Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

The rpoS gene confers resistance to low osmolarity conditions in Salmonella enterica serovar Typhi

  • Eamon Gibbons ,

    Contributed equally to this work with: Eamon Gibbons, Mehbooba Tamanna

    Roles Investigation, Methodology, Writing – review & editing

    Affiliation Mucosal Immunology and Biology Research Center, Massachusetts General Hospital, Charlestown, Massachusetts, United States of America

    ⨯
  • Mehbooba Tamanna ,

    Contributed equally to this work with: Eamon Gibbons, Mehbooba Tamanna

    Roles Investigation, Methodology, Writing – review & editing

    Affiliations Mucosal Immunology and Biology Research Center, Massachusetts General Hospital, Charlestown, Massachusetts, United States of America, Medical Sciences Program, Boston University School of Medicine, Boston, Massachusetts, United States of America

    ⨯
  • Bobby J. Cherayil

    Roles Conceptualization, Data curation, Formal analysis, Funding acquisition, Project administration, Supervision, Writing – original draft, Writing – review & editing

    cherayil@helix.mgh.harvard.edu

    Affiliations Mucosal Immunology and Biology Research Center, Massachusetts General Hospital, Charlestown, Massachusetts, United States of America, Department of Pediatrics, Harvard Medical School, Boston, Massachusetts, United States of America

    ⨯

Abstract

Salmonella enterica serovars Typhimurium and Typhi are enteropathogens that differ in host range and the diseases that they cause. We found that exposure to a combination of hypotonicity and the detergent Triton X-100 significantly reduced the viability of the S. Typhi strain Ty2 but had no effect on the S. Typhimurium strain SL1344. Further analysis revealed that hypotonicity was the critical factor: incubation in distilled water alone was sufficient to kill Ty2, while the addition of sodium chloride inhibited killing in a dose-dependent manner. Ty2’s loss of viability in water was modified by culture conditions: bacteria grown in well-aerated shaking cultures were more susceptible than bacteria grown under less aerated static conditions. Ty2, like many S. Typhi clinical isolates, has an inactivating mutation in the rpoS gene, a transcriptional regulator of stress responses, whereas most S. Typhimurium strains, including SL1344, have the wild-type gene. Transformation of Ty2 with a plasmid expressing wild-type rpoS, but not the empty vector, significantly increased survival in distilled water. Moreover, an S. Typhi strain with wild-type rpoS had unimpaired survival in water. Inactivation of the wild-type gene in this strain significantly reduced survival, while replacement with an arabinose-inducible allele of rpoS restored viability in water under inducing conditions. Our observations on rpoS-dependent differences in susceptibility to hypotonic conditions may be relevant to the ability of S. Typhi and S. Typhimurium to tolerate the various environments they encounter during the infectious cycle. They also have implications for the handling of these organisms during experimental manipulations.

Introduction

Salmonella enterica serovar Typhi (S. Typhi) and Salmonella enterica serovar Typhimurium (S. Typhimurium) are closely related Gram-negative bacteria that differ in host range and the diseases that they cause. Both organisms are enteropathogens that are transmitted through contaminated food or water. However, S. Typhi infects only humans and causes typhoid fever, a systemic illness involving spread of the pathogen to extra-intestinal tissues. The infection is potentially fatal if it is not treated appropriately. Accordingly, typhoid is responsible for significant morbidity and mortality in the developing world, mainly in young children, and has become particularly problematic because of the emergence of multidrug resistance [1, 2]. S. Typhimurium infects a broad range of hosts globally, including humans, farm animals and laboratory mice [3–6]. In humans, S. Typhimurium infection is usually confined to the intestine, causing a robust local inflammatory response that manifests as acute, self-limiting gastroenteritis [3]. It rarely spreads systemically and generally does not require specific treatment, although certain pathovars of S. Typhimurium can cause an invasive, typhoid-like systemic disease in children and immunocompromised adults in sub-Saharan Africa [7]. The mechanisms responsible for these differences between S. Typhi and S. Typhimurium are not completely understood.

During infection of their hosts, enteropathogens like S. Typhi and S. Typhimurium have to adapt to changing environments as they pass through the gastrointestinal tract and then interact with epithelial and immune cells [8–12]. The challenges that they have to contend with include alterations in temperature, pH, osmolarity and oxygen and nutrient concentrations, as well as potentially toxic molecules such as bile salts, antimicrobial peptides and oxidative radicals [10, 11, 13–19]. In addition, they have to survive, at least for some time, in the external environment in order to pass from one host to another. This requirement may be particularly relevant to S. Typhi, which does not have a non-human animal host that can act as an intermediary in transmitting infection. Although direct fecal-oral transmission of S. Typhi between humans may occur, indirect transmission via consumption of untreated water from wells, ponds and rivers probably plays an even more important role [20–23]. Thus, the pathogen must have the ability to adjust to and tolerate the low osmolarity of such freshwater sources. Indeed, it has been shown that S. Typhi adapts to water by modulating the expression of a large number of genes, including some that are essential for viability under such conditions [24].

One of the genes that plays a key role in adapting to multiple environmental stresses in Salmonella is rpoS, which encodes the stationary phase alternate sigma factor RpoS [25]. Disruption of the rpoS gene in S. Typhimurium has been shown to impair survival in the presence of low pH, nutrient deprivation and oxidative agents, and to attenuate virulence in mice [26, 27]. Studies with S. Typhimurium strains carrying a mutant allele of rpoS have led to similar findings, along with demonstration of significantly reduced colonization of gut-associated lymphoid tissues, spleen and liver by the mutant bacteria despite their normal invasiveness and ability to survive in macrophages [28, 29]. These effects have been linked, either experimentally or presumptively, to the involvement of rpoS in controlling the expression of a large number of genes that contribute to metabolic processes, resistance to oxidative molecules, DNA damage repair, membrane transport, and various aspects of virulence [30–33]. The rpoS gene has also been shown to play important roles in S. Typhi, including in resistance to acid, starvation and reactive oxygen and nitrogen species, synthesis of the Vi capsular polysaccharide, expression of the HlyE hemolysin and the OsmY periplasmic protein, macrophage cytotoxicity and adhesion to epithelial cells [34–39]. In addition, the wild-type or mutant rpoS status of S. Typhi vaccine strains has been shown to affect their ability to survive stresses associated with the host environment, and to influence the kinds of immune responses that they elicit in mice [40–43].

