Whole blood RNA-seq demonstrates an increased host immune response in individuals with cystic fibrosis who develop nontuberculous mycobacterial pulmonary disease

Miguel Dario Prieto; Jiah Jang; Alessandro N. Franciosi; Yossef Av-Gay; Horacio Bach; Scott J. Tebbutt; Bradley S. Quon

doi:10.1371/journal.pone.0278296

Abstract

Background

Individuals with cystic fibrosis have an elevated lifetime risk of colonization, infection, and disease caused by nontuberculous mycobacteria. A prior study involving non-cystic fibrosis individuals reported a gene expression signature associated with susceptibility to nontuberculous mycobacteria pulmonary disease (NTM-PD). In this study, we determined whether people living with cystic fibrosis who progress to NTM-PD have a gene expression pattern similar to the one seen in the non-cystic fibrosis population.

Methods

We evaluated whole blood transcriptomics using bulk RNA-seq in a cohort of cystic fibrosis patients with samples collected closest in timing to the first isolation of nontuberculous mycobacteria. The study population included patients who did (n = 12) and did not (n = 30) develop NTM-PD following the first mycobacterial growth. Progression to NTM-PD was defined by a consensus of two expert clinicians based on reviewing clinical, microbiological, and radiological information. Differential gene expression was determined by DESeq2.

Results

No differences in demographics or composition of white blood cell populations between groups were identified at baseline. Out of 213 genes associated with NTM-PD in the non-CF population, only two were significantly different in our cystic fibrosis NTM-PD cohort. Gene set enrichment analysis of the differential expression results showed that CF individuals who developed NTM-PD had higher expression levels of genes involved in the interferon (α and γ), tumor necrosis factor, and IL6-STAT3-JAK pathways.

Conclusion

In contrast to the non-cystic fibrosis population, the gene expression signature of patients with cystic fibrosis who develop NTM-PD is characterized by increased innate immune responses.

Citation: Prieto MD, Jang J, Franciosi AN, Av-Gay Y, Bach H, Tebbutt SJ, et al. (2022) Whole blood RNA-seq demonstrates an increased host immune response in individuals with cystic fibrosis who develop nontuberculous mycobacterial pulmonary disease. PLoS ONE 17(12): e0278296. https://doi.org/10.1371/journal.pone.0278296

Editor: Abdelwahab Omri, Laurentian University, CANADA

Received: August 29, 2022; Accepted: November 14, 2022; Published: December 8, 2022

Copyright: © 2022 Prieto et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: The RNA sequencing data, raw reads, and normalized counts were deposited in the Gene Expression Omnibus repository of NCBI (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE205161, access token: kxsteiucbhebbkp). The dataset will be publicly available without restriction once we finish the publication process. The scripts for analysis of clinical, demographic, and genomic data have been deposited with the rest of the necessary data sets in dryad (https://datadryad.org/stash/share/FZ1DbrVy1KzveU5UQ_UbjqG-IrfFSouFSpspXhdnghg). While completing the submission process, the data is accessible by request of the reviewers. Once published, it will be made available without restrictions.

Funding: Franciossi AN is supported by a Research Trainee Award (RT-2020-0493) from the Michael Smith Foundation for Health Research (https://www.msfhr.org/). Quon BS is supported by a Michael Smith Foundation for Health Research Scholar Award, with no reference number. Av-Gay Y is supported by the Cystic Fibrosis Canada Foundation, with no reference number (https://www.cysticfibrosis.ca/). The funders had no role in study design, data collection, and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Cystic fibrosis (CF) is a life-limiting genetic condition more prevalent in white populations (affecting approximately 1 in 3,000–4,000 live newborns) [1, 2]. People living with CF experience chronic respiratory symptoms and a steady decline in lung function leading to an increased risk of death or the need for a lung transplant [2, 3]. CF patients suffer from persistent and repetitive infections, including an increased lifetime risk of infection and disease caused by nontuberculous mycobacteria (NTM). According to data from the United States of America CF registry, around 12% of CF individuals in a given year have a positive culture for NTM, mostly of species belonging to the Mycobacterium avium (MAC) and Mycobacterium abscessus (MABs) complexes [3]. The clinical course of NTM infection in patients with CF is variable, ranging from an isolated positive culture to NTM pulmonary disease (NTM-PD) [4, 5]. The latter is diagnosed in a patient with two or more positive cultures of the same NTM, clinical deterioration, and characteristic radiological findings after excluding more common causes of the deteriorated status [4]. In CF, NTM-PD has been associated with an accelerated decline in lung function, and sputum positivity for NTM may affect eligibility for lung transplants [4–8].

