaction (PCR) method. DNA samples were stored at −30°C until needed.

16S ribosomal RNA gene PCR amplification

The specific sequence of the 16S ribosomal RNA gene was amplified using AGAGTTTGATCCTGGCTCAG and GTTACGACTTCACCCTCCT primers selective for the phylum Spirochaetes [20] or TTGCTTGGTTGCATGATCGG and GCTTATTCTTACGGTACATTCACA primers selective for P. gulae [14].

PCR was performed using GoTaq® Green Master Mix (Promega, USA) with the following cycling parameters: an initial denaturation at 95°C for 2 min, followed by 25 cycles of 30 s at 95°C, 30 s at 60°C, and 90 s at 72°C for the phylum Spirochaetes or 30 cycles of 30 s at 95°C, 30 s at 60°C, and 30 s at 72°C for P. gulae, with a final extension at 72°C for 5 min. The purity of the product was determined by electrophoresis in a 1% agarose gel using Mupid-2plus (Takara, Japan). DNA was stained with ethidium bromide and viewed under long-wavelength ultraviolet light using a UV transilluminator (ATTO, Japan).

Statistical analysis

Data were analyzed using the software EZR 4.0.3 (Windows 11). Fisher’s exact test was used to compare the prevalence of gingivitis or positive rate of bacteria between cats and dogs, considering P < 0.05 as statistically significant. In addition, the association between the clinical characteristics of the gingiva and the detection of bacteria was evaluated by odds ratio (OR), with 95% confidence intervals (95% CI).

Results

Study population

A total of 68 cats (34 males and 34 females) and 31 dogs (14 males and 17 females) were sampled. The age of the cats varied between 5 and 12 months (mean, 7.1 months; SD, 1.4 months), and their weights ranged from 2.04 to 4.66 kg (mean, 3.22 kg; SD, 0.55 kg). The age of the dogs varied between 5 and 11 months (mean, 6.7 months; SD, 1.2 months), and their weights ranged from 1.44 to 27.0 kg (mean, 5.50 kg; SD, 3.34 kg). Further information, including sampling sites and GI of each animal, is shown in S1 and S2 Tables.

Prevalence of gingivitis

The prevalence of gingivitis was 92.6% (63/68) in cats and 45.2% (14/31) in dogs (Fig 2). Cats had a significantly higher prevalence of gingivitis than dogs (P < 0.05).

thumbnail
Fig 2. Prevalence of gingivitis in cats and dogs one year old or younger.

Significant differences are indicated by asterisks (*P < 0.05).

https://doi.org/10.1371/journal.pone.0281126.g002

Microscopic examination

To confirm if there were spirochetes in the dental plaque, the samples were stained and observed under an optical microscope. Several types of spirochetes were found based on their morphology (staining, spiral, and width) (Fig 3). At least one key morphological characteristic (low stainability, many spirals, and small width) was common to almost all spirochete-positive samples. The results were assessed by the presence or absence of spirochete (Table 2). Spirochetes were observed in samples of 51 of 63 cats (81.0%) and 2 of 14 dogs (14.3%) with gingivitis. Spirochetes were observed in samples from 2 of 5 cats (40.0%) and 1 of 17 dogs (5.9%) without gingivitis (Table 2).

thumbnail
Fig 3. Several morphological types of spirochetes found in dental plaque.

(A) High stainability and many spiral type (arrows). (B) Low stainability and little spiral type (white arrowheads). (C) Low stainability and many spiral type (black arrowheads). (D) Many types of spirochetes. Scale bar represents 10 μm.

https://doi.org/10.1371/journal.pone.0281126.g003

thumbnail
Table 2. Rate of positivity for spirochetes and P. gulae by microscope or PCR examination.

https://doi.org/10.1371/journal.pone.0281126.t002

Molecular analysis

The results of the PCR for the phylum Spirochaetes are shown in Table 2. A total of 53 of 63 (84.1%) samples from cats with gingivitis and 2 of 5 (40.0%) samples from cats without gingivitis were positive. A total of 3 of 14 (21.4%) samples from dogs with gingivitis and 3 of 17 (17.7%) samples from dogs without gingivitis were positive. Among animals with gingivitis, the detection rate of spirochete was significantly higher in cats than in dogs.