Adding to the above observations, the experiments described in the present work show that the S. Typhi rpoS gene is involved in the ability of the pathogen to survive under low osmolarity conditions. The results are relevant to our understanding of how S. Typhi deals with the transition to the external environment during host-to-host transmission, and also have implications for handling of the organism during experimental manipulations.

Materials and methods

Bacterial strains

The wild-type S. Typhi strain Ty2 was obtained from the American Type Culture Collection, Manassas, VA, while the wild-type S. Typhimurium strain SL1344 was originally provided by Dr. Beth McCormick, University of Massachusetts Medical Center, Worcester, MA. The S. Typhi ISP1820 strains χ3744 (wild-type rpoS gene), χ9061 (rpoS inactivated by phage-mediated introduction of a mutant allele expressing a truncated protein) and χ9066 (arabinose-inducible wild-type rpoS generated by allelic exchange) were constructed in the laboratory of Dr. Roy Curtiss, III as detailed earlier [36], and were kindly provided by Drs. Curtiss and Soo-Young Wanda. Unless indicated otherwise, bacteria were routinely grown at 37°C in Lysogeny Broth (LB, Miller formulation, 10 g/l NaCl, Sigma Chemical Co., St. Louis, MO) in sterile 12 ml polypropylene tubes (Fisher Scientific, Manassas, VA), using 2 ml of LB in loosely capped tubes or 10 ml of LB in tightly capped tubes for shaking or static cultures, respectively [44]. The cultures were shaken at 220 rpm when necessary. Ampicillin was added to a concentration of 100 μg/ml when plasmid selection was required. As previously described, arabinose was added to a concentration of 0.2% to induce rpoS expression in χ9066 [36].

Bacterial viability assays

Bacterial cultures were grown overnight for 18–20 hours at 37°C in LB under static or shaking conditions as specified in individual experiments. Aliquots of each culture were centrifuged, and the pelleted bacteria were washed once with phosphate buffered saline (PBS). After an additional centrifugation, the washed bacteria were resuspended in PBS at a density of approximately 5 x 108 colony forming units per ml (cfu/ml), as determined by preliminary titering experiments. Ten μl aliquots of the bacterial suspensions were added to replicate sterile microcentrifuge tubes containing 200 μl of either PBS or the test solution indicated in each experiment and mixed well. The tubes were incubated on ice or in a 37°C water bath for 1 hour or for different times indicated in specific experiments. At the end of the incubation period, serial dilutions of the incubation mixes were made in PBS and plated on LB agar to determine the number of surviving bacteria. The number of viable bacteria in the test condition was expressed as a percentage of the number in PBS. In experiments involving plasmid-transformed bacteria, ampicillin at 100 μg/ml was included in culture media and buffers to maintain selection for the plasmid at all steps.

Bacterial growth curves

Overnight shaking cultures of the various strains grown in LB were diluted 1000-fold into triplicate 1.2 ml aliquots of fresh medium distributed in the wells of 24-well tissue culture plates. The plates were incubated at 37°C with shaking at 220 rpm. To generate growth curves, 100 μl of the culture from each well was removed at hourly intervals and transferred to a 96-well microplate for measurement of absorbance at 595 nm in a Spectramax ABS plate reader (Molecular Devices, San Jose, CA). To ensure that the culture volume was not depleted, separate plates were used for the measurements at 0–6 hours, 7–16 hours and 24–26 hours. The effect of low osmolarity was determined by comparing growth in standard LB (10 g/l of NaCl, osmolarity approximately 400 mosmol/l) versus hypotonic LB (no NaCl, osmolarity approximately 100 mosmol/l) [45, 46].

Gene expression analysis

Five hundred μl of overnight shaking cultures of the relevant bacterial strains grown in standard LB were used to prepare RNA with the RNAprotect Bacteria Reagent and RNeasy Plus Mini Kit (Qiagen, Germantown, MD) according to the manufacturer’s instructions. Approximately 500 ng of the RNA samples were treated with RQ1 RNAse-free DNAse (Promega, Madison, WI) for 1 hour at 37°C to eliminate any contaminating genomic DNA. The DNAse-treated RNA was then reverse transcribed using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA) according to the manufacturer’s directions, and the cDNA subjected to real-time quantitative PCR amplification with the iQ SYBR Green Supermix kit (Bio-Rad, Hercules, CA) in an Applied Biosystems QuantStudio 3 (Fisher Scientific, Manassas, VA). The primers used for amplification were designed using Primer-BLAST (National Center for Biotechnology Information, National Library of Medicine, Bethesda, MD) and were specific for the Salmonella enterica genes katE (forward, 5’ CGTACGGTATCAGCAGACCC 3’, reverse, 5’ CCCGAGACCGCGAATGATAA 3’) and otsA (forward, 5’ TTCGAGTCAAACGCGAGTCA 3’, reverse, 5’ ACGTAGGCGCAATTTGGGTA 3’), and for pan-bacterial 16S rRNA (forward, 5’ TCCTACGGGAGGCAGCAGT 3’, reverse, 5’ GGACTACCAGGGTATCTAATCCTGTT 3’). Forty cycles of amplification were carried out as previously described, with denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds and extension at 72°C for 1 minute [44]. The specificity of the amplification was confirmed by melting curve analysis: all products yielded single, sharp melting curve peaks. Expression was determined using the 2-ΔΔCt method, with the levels of the transcript of interest normalized to 16S rRNA and calculated relative to the levels in SL1344 or Ty2 as indicated in the specific experiment.

Cloning of the S. Typhimurium rpoS gene

Genomic DNA was prepared from an overnight culture of SL1344 using the UltraClean Microbial DNA kit (Qiagen, Germantown, MD). It was used as the template to PCR amplify the entire coding region of the rpoS gene (gene ID 11768183) with primers that incorporated EcoR1 and Not1 restriction sites at the 5’ and 3’ ends, respectively (forward, 5’ GTAGGGAATTCGGGTAGGAGCCACCTTATGAG 3’, reverse, 5’ ATAGCGGCCGCTACTTACTCGCGGAACAGCGC 3’). The approximately 1 kb amplification product was digested with EcoR1 and Not1, gel purified and ligated to the similarly digested, ampicillin resistance-encoding bacterial expression vector pBH [47]. pBH is a high-copy plasmid (Roche, Nutley, NJ) in which expression of the cloned gene is under the control of a trp-lac promoter. Since Ty2 does not have the lac repressor, pBH-mediated expression is constitutive. We have used the vector previously to obtain robust and reliable expression of multiple genes in Salmonella [47]. The ligation mix was transformed into competent E. coli DH5α (Fisher Scientific, Manassas, VA) and the transformants were screened for the presence of plasmid containing the rpoS insert. One such plasmid (designated pBHSTmrpoS) was prepared in larger scale using a midi-prep column (Qiagen, Germantown, MD) and sequenced to confirm the identity of the insert and to verify the absence of any mutations. pBHSTmrpoS, as well as the empty vector pBH, were transformed separately into Ty2 by electroporation as described previously to generate the transformants Ty2/pBHSTmrpoS and Ty2/pBH [44].