Clinically, NTM infection in CF has been linked to specific age groups, clinical history of allergic bronchopulmonary aspergillosis, infection with Aspergillus spp., and chronic exposure to immunomodulatory drugs like macrolides and steroids [9–14]. However, fewer studies have evaluated risk factors for the progression from NTM infection to NTM-PD in the CF population. Caverly et al. showed that changes in the microbiome composition, including relative abundance of the Rhotia taxonomic unit, were associated with developing NTM-PD (n = 25) [15]. Furthermore, based on a prospective cohort of 96 CF patients with positive NTM culture, Martiniano et al. showed that those who progressed to NTM-PD had lower baseline Forced Expiratory Volume in 1 second (FEV1) and a faster lung function decline in the year before NTM infection [5]. While the role of the host immune response in the development of NTM-PD remains unclear in CF, various genetic polymorphisms have been reported in association with the diagnosis of NTM-PD in the non-CF population [16]. Additionally, Cowman et al. compared whole blood transcriptomics of patients with chronic obstructive pulmonary disease or non-CF bronchiectasis with and without a diagnosis of NTM-PD. Using microarray technology, they found reduced expression of genes involved in lymphocyte effector functions and interferon-γ production in those who developed NTM-PD. Also, they reported that those with NTM-PD and poor survival after diagnosis had a positive enrichment (higher expression) of innate immunity pathways compared to those with NTM-PD and better outcomes [17]. No prior studies have studied the relationship between host immune response to NTM and the development of NTM-PD in CF. In this exploratory study, we hypothesized that patients with CF who develop NTM-PD would have intrinsic downregulation of gene expression in interferon-γ and immune-related pathways. Thus, we evaluated patterns of gene expression associated with NTM-PD in a cohort of CF patients using whole-blood transcriptomics.

Methods

Study population and clinical data

This study is a secondary data analysis using blood samples and data from the “CF Biomarker” cohort approved by the University of British Columbia-Providence Health Care ethics review board (H12-00835). The local ethics board also approved the secondary analysis (H20-00117). Patients in the parent cohort were recruited following informed consent at the St. Paul’s Hospital Adult CF Clinic (Vancouver, Canada) between January 2012 and December 2019. In the current study, we included participants who consented to the future use of their samples and data, had at least one positive respiratory culture for NTM, and had a whole blood RNA sample available (PAXgene^® stored at -70°C). Lung transplant recipients and subjects without a definite diagnosis of CF were excluded [18]. We preferentially selected blood samples taken during clinically stable periods and closest to the first positive growth of NTM. We did not limit blood sampling to within a specified time frame in relation to NTM infection or the development of NTM-PD as we expected an intrinsic downregulation of gene expression in immune-related pathways in patients with CF who develop NTM-PD.

Clinical and demographic data analysis

Demographic characteristics, anthropometric measurements, pulmonary function tests, CFTR genotyping results, and microbiology laboratory reports were extracted from the clinical charts using a pre-defined case report form. Clinical and demographic data were extracted starting from 2 years before the recorded time of first NTM isolation for each patient (as far back as May 2001) and follow-up data was reviewed for the development of NTM-PD or not up until September 2022. Participants were censored at the time of NTM-PD diagnosis, lung transplant, or death. The diagnosis of NTM-PD was defined independently by two expert CF clinicians, based on current CF NTM guidelines, and disagreements were resolved by consensus [4]. Lung function measurements (forced expiratory volume in 1 second [FEV₁]) were standardized according to the 2012 Global Lung Function Initiative equation [19]. Clinical and demographic differences were compared according to the development or not of NTM-PD using univariable statistics in R studio (build 443) and R version 4.1.3 with the tidyverse package collection [20–22]. Statistical comparisons used parametric and non-parametric tests depending on the skewness of data and the type of variable analyzed, the significance level was defined at alpha < 0.05. Plots were produced using the ggplot and ggpubr packages [23, 24].

RNA extraction and RNA sequencing experiments

The PAXgene Blood micro-RNA Kit was used for RNA extraction (in five batches) following the manufacturer’s instructions (QIAGEN) and omitting the DNA depletion steps [25]. The quality of the extracted RNA was evaluated using the 260/280nm ratio in a NanoDrop^™ spectrophotometer; the mean concentration was 117.4 ± 73.2 (SD) ng/uL. The RNA Integrity Number (RIN) was evaluated using a 2100 Bioanalyzer instrument from Agilent. A RIN ≥ 7 was required for sequencing; two samples failed bioanalyzer quality control and were re-extracted. Poly-A RNA-seq libraries were prepared in a single batch with a starting concentration of 250 ng per sample. The library preparation was performed using the strand-specific Nextera NEB mRNA kit with adapters AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT. The NovaSeq 6000 S4 PE100 (Illumina) platform with automatic base calling (RTA3) and an initial concentration of 200 pM per library was used for sequencing. Samples were multiplexed in a single flow cell after dual barcoding. The sequencing run generated 150 bp paired-end reads, the lowest mean Phred+33 score per file was 36/40. The median number of reads per sample was 65 x 10⁶ (range: 36-151 x 10⁶). All transcriptomic data from this study can be found in NCBI Gene Expression Omnibus with accession GSE20516. The scripts to reproduce our results and additional metadata are deposited in the Dryad Digital Repository (doi:10.5061/dryad.np5hqbzx2).