Only 1 of 53 microscopy positive cat samples and 1 of 3 microscopy positive dog samples were PCR negative and 3 of 15 microscopy negative cat samples and 4 of 28 microscopy negative dog samples were PCR positive for the phylum Spirochaetes (Table 3).

thumbnail
Table 3. The correlation between positive rates of spirochete by PCR or microscopic examination.

https://doi.org/10.1371/journal.pone.0281126.t003

The PCR results for P. gulae are shown in Table 2. A total of 39 of 63 (61.9%) samples from cats with gingivitis and 2 of 5 (40.0%) samples from cats without gingivitis were PCR positive. A total of 2 of 14 (14.3%) samples from dogs with gingivitis and 4 of 17 (23.5%) samples from dogs without gingivitis were PCR positive. Among animals with gingivitis, the detection rate of P. gulae was significantly higher in cats than in dogs, as was the identification of spirochetes.

The association between the development of gingivitis in young cats and dogs and each bacterial species was examined by OR and 95% CI (Table 4). In young cats, spirochetes (OR = 7.95; 95% CI = 1.17, 53.83; P < 0.05) were shown to be significantly associated with gingivitis, but P. gulae (OR = 2.44; 95% CI = 0.38, 15.66; P = 0.23) was not associated with gingivitis. Conversely, in young dogs, neither spirochetes (OR = 1.27; 95% CI = 0.21, 7.58; P = 0.34) nor P. gulae (OR = 0.54; 95% CI = 0.08, 3.51; P = 0.29) was associated with gingivitis.

thumbnail
Table 4. Odds ratio of Spirochaetes or P. gulae for gingivitis.

https://doi.org/10.1371/journal.pone.0281126.t004

Discussion

To the best of our knowledge, this study reported for the first time a higher prevalence of gingivitis in young cats under one year old by comparing to young dogs. Because gingivitis in small animals presents with few clinical signs, it can only be diagnosed as a pathology with careful observation within the oral cavity. The fact that many veterinarians and owners are unaware of the signs of gingivitis in young animals may have contributed to underdiagnosing this disease.

Periodontal disease is the most common and important health problem in cats and dogs. Gingivitis is the initial, reversible, and preventable stage of periodontal disease, and it may develop to periodontitis, involving the progressive and irreversible destruction of the periodontal tissues [1,21]. Complications include chronic ulcerative paradental stomatitis, faucitis, and chronic gingivostomatitis [22]. Therefore, it is desirable to swiftly diagnose gingivitis cases. The 2019 AAHA Dental Care Guidelines for Dogs and Cats [21] recommends that a true dental prophylaxis starts at one year of age for cats and small- to medium-breed dogs and by two years of age for larger-breed dogs, even if there are no obvious lesions. The clarification of the association between gingivitis in young cats and oral bacteria should help in establishing effective prevention and providing treatment.

Various forms of spirillum have been confirmed in the plaque of dogs and cats at the stage of preliminary experiments, in addition to Treponema, which is usually detected in the oral cavity of humans. Nonetheless, other spirochetal species (such as Borrelia and Brachyspira) may coexist. Therefore, in this study, primers specific to the phylum Spirochaetes were used to detect spirochetes. The results found by PCR were well correlated with the pictures obtained by microscopy. Because one similar morphology was common to almost all spirochete-positive samples under light microscopy, PCR-positive results were considered to reflect the presence of a particular species.

In one sample, spirochetes were detected under a microscope but not by PCR for both cats and dogs. This may be due to both samples presenting a small number of spirochetes on the smear; the number of bacteria in the sample may be below the detection limit for PCR. It was also possible that there were novel spirochetes that did not match the primer pair used [23] or that an inhibitor was present in the sample.