Statistical analysis

Experiments to assess bacterial viability, growth and gene expression were carried out with 2 to 4 biological replicates, and the data from multiple experiments pooled for analysis. The scatter histogram plots in the figures show means +/- standard deviations with each symbol corresponding to an individual replicate. Statistical analysis was carried out with Prism 6.0 software (GraphPad Software, Inc., San Diego, CA). One-way ANOVA with correction for multiple comparisons was used to compare more than 2 experimental groups. The student’s t test was used when only 2 groups were involved. In both cases, p < 0.05 was considered significant. The actual p values are indicated in the legends of individual figures, along with the number of replicates.

Results

Viability of S. Typhi strain Ty2 is compromised by Triton X-100 and hypotonic conditions

Triton X-100 is a non-ionic detergent that is widely used at different concentrations (usually 0.5–1%) to lyse mammalian cells in gentamicin protection assays for the assessment of Salmonella invasiveness [48]. In initial experiments, we tested the ability of S. Typhimurium and S. Typhi prepared from overnight static cultures to survive incubation in 1% Triton X-100. The viability of the S. Typhimurium strain SL1344 was not affected by exposure to this detergent: equivalent numbers of surviving bacteria were recovered following a 1 hour incubation on ice in either 1% Triton X-100 in water or in PBS (Fig 1A). However, the S. Typhi strain Ty2 behaved very differently under these conditions: less than 5% of the bacteria survived the incubation in Triton/water relative to incubation in PBS (Fig 1A). This effect was seen with Triton concentrations as low as 0.1% and with incubation times as short as 15 minutes (Fig 1B). Moreover, similar results were obtained when we used Ty2 bacteria prepared from well-aerated overnight shaking cultures (Fig 1C), and when the incubation in Triton/water was carried out at 37°C (Fig 1D).

thumbnail
Fig 1. Effect of Triton X-100 in water on viability of SL1344 and Ty2.

A. Equivalent numbers of SL1344 (S) or Ty2 (T) bacteria, grown overnight in static cultures, were incubated in PBS (Pb) or 1% Triton X-100 in water (Tx) for 1 hour on ice. The number of bacteria surviving in Triton was determined and expressed as a percentage of the number in PBS for each strain. ****p < 0.0001, n = 9 or 10 per group. B. Equivalent numbers of Ty2 bacteria, grown overnight in static cultures, were incubated in PBS or in 0.1% or 1% Triton X-100 in water (Tx) for 15 or 60 minutes on ice as indicated. The number of bacteria surviving in Triton was determined and expressed as a percentage of the number in PBS (the values for PBS are not shown for ease of visualization). n = 4–8 per group. Note the different Y axis scales in A and B. C. Equivalent numbers of Ty2 (T), grown overnight in shaking culture, were incubated in PBS (Pb) or in 1% Triton X-100 in water (Tx) for 60 minutes on ice. The number of bacteria surviving in Triton was determined and expressed as a percentage of the number in PBS. ****p < 0.0001, n = 8 per group. D. Equivalent numbers of Ty2 (T), grown overnight in shaking culture, were incubated in PBS (Pb) or in 1% Triton X-100 in water (Tx) for 60 minutes at 37°C. The number of bacteria surviving in Triton was determined and expressed as a percentage of the number in PBS. ****p < 0.0001, n = 6 per group.

https://doi.org/10.1371/journal.pone.0279372.g001

The compromised viability of Ty2 seen in these experiments could be the result of the detergent itself, the low osmolarity of the detergent solution (which was made in distilled water), or a combination of the two. To discriminate between these possibilities, we examined the ability of the bacteria (prepared from overnight static cultures) to survive a 1 hour incubation on ice in 1% Triton X-100 dissolved in water or PBS, or in plain sterile distilled water, relative to incubation in PBS. In contrast to the effects of incubation in Triton/water, we found that incubation in Triton/PBS had no effect on Ty2 viability, while incubation in just distilled water reduced viability by about 40% (Fig 2A). The results suggested that it was the combined effect of the detergent and hypotonicity that was responsible for the marked decrease in Ty2 survival. In support of this idea, Triton/water-induced killing of Ty2 was inhibited in a dose-dependent manner by the presence of NaCl at 50 and 100 mM concentrations (Fig 2B). Interestingly, when we used bacteria prepared from well-aerated overnight shaking cultures, incubation in just distilled water, either on ice or at 37°C, resulted in about 99% killing of Ty2, with no significant effect on SL1344 (Fig 2C and 2D), similar to the effect of the combination of Triton X-100 and water on Ty2 grown in static culture. Thus, Ty2 appears to be more sensitive than SL1344 to low osmolarity even in the absence of detergent, a characteristic that is particularly prominent in bacteria grown under well-aerated conditions.

thumbnail
Fig 2. Hypotonic conditions are required for the effect of Triton X-100 on Ty2.

A. Equivalent numbers of Ty2 (T), grown overnight in static culture, were incubated in PBS (Pb), in 1% Triton X-100 dissolved in either water (TxW) or PBS (TxP), or in sterile distilled water (W) for 1 hour on ice. The number of bacteria surviving in each condition was determined and expressed as a percentage of the number in PBS. *p = 0.0274, ****p < 0.0001, n = 9–12 per group. B. Equivalent numbers of Ty2 (T) bacteria, grown overnight in static culture, were incubated in PBS (Pb), in 1% Triton X-100 in water (TxW), or in 1% Triton X-100 (Tx) in 50 or 100 mM NaCl (N) for 1 hour on ice. The number of bacteria surviving in each condition was determined and expressed as a percentage of the number in PBS. **p = 0.0089, ***p = 0.0018, ****p < 0.0001, n = 5–8 per group. C. Equivalent numbers of SL1344 (S) or Ty2 (T) bacteria, grown overnight in shaking cultures, were incubated in PBS (Pb) or sterile distilled water (W) for 1 hour on ice. The number of bacteria surviving in each condition was determined and expressed as a percentage of the number in PBS for each strain. ****p < 0.0001, n = 6 per group. D. Equivalent numbers of SL1344 (S) or Ty2 (T) bacteria, grown overnight in shaking cultures, were incubated in PBS (Pb) or sterile distilled water (W) for 1 hour at 37°C. The number of bacteria surviving in each condition was determined and expressed as a percentage of the number in PBS for each strain. ****p < 0.0001, n = 6 per group.