RNA-seq data analysis

Alignment and quantification of raw reads (FASTQ format) were performed in a High-Performance computational cluster (CentOS 7 Linux). Fast-QC was used to evaluate the quality of raw reads before and after alignment [26]. Untrimmed reads were aligned to the primary human assembly GRCh38.p13 v38 (May 21, 2021) from GENCODE using STAR v 2.7 [27, 28]. We produced gene-level quantification (bam format) in RSEM v1.3.3 with default parameters [29]. Quality control of alignment was performed using Picard tools, and quality reports were summarized with MultiQC [30, 31]. The raw count data was imported to R version 4.1.1 using tximport [32] and annotated with the Ensembl database version 104 of Bioconductor [33, 34]. Globin subunits and genes showing abnormally large expression counts (>7*10⁷) were filtered out before analysis; prior to filtering, 68–93% of reads per sample were overrepresented. An outlier sample was detected in exploratory principal component analysis (CFB2006) and removed from the dataset. Count data were corrected for extraction batches using the ComBat-seq algorithm [35]. Differential gene expression of the group with vs. without NTM-PD was performed using DESeq2 (v 1.3.2) with a cut-off FDR of 0.3. No minimum fold-change threshold was defined to increase the recovery of differentially expressed genes in this exploratory cohort [36]. Finally, gene set enrichment analysis of the molecular signatures database (human hallmark pathways) was performed with the fgsea package using the fold change ranked results from DESeq2 [37–40]. The cell-specific population compositions were estimated and explored using gene expression deconvolution in cibersortX against the complete blood cell counts (CBC) measured in patients at the time of sample procurement. The deconvolution process used the LM22 (22 blood immune cell types) signature matrix, bulk mode batch correction, and a hundred iterations [41]. Reporting of high-throughput sequencing methods follows the MINISEQE recommendations [42].

Results

Study cohort selection

Among 189 participants included in the CF biomarkers study, 53 had one or more positive airway cultures for NTM, and 42 of these fulfilled all eligibility criteria and were included in the study. Exclusion criteria included unclear CF diagnosis (n = 1), lung transplant recipient (n = 1), and no whole blood RNA sample available (n = 9). The diagnosis of NTM-PD was defined independently by two expert clinicians with a Cohen’s kappa of 90%. Overall, 12 out of the 42 (29%) participants progressed to NTM-PD during clinical follow-up (up to September 2022). Among the 30 patients who did not develop NTM-PD, 22 spontaneously cleared the NTM from their respiratory cultures (12 after a single positive culture and 10 after multiple cultures), 3 had chronic colonization (NTM positive on all cultures) and 5 had intermittent positive cultures for NTM. The median follow-up time was 83.6 months (IQR 43–136), and the median interval between the first NTM growth and diagnosis of NTM-PD was 14.8 months (IQR 3–30). Patients who did not develop NTM-PD were followed for a minimum of 20.7 months after the first isolation of an NTM. Most patients were infected with M. avium complex (n = 22 in total; n = 7 progressed to NTM-PD) or M. abscessus complex (n = 12 in total; n = 5 progressed to NTM-PD). The remaining mycobacterial species included M. gordonae (n = 3), M. fortuitum (n = 2), M. cosmeticum, M. peregrinum, and M. simiae (n = 1 each), and none of these developed NTM-PD.

Clinical and demographic characteristics of the cohort.

Included participants were predominantly male (n = 29, 69%), with a median age of 25 years, and 83% had at least one copy of F508del. Table 1 summarizes the demographic and clinical characteristics of the study cohort at baseline (first NTM growth). No differences at baseline were found in exposure to azithromycin (prior three months) or oral steroids (prior month) between patients who did vs. did not progress to NTM-PD. Furthermore, baseline clinical characteristics, including body mass index, FEV₁, and sputum microbiology, were not significantly different between the NTM-PD groups. No significant differences were found in co-infection rates at baseline for Pseudomonas aeruginosa, Burkholderia spp., Stenotrophomonas maltophilia, or Aspergillus spp. At baseline, there were also no differences in demographic or clinical factors (age, sex, body mass index, ppFEV1, genotype, or co-morbidities) between patients infected with MAC or MABs (S1 Table). The median time window between the first NTM growth and whole blood RNA collection was 20.8 months (range between -15.2 and 171 months as 5/42 samples were collected before first NTM growth). Six patients were sampled after therapy for NTM-PD (median of 49 months before sampling).

Download:

Table 1. Demographic and clinical characteristics of included patients at baseline, stratified by NTM-PD status.

https://doi.org/10.1371/journal.pone.0278296.t001

There were no significant differences at baseline in the absolute number of leukocytes