It is reported that that the microbiota of periodontally healthy cats were distinguishable from diseased cats [24]. In this study, we showed that spirochetes are more associated with gingivitis in young cats than with P. gulae. P. gulae is thought to be associated with periodontal disease in cats, and a correlation has been reported between the proportion of this species and the severity of periodontal disease [16]. However, because the subjects of the study were the animals with gingivitis (mild periodontal disease), the association of P. gulae to the disease may not be significant.

Many studies reported that spirochetes as a group and T. denticola are associated with periodontal disease, especially periodontitis in humans [25]. One of the reports showed that T. denticola increases susceptibility to gingivitis [26]. On the other hand, only a few studies have investigated the association of oral spirochetes with periodontal disease in animals. However, in recent years, some studies of the subgingival microbiota using next-generation sequencing have found spirochetes to have a higher abundance in periodontally diseased cats compared to healthy [18,24]. Moreover, if there might be more diverse oral spirochetes in dogs and cats than in humans as previous report have shown [23], it is also possible that there are spirochetes with etiologies that are not common in humans. The association of spirochetes with gingivitis in young cats shown in this study suggests that spirochetes, together with other oral microbes or alone, may play some role in the early stages of periodontal disease in cats.

Supporting information

References

  1. 1. Niemiec B, Gawor J, Nemec A, Clarke D, McLeod K, Tutt C, et al. World Small Animal Veterinary Association Global Dental Guidelines. J Small Anim Pract 2020; 61. pmid:32715504
  2. 2. Lund EM, Armstrong PJ, Kirk CA, Kolar LM, Klausner JS. Health Status and Population Characteristics of Dogs and Cats Examined at Private Veterinary Practices in the United States. J Am Vet Med Assoc 1999; 214: 1336–1341. pmid:10319174
  3. 3. Robinson NJ, Dean RS, Cobb M, Brennan ML. Factors Influencing Common Diagnoses Made During First-Opinion Small-Animal Consultations in the United Kingdom. Prev Vet Med 2016; 131: 87–94. pmid:27544257
  4. 4. Dewhirst FE, Chen T, Izard J, Paster BJ, Tanner ACR, Yu WH, et al. The Human Oral Microbiome. J Bacteriol 2010; 192: 5002–5017. pmid:20656903
  5. 5. Dewhirst FE, Klein EA, Thompson EC, Blanton JM, Chen T, Milella L, et al. The Canine Oral Microbiome. PLOS ONE. Ravel J, editor 2012; 7: e36067. pmid:22558330
  6. 6. Dewhirst FE, Klein EA, Bennett ML, Croft JM, Harris SJ, Marshall-Jones ZV. The Feline Oral Microbiome: A Provisional 16S rRNA Gene Based Taxonomy with Full-Length Reference Sequences. Vet Microbiol 2015; 175: 294–303. pmid:25523504
  7. 7. Santibáñez R, Rodríguez-Salas C, Yáñez CF, Garrido D, Thomson P. Assessment of Changes in the Oral Microbiome That Occur in Dogs with Periodontal Disease. Vet Sci 2021; 8: 291. pmid:34941818
  8. 8. Harvey CE, Shofer FS, Laster L. Association of Age and Body Weight with Periodontal Disease in North American Dogs. J Vet Dent 1994; 11: 94–105. pmid:9693607
  9. 9. Gengler W, Dubielzig R, Ramer J. Physical Examination and Radiographic Analysis to Detect Dental and Mandibular Bone Resorption in Cats: A Study of 81 Cases from Necropsy. J Vet Dent 1995; 12: 97–100. pmid:9693633