https://doi.org/10.1371/journal.pone.0279372.g002

To further evaluate the effects of hypotonic conditions on Ty2, we assessed growth of the bacteria at 37°C in standard LB (Miller formulation, 10 g/l NaCl, 400 mosmol/l) and in hypotonic LB (no NaCl, 100 mosml/l) under well-aerated shaking conditions [45, 46]. As shown in Fig 3A, growth of Ty2 was clearly inhibited under the hypotonic conditions during the initial 6 hours, although this effect was not seen after overnight incubation. In contrast, the growth of SL1344 was not affected by the hypotonic conditions at any stage of the analysis (Fig 3A). These results were substantiated by enumerating viable bacteria following 6 hours of growth in standard or hypotonic LB at 37°C. The experiment confirmed that there was a significant reduction in the number of viable Ty2 in the hypotonic LB, whereas there was no effect on the viability of SL1344 (Fig 3B).

thumbnail
Fig 3. Growth of Ty2, but not SL1344, is impaired by hypotonic conditions.

A. Overnight shaking cultures of Ty2 and SL1344 were diluted 1000-fold into fresh medium, either standard LB or hypotonic LB, and the bacteria were grown at 37°C with shaking at 220 rpm. Growth curves were generated as described in the methods section. B. Overnight shaking cultures of Ty2 (T) and SL1344 (S) were diluted 1000-fold into fresh medium, either standard LB (StdLB) or hypotonic LB (HypLB), and the bacteria were grown at 37°C with shaking at 220 rpm for 6 hours. The number of viable bacteria in each condition at that time point was determined and expressed as a percentage of the number in standard LB. ***p = 0.0001, n = 5 or 6 per group.

https://doi.org/10.1371/journal.pone.0279372.g003

The heightened susceptibility of S. Typhi Ty2 to hypotonic conditions is the result of a mutated rpoS gene

The Ty2 strain of S. Typhi is known to have a frameshift mutation in the rpoS gene [41, 43]. Similar inactivating mutations of rpoS have been documented in about a third of clinical isolates of S. Typhi, whereas most S. Typhimurium strains, including SL1344, carry the wild-type gene [49]. To determine whether the mutant rpoS gene might contribute to the heightened susceptibility of Ty2 to low osmolarity, we first analyzed expression of two transcriptional targets of rpoS: katE, encoding a major catalase involved in resistance to hydrogen peroxide, and otsA, which encodes a trehalose synthase required to survive hyperosmotic stress [31, 33]. We prepared RNA from SL1344 and Ty2 isolated from overnight shaking cultures grown to stationary phase, when rpoS is maximally expressed, and carried out quantitative reverse transcription-PCR analysis of katE and otsA expression. As shown in Fig 4, Ty2 expressed barely detectable levels of both genes compared to SL1344, consistent with the absence of a functional rpoS in the former strain.

thumbnail
Fig 4. Expression of rpoS target genes in SL1344 and Ty2.

Expression of the katE and otsA genes in overnight shaking cultures of SL1344 (S) and Ty2 (T) was determined by quantitative reverse transcription-PCR. Levels of each transcript were calculated relative to the levels in SL1344. *p = 0.02, n = 4 or 5 per group.

https://doi.org/10.1371/journal.pone.0279372.g004

We then cloned the wild-type rpoS from SL1344 into the expression vector pBH and transformed the contruct into Ty2 to generate the strain Ty2/pBHSTmrpoS. As a control, we also transformed Ty2 with the empty vector to generate the strain Ty2/pBH. The growth curves of Ty2/pBHSTmrpoS and Ty2/pBH were very similar, although both had a longer lag phase than the parental Ty2 (Fig 5A). To confirm functional expression of rpoS in the transformant, we first analyzed the expression of its downstream target katE by quantitative reverse transcription-PCR. As shown in Fig 5B, katE levels in Ty2/pBHSTmrpoS were significantly higher (about 45-fold) than in Ty2, an effect that was not seen in Ty2/pBH. Although a 45-fold increase represents a robust over-expression of katE relative to Ty2, it is lower than the level seen in χ3744, an S. Typhi strain with a wild-type rpoS gene [36], which expresses about a 600-fold higher amount of katE than Ty2 (Fig 5B). Thus, the effect of plasmid-mediated rpoS expression on katE levels in Ty2 can be considered to be within the wild-type range. To further substantiate the functionality of rpoS expression and the consequent increase in katE levels, we assessed the ability of the transformant Ty2/pBHSTmrpoS to survive 1 hour incubation in 0.1 mM hydrogen peroxide in PBS at 37°C. Other investigators have shown that strains of S. Typhi with mutant rpoS are rapidly killed by hydrogen peroxide and that expression of the wild-type gene in such strains confers resistance to the oxidizing agent [43]. Consistent with these published observations and with the rpoS-induced up-regulation of katE that we have documented (Fig 5B), we found that Ty2 transformed with the rpoS expression construct had markedly enhanced resistance to hydrogen peroxide relative to the parental strain, whereas the empty vector had little or no effect (Fig 5C).

thumbnail
Fig 5. Expression of wild-type rpoS in in Ty2.