  10. 10. Isogai H, Isogai E, Okamoto H, Shirakawa H, Nakamura F, Matsumoto T, et al. Epidemiological Study on Periodontal Diseases and Some Other Dental Disorders in Dogs. Nihon Juigaku Zasshi 1989; 51: 1151–1162. pmid:2601227
  11. 11. Verhaert L, Wetter C. Survey of Oral Diseases in Cats in Flanders. Vlaams Diergeneeskd Tijdschr 2004; 73: 331–340.
  12. 12. Socransky SS, Haffajee AD, Cugini MA, Smith C, Kent RL. Microbial Complexes in Subgingival Plaque. J Clin Periodontol 1998; 25: 134–144. pmid:9495612
  13. 13. Ishihara K. Virulence Factors of Treponema denticola. Periodontol 2000 2010; 54: 117–135. pmid:20712637
  14. 14. Fournier D, Mouton C, Lapierre P, Kato T, Okuda K, Ménard C. Porphyromonas gulae sp. nov., an Anaerobic, Gram-Negative Coccobacillus from the Gingival Sulcus of Various Animal Hosts. Int J Syst Evol Microbiol 2001; 51: 1179–1189. pmid:11411686
  15. 15. Kato Y, Shirai M, Murakami M, Mizusawa T, Hagimoto A, Wada K, et al. Molecular Detection of Human Periodontal Pathogens in Oral Swab Specimens from Dogs in Japan. J Vet Dent 2011; 28: 84–89. pmid:21916371
  16. 16. Pérez-Salcedo L, Herrera D, Esteban-Saltiveri D, León R, Jeusette I, Torre C, et al. Isolation and Identification of Porphyromonas spp. and Other Putative Pathogens from Cats with Periodontal Disease. J Vet Dent 2013; 30: 208–213. pmid:24660305
  17. 17. Harris S, Croft J, O’Flynn C, Deusch O, Colyer A, Allsopp J, et al. A Pyrosequencing Investigation of Differences in the Feline Subgingival Microbiota in Health, Gingivitis and Mild Periodontitis. PLOS ONE. Al-Ahmad A, editor 2015; 10: e0136986. pmid:26605793
  18. 18. Davis IJ, Wallis C, Deusch O, Colyer A, Milella L, Loman N, Harris S. A Cross-Sectional Survey of Bacterial Species in Plaque from Client Owned Dogs with Healthy Gingiva, Gingivitis or Mild Periodontitis. PLOS ONE. Semple MG, editor 2013; 8: e83158. pmid:24349448
  19. 19. Löe H, Silness J. Periodontal Disease in Pregnancy. I. Prevalence and Severity. Acta Odontol Scand 1963; 21: 533–551. pmid:14121956
  20. 20. Siqueira JF, Rôças IN. Treponema Species Associated with Abscesses of Endodontic Origin. Oral Microbiol Immunol 2004; 19: 336–339. pmid:15327648
  21. 21. Bellows J, Berg ML, Dennis S, Harvey R, Lobprise HB, Snyder CJ, et al. 2019 AAHA Dental Care Guidelines for Dogs and Cats. J Am Anim Hosp Assoc 2019; 55: 49–69. pmid:30776257
  22. 22. Maciel RM, Mazaro RD, Silva JPF, Lorenzetti DM, Herbichi A, Paz MC, et al. Periodontal disease and its complications in cats from a shelter in the Central Region of Rio Grande do Sul. Pesq. Vet. Bras 2020; 40:696–706.
  23. 23. Valdez M, Haines R, Riviere KH, Riviere GR, Thomas DD. Isolation of oral spirochetes from dogs and cats and provisional identification using polymerase chain reaction (PCR) analysis specific for human plaque Treponema spp. J Vet Dent 2000; 17:23–26.
  24. 24. Rodrigues MX, Bicalho RC, Fiani N, Lima SF, Peralta S. The subgingival microbial community of feline periodontitis and gingivostomatitis: characterization and comparison between diseased and healthy cats. Sci Rep 2019; 9:12340. pmid:31451747
  25. 25. Ellen RP, Galimanas VB. Spirochetes at the Forefront of Periodontal Infections. Periodontol 2000 2005; 38: 13–32. pmid:15853935
  26. 26. Riviere GR, DeRouen TA. Association of Oral Spirochetes from Periodontally Healthy Sites with Development of Gingivitis. J Periodontol 1998; 69: 496–501. pmid:9609381