A. Overnight shaking cultures of Ty2 (T), Ty2 transformed with wild-type rpoS (T-rpoS) and Ty2 transformed with empty vector (T-vec) were diluted 1000-fold into fresh LB and the bacteria were grown at 37°C with shaking at 220 rpm. Growth curves were generated as described in the methods section. B. Expression of the katE gene in overnight shaking cultures of Ty2 (T), Ty2 transformed with wild-type rpoS (T-rpoS), Ty2 transformed with empty vector (T-vec) and χ3744 (wild-type rpoS) was determined by quantitative reverse transcription-PCR. Levels of the transcript in each strain were calculated relative to the level in Ty2. *p = 0.034, ***p = 0.0002, n = 6 per group. C. Equivalent numbers of Ty2 (T), Ty2 transformed with wild-type rpoS (T-rpoS) and Ty2 transformed with empty vector (T-vec), grown overnight in shaking cultures, were incubated in PBS or PBS containing 0.1 mM hydrogen peroxide for 1 hour at 37°C. The number of bacteria surviving in hydrogen peroxide was determined and expressed as a percentage of the number in PBS for each strain (the values for PBS are not shown for ease of visualization). ***p = 0.0001, ****p < 0.0001, n = 5 per group. The difference between T and T-vec was not statistically significant.

https://doi.org/10.1371/journal.pone.0279372.g005

Next, we determined the effect of expressing wild-type rpoS on the viability of Ty2 in distilled water. Transformation with the wild-type rpoS expression construct, but not the empty vector, significantly enhanced the ability of Ty2 to survive incubation in water for 1 hour, both on ice and at 37°C (Fig 6A and 6B). The bacteria were grown overnight in well-aerated shaking cultures for these experiments. The results suggest that the marked sensitivity of Ty2 to hypotonic conditions (as represented by water) may be attributable to the mutation in the rpoS gene.

thumbnail
Fig 6. Wild-type rpoS confers resistance to water in Ty2.

Equivalent numbers of the parental Ty2 (T), Ty2 transformed with wild-type rpoS (T-rpoS) and Ty2 transformed with empty vector (T-vec), grown overnight in shaking cultures, were incubated in PBS or in sterile distilled water for 1 hour on ice (A) or at 37°C (B). The number of bacteria surviving in water was expressed as a percentage of the number in PBS for each strain (the values for PBS are not shown for ease of visualization). A, **p = 0.0007, ***p = 0.0006, n = 6 per group. B, ****p < 0.0001, n = 4 per group.

https://doi.org/10.1371/journal.pone.0279372.g006

Although these findings implicate rpoS in resistance to low osmolarity conditions, they leave open the formal possibility that the plasmid-directed over-expression of rpoS in Ty2 could compensate for some other factor that makes the strain sensitive to a hypotonic environment. Therefore, to demonstrate the role of rpoS more conclusively, we compared the ability of the S. Typhi ISP1820 strains χ3744 (wild-type rpoS), χ9061 (inactive, mutated rpoS), χ9066 (wild-type rpoS allele replaced with arabinose-inducible wild-type rpoS) to survive incubation in distilled water for 1 hour at 37°C. The bacteria were prepared from overnight shaking cultures, with χ9066 grown in the absence or presence of 0.2% arabinose. As shown in Fig 7, the survival of χ3744 was not significantly affected by incubation in water (unlike our results with Ty2), while the viability of χ9061 under these conditions was significantly reduced and that of χ9066 was restored to wild-type levels only if rpoS expression was induced by culture in arabinose. These results confirm that rpoS is required for S. Typhi to survive in the low osmolarity environment of distilled water. Interestingly, the effect of the rpoS mutation on survival in water was less marked in χ9061 than in Ty2 –viability of χ9061 after 1 hour in water at 37°C was about 30% of that in PBS, whereas the viability of Ty2 under the same conditions was about 4% (compare the results in Figs 2D and 7, p < 0.0001). Presumably, this difference reflects variations in the genetic backgrounds of the 2 strains.

thumbnail
Fig 7. rpoS is required for survival of S. Typhi in water.

Equivalent numbers of the S. Typhi strains χ3744 (wild-type rpoS), χ9061 (rpoS inactivated), χ9066 (arabinose-inducible rpoS), grown overnight in shaking cultures (with our without added arabinose–Ara–in the case of χ9066, as indicated), were incubated in PBS or in sterile distilled water for 1 hour at 37°C. The number of bacteria surviving in water was expressed as a percentage of the number in PBS for each strain (the values for PBS are not shown for ease of visualization). ****p < 0.0001, n = 6–9 per group.

https://doi.org/10.1371/journal.pone.0279372.g007

Discussion

The results of our experiments indicate that the viability of the widely used S. Typhi strain Ty2 is markedly reduced by exposure to hypotonic conditions, in contrast to the S. Typhimurium strain SL1344, which survives as well in distilled water as in PBS. This difference between the strains correlates with the presence of a mutated, non-functional rpoS gene in Ty2 and a wild-type version of the gene in SL1344. We demonstrated the functional relevance of this correlation by showing that expression of the wild-type rpoS in Ty2 increased survival in water to the level of SL1344. Furthermore, we confirmed the role of rpoS by showing that an S. Typhi strain with wild-type rpoS retained normal viability in water, that inactivation of the gene in this strain significantly reduced survival in water and that the latter abnormality could be corrected by inducing expression of wild-type rpoS. Taken together, our results indicate that rpoS plays an important role in maintaining the viability of S. Typhi (and presumably of S. Typhimurium also) in a low osmolarity environment. This function adds to the previously documented involvement of rpoS in the ability of Salmonella to adapt to other stresses such as hyperosmolarity, acidity, nutrient deprivation and low temperature, and to cause lethal infection in mice [26–29, 34, 35, 43, 50, 51].

The details of how exactly rpoS protects against low osmolarity in S. Typhi remain to be elucidated. However, studies carried out in E. coli provide clues about the ways in which bacteria adapt to an osmotic downshift [52]. A decrease in the osmolarity of the environment causes a rapid influx of water into the bacterial cell, leading to an increase in outward turgor pressure that has the potential to disrupt the cell envelope and cause death. Bacteria are able to resist or counteract these events by alterations in cytoplasmic solute content and changes to the composition and mechanical properties of cellular membranes and the peptidoglycan layer. An important aspect of this adaptive response involves mechanosensitive channels in the cytoplasmic membrane, exemplified by MscS and MscL, which become activated as a result of an increase in membrane tension, allowing the rapid release of cytoplasmic solutes and the consequent relief of turgor pressure [53–55]. Adequate levels of these channel proteins are required for bacteria to survive a significant decrease in external osmolarity [56]. Interestingly, experiments in E. coli have shown that the expression of both MscS and MscL increases in stationary phase in an rpoS-dependent manner [54]. Correspondingly, and in keeping with the findings reported here, an rpoS null mutant of E. coli undergoes rapid and dramatic lytic death when shifted from stationary phase culture to sterile distilled water [54]. rpoS has also been implicated in remodeling of the cell wall in stationary phase through its control of genes involved in peptidoglycan synthesis and recycling [57, 58]. Thus, effects on the levels of mechanosensitive channels and on peptidoglycan biosynthesis offer potential mechanisms by which rpoS could affect susceptibility to low osmolarity conditions in S. Typhi. Whether such mechanisms actually operate in Salmonella during the transition to water requires further investigation.

Our experiments indicate that the loss of S. Typhi Ty2 viability on incubation in water is significantly less when the bacteria are cultured under static conditions than when they are grown in well-aerated shaking cultures (about 40% killing–Fig 2A–versus about 99% killing–Fig 2C–respectively, p < 0.0001). A potential explanation for this difference is that the static culture had not reached full saturation at the time the bacteria were collected for analysis–it has been shown previously that the lytic effects of an osmotic downshift on an rpoS mutant of E. coli occur only at saturation [54]. An alternative possibility is that growth under poorly aerated conditions induces or facilitates the operation of rpoS-independent mechanisms that confer some degree of protection against lysis in water. Such mechanisms may involve genes that have been implicated in the survival of S. Typhi Ty2 when the bacteria are transferred from LB broth to distilled water [24]. These genes play roles in glycogen biosynthesis and degradation, production of lipopolysaccharide, and, perhaps most pertinently, in peptidoglycan biosynthesis, but how exactly they contribute to resistance against hypoosmotic stress is not yet clear.

Even though Ty2’s susceptibility to lysis in water is reduced by growth in static culture, the bacteria remain exquisitely sensitive to killing by the combined effects of hypotonicity and Triton X-100 even under these conditions. Presumably, the hypotonic environment and the absence of a functional rpoS result in excessive turgor pressure, which may not be lethal on its own (because of the effects of the static culture) but may make the bacteria particularly vulnerable to membrane disrupting agents like Triton. It is important to emphasize that our studies demonstrate that Triton does not affect viability of Ty2 under isotonic conditions, explaining why both S. Typhi and S. Typhimurium can grow in the presence of bile salts, which are detergent-like molecules, at concentrations of up to 3% in LB, and why S. Typhi can colonize the gallbladder in some patients with typhoid [59, 60].

S. Typhi and S. Typhimurium are enteropathogens that are transmitted via contaminated food and water. As such, they are exposed to environments, both within and outside their hosts, that present potentially stressful challenges, including variations in osmolarity. The transition from feces to water, a key step in the infectious cycle, is particularly pertinent to the present discussion since it represents an abrupt osmotic downshift. Our results indicate that rpoS is likely to play an important role in surviving this transition. In addition, since S. Typhi does not productively infect animals other than humans, it may have to exist for extended periods in wells, ponds, rivers and other freshwater collections that represent sources of infection in parts of the world where typhoid is endemic [20–23]. Thus, S. Typhi may be particularly dependent on rpoS for survival in such environments, raising the possibility that targeting this gene or its downstream functions could represent a strategy for interfering with transmission of the pathogen.

Given our findings, it is surprising that about one-third of S. Typhi clinical isolates have a mutated, functionally inactive rpoS, whereas most S. Typhimurium clinical isolates have a wild-type rpoS [49]. This variation in the occurrence of rpoS mutations between the serovars suggests that S. Typhi may be less dependent on rpoS during infection of humans than S. Typhimurium, and so may be able to tolerate loss of function of this gene in the host environment. It will be interesting in this context to determine the frequency of rpoS mutations in S. Typhi isolates obtained from environmental water sources. Our results predict that such mutations would be seen infrequently, if at all, in environmental freshwater isolates.

Finally, it is pertinent to mention that the S. Typhi Ty2 strain is widely used in laboratory studies of host-pathogen interactions, including in gentamicin protection assays that require the use of Triton or similar detergent to lyse mammalian cells infected with the bacteria [48]. Our studies indicate that if the detergent is made in a hypotonic buffer, the number of recovered Ty2 may be falsely low.

Supporting information

S11 Data. Quantitative reverse transcription PCR data for Fig 4.

https://doi.org/10.1371/journal.pone.0279372.s011

(XLSX)

S13 Data. Quantitative reverse transcription PCR data for Fig 5B.

https://doi.org/10.1371/journal.pone.0279372.s013

(XLSX)

Acknowledgments

We would like to thank Dr. Roy Curtiss, III and Dr. Soo-Young Wanda of the University of Florida, Gainesville for graciously sharing their S. Typhi strains.

References

  1. 1. Gibani MM, Britto C, Pollard AJ. Typhoid and paratyphoid fever: a call to action. Curr Opin Infect Dis. 2018; 31: 440–448. pmid:30138141
  2. 2. Mogasale V, Maskery B, Ochiai RL, Lee JS, Mogasale VV, Ramani E, et al. Burden of typhoid fever in low-income and middle-income countries: a systematic, literature-based update with risk factor adjustment. Lancet Glob Health. 2014; 2: e570–e580. pmid:25304633
  3. 3. Majowicz SE, Musto J, Scallan E, Angulo FJ, Kirk M, O’Brien SJ, et al. The global burden of nontyphoidal Salmonella gastroenteritis. Clin Infect Dis. 2010; 50: 882–889.
  4. 4. Kaiser P, Diard M, Stecher B, Hardt WD. The streptomycin mouse model for Salmonella diarrhea: functional analysis of the microbiota, the pathogen’s virulence factors, and the host’s mucosal immune response. Immunol Rev. 2012; 245: 56–83.
  5. 5. Cheng RA, Eade CR, Wiedmann M. Embracing diversity: differences in virulence mechanisms, disease severity, and host adaptations contribute to the success of nontyphoidal Salmonella as a foodborne pathogen. Front Microbiol. 2019; 10: 1368. pmid:31316476
  6. 6. Stevens MP, Kingsley RA. Salmonella pathogenesis and host-adaptation in farmed animals. Curr Opin Microbiol. 2021; 63: 52–58.
  7. 7. Gilchrist JJ, MacLennan CA. Invasive nontyphoidal Salmonella disease in Africa. EcoSal Plus. 2019; 8. pmid:30657108
  8. 8. Leclerc GJ, Tartera C, Metcalf ES. Environmental regulation of Salmonella Typhi invasion-defective mutants. Infect Immun. 1998; 66: 682–691.
  9. 9. Ellermeier JR, Slauch JM. Adaptation to the host environment: regulation of the SPI1 type III secretion system in Salmonella enterica serovar Typhimurium. Curr Opin Microbiol. 2007; 10: 24–29.
  10. 10. Anderson CJ, Kendall MM. Salmonella enterica serovar Typhimurium strategies for host adaptation. Front Microbiol. 2017; 8: 1983. pmid:29075247
  11. 11. De Nisco NJ, Rivera-Cancel G, Orth K. The biochemistry of sensing: enteric pathogens regulate type III secretion in response to environmental and host cues. mBio. 2018; 9: e02122–17. pmid:29339429
  12. 12. Shaw C, Hess M, Weimer BC. Two-component systems regulate bacterial virulence in response to the host gastrointestinal environment and metabolic cues. Virulence. 2022; 13: 1666–1680. pmid:36128741
  13. 13. Deiwick J, Nikolaus T, Erdogan S, Hensel M. Environmental regulation of Salmonella pathogenicity island 2 gene expression. Mol Microbiol. 1999; 31: 1759–1773.
  14. 14. Ellermeier JR, Slauch JM. Fur regulates expression of the Salmonella pathogenicity island 1 type III secretion system through HilD. J Bacteriol. 2008; 190: 476–486.
  15. 15. Aussel L, Zhao W, Hebrard M, Guilhon AA, Viala JP, Henri S, et al. Salmonella detoxifying enzymes are sufficient to cope with the host oxidative burst. Mol Microbiol. 2011; 80: 628–640.
  16. 16. Hernandez SB, Cota I, Ducret A, Aussel L, Casadesus J. Adaptation and preadaptation of Salmonella enterica to bile. PLoS Genet. 2012; 8: e1002459.
  17. 17. Hicks KG, Delbecq SP, Sancho-Vaello E, Blanc M-P, Dove KK, Prost LR, et al. Acidic and divalent cation sensing by PhoQ are dispensable for systemic Salmonella virulence. eLife 4: e06792. pmid:26002083
  18. 18. Matamouros S, Miller SI. S. Typhimurium strategies to resist killing by cationic antimicrobial peptides. Biochim Biophys Acta. 2015; 1848: 3021–3025.
  19. 19. Rhen M. Salmonella and reactive oxygen species: a love-hate relationship. J Innate Immun. 2019; 11: 216–226.
  20. 20. Baker S, Holt KE, Clements ACA, Karkey A, Arjyal A, Boni MF, et al. Combined high-resolution genotyping and geospatial analysis reveals modes of endemic urban typhoid fever transmission. Open Biol. 2011; 1: 110008. pmid:22645647
  21. 21. Gauld JS, Olgemoeller F, Nkhata R, Li C, Chirambo A, Morse T, et al. Domestic river water use and risk of typhoid fever: results from a case-control study in Blantyre, Malawi. Clin Infect Dis. 2020; 70: 1278–1284. pmid:31144715
  22. 22. Mohan VR, Srinivasan M, Sinha B, Shrivastava A, Kanungo S, Sindhu KN, et al. Geographically weighted regression modeling of spatial clustering and determinants of focal typhoid fever incidence. J Infect Dis. 2021; 224: S601–S611. pmid:35238357
  23. 23. Gauld JS, Olgemoeller F, Heinz E, Nkhata R, Bilima S, Wailan AM, et al. Spatial and genomic data to characterize endemic typhoid transmission. Clin Infect Dis. 2022; 74: 1993–2000. pmid:34463736
  24. 24. Kingsley RA, Langridge G, Smith SE, Makendi C, Fookes M, Wileman TM, et al. Functional analysis of Salmonella Typhi adaptation to survival in water. Environ Microbiol. 2018; 20: 4079–4090.
  25. 25. Rychlik I, Barrow PA. Salmonella stress management and its relevance to behaviour during intestinal colonization and infection. FEMS Microbiol Rev. 2005; 29: 1021–1040.
  26. 26. Fang FC, Libby SJ, Buchmeier NA, Loewen PC, Switala J, Harwood J, et al. The alternative sigma factor katF (rpoS) regulates Salmonella virulence. Proc Natl Acad Sci USA. 1992; 89: 11978–11982.
  27. 27. Coynault C, Robbe-Saule V, Norel F. Virulence and vaccine potential of Salmonella Typhimurium mutants deficient in the expression of the RpoS (σS) regulon. Mol Microbiol. 1996; 22: 149–160.
  28. 28. Wilmes-Riesenberg MR, Foster JW, Curtiss R 3rd. An altered rpoS allele contributes to the avirulence of Salmonella Typhimurium LT2. Infect Immun. 1997; 65: 203–210.
  29. 29. Nickerson CA, Curtiss R 3rd. Role of sigma factor RpoS in initial stages of Salmonella Typhimurium infection. Infect Immun. 1997; 65: 1814–1823.
  30. 30. Kowarz L, Coynault C, Robbe-Saule V, Norel F. The Salmonella Typhimurium katF (rpoS) gene: cloning, nucleotide sequence, and regulation of spvR and spvABCD virulence plasmid genes. J Bacteriol. 1994; 176: 6852–6860.
  31. 31. Fang FC, Chen CY, Guiney DG, Xu Y. Identification of sigma S-regulated genes in Salmonella Typhimurium: complementary regulatory interactions between sigma S and cyclic AMP receptor protein. J Bacteriol 1996; 178: 5112–5120.
  32. 32. Spectror MP, Garcia Del Portillo F, Bearson SMD, Mahmud A, Magut M, Finlay BB, et al. The rpoS-dependent starvation stress response locus stiA encodes a nitrate reductase (narZYWV) required for carbon-starvation-inducible thermotolerance and acid tolerance in Salmonella Typhimurium. Microbiology. 1999; 145: 3035–3045.
  33. 33. Ibanez-Ruiz M, Robbe-Saule V, Hermant D, Labrude S, Norel F. Identification of RpoS (sigma S)-regulated genes in Salmonella enterica serovar Typhimurium. J Bacteriol. 2000; 182: 5749–5756.
  34. 34. Khan AQ. Zhao L, Hirose K, Miyake M, Li T, Hashimoto Y, et al. Salmonella Typhi rpoS mutant is less cytotoxic than the parent strain but survives inside resting THP-1 macrophages. FEMS Microbiol Lett. 1998; 161: 201–208.
  35. 35. Alam MS, Zaki MH, Yoshitake J, Akuta, T, Ezaki T, Akaike T. Involvement of Salmonella enterica serovar Typhi RpoS in resistance to NO-mediated host defense against serovar Typhi infection. Microb Pathog. 2006; 40: 116–125.
  36. 36. Santander J, Wanda S-Y, Nickerson CA, Curtiss R 3rd. Role of RpoS in fine-tuning the synthesis of Vi capsular polysaccharide in Salmonella enterica serotype Typhi. Infect Immun. 2007; 75: 1382–1392.
  37. 37. Jofre MR, Rodriguez LM, Villagra NA, Hidalgo AA, Mora GC, Fuentes JA. RpoS integrates CRP, Fis and PhoP signaling pathways to control Salmonella Typhi hlyE expression. BMC Microbiol. 2014; 14: 139. pmid:24885225
  38. 38. Zheng X, Ji Y, Weng X, Huang X. RpoS-dependent expression of OsmY in Salmonella enterica serovar Typhi: activation under stationary phase and SPI-2-inducing conditions. Curr Microbiol. 2015; 70: 877–882.
  39. 39. Velasquez JC, Hidalgo AA, Villagra N, Santiviago CA, Mora GC, Fuentes JA. SPI-9 of Salmonella enterica serovar Typhi is constituted by an operon positively regulated by RpoS and contributes to adherence to epithelial cells in culture. Microbiology. 2016; 162: 1367–1378.
  40. 40. Robbe-Saule V, Coynault C, Norel F. The live oral typhoid vaccine Ty21a is a rpoS mutant and is susceptible to various environmental stresses. FEMS Microbiol Lett. 1995; 126: 171–176.
  41. 41. Robbe-Saule V, Norel F. The rpoS mutant allele of Salmonella Typhi Ty2 is identical to that of the live typhoid vaccine Ty21a. FEMS Microbiol Lett. 1999; 170: 141–143.
  42. 42. Shi H, Santander J, Brenneman KE, Wanda S-Y, Wang S, Senechal P, et al. Live recombinant Salmonella Typhi vaccines constructed to investigate the role of rpoS in eliciting immunity to a heterologous antigen. PLoS One. 2010; 5: e11142. pmid:20585446
  43. 43. Burda WN, Brenneman KE, Gonzales A, Curtiss R 3rd. Conversion of RpoS- attenuated Salmonella enterica serovar Typhi vaccine strains to RpoS+ improves their resistance to host defense barriers. mSphere. 2018; 3: e00006–18. pmid:29507892
  44. 44. Verma S, Prescott RA, Ingano L, Nickerson KP, Hill E, Faherty CS, et al. The YrbE phospholipid transporter of Salmonella enterica serovar Typhi regulates the expression of flagellin and influences motility, adhesion and induction of epithelial inflammatory responses. Gut Microbes. 2020; 11: 526–538.
  45. 45. Bhagwat AA, Jun W, Liu L, Kannan P, Dharne M, Pheh B, et al. Osmoregulated periplasmic glucans of Salmonella enterica serovar Typhimurium are required for optimal virulence in mice. Microbiology. 2009; 155: 229–237.
  46. 46. Amar A, Pezzoni M, Pizarro RA, Costa CS. New envelope stress factors involved in σE activation and conditional lethality of rpoE mutations in Salmonella enterica. Microbiology. 2018; 164: 1293–1307.
  47. 47. Cherayil BJ, McCormick BA, Bosley J. Salmonella enterica serovar Typhimurium-dependent regulation of inducible nitric oxide synthase expression in macrophages by invasins SipB, SipD and SipD and effector SopE2. Infect Immun. 2000; 68: 5567–5574.
  48. 48. Lee CA, Falkow S. The ability of Salmonella to enter mammalian cells is affected by bacterial growth rate. Proc Natl Acad Sci USA. 1990; 87: 4304–4308.
  49. 49. Robbe-Saule V, Algorta G, Rouilhac I, Norel F. Characterization of the RpoS status of clinical isolates of Salmonella enterica. Appl Environ Microbiol. 2003; 69: 4352–4358.
  50. 50. Munro PM, Flatau GN, Clement RL, Gauthier MJ. Influence of the RpoS (KatF) sigma factor on maintenance of viability and culturability of Escherichia coli and Salmonella Typhimurium in seawater. Appl Environ Microbiol. 1995; 61: 1853–1858.
  51. 51. McMeechan A, Roberts M, Cogan TA, Jorgensen F, Stevenson A, Lewis C, et al. Role of the alternative sigma factors sigmaE and sigmaS in survival of Salmonella enterica serovar Typhimurium during starvation, refrigeration and osmotic shock. Microbiology (Reading). 2007; 153: 263–269.
  52. 52. Altendorf K, Booth IR, Gralla J, Greie JC, Rosenthal AZ, Wood JM. Osmotic stress. EcoSal Plus. 2009; 3. pmid:26443764
  53. 53. Booth IR, Blount P. The MscS and MscL families of mechanosensitive channels act as emergency release valves. J Bacteriol. 2012; 194: 4802–4809.
  54. 54. Stokes NR, Murray HD, Subramaniam C, Gourse RL, Louis P, Bartlett W, et al. A role for mechanosensitive channels in survival of stationary phase: regulation of channel expression by RpoS. Proc Natl Acad Sci USA. 2003; 100: 15959–15964. pmid:14671322
  55. 55. Bialecka-Fornal M, Lee HJ, Phillips R. The rate of osmotic downshift determines the survival probability of bacterial mechanosensitive channel mutants. J Bacteriol. 2015; 197: 231–237.
  56. 56. Chure G, Lee HJ, Rasmussen A, Phillips R. Connecting the dots between mechanosensitive channel abundance, osmotic shock, and survival at single-cell resolution. J Bacteriol. 2018; 200: e00460–18. pmid:30201782
  57. 57. Dougherty TJ, Pucci MJ. Penicillin-binding proteins are regulated by rpoS during transitions in growth states of Escherichia coli. Antimicrob Agents Chemother. 1994; 38: 205–210.
  58. 58. Lessard IA, Walsh CT. Van X, a bacterial D-alanyl-D-alanine dipeptidase: resistance, immunity or survival function? Proc Natl Acad Sci USA. 1999; 96: 11028–11032.
  59. 59. Gunn JS, Marshall JM, Baker S, Dongol S, Charles RC, Ryan ET. Salmonella chronic carriage: epidemiology, diagnosis and gall bladder persistence. Trends Microbiol. 2014; 22: 648–655.
  60. 60. Johnson R, Ravenhall M, Pickard D, Dougan G, Byrne A, Frankel G. Comparison of Salmonella enterica serovars Typhi and Typhimurium reveals serovar-specific responses to bile. Infect Immun. 2018. 86: e00490–17. pmid:29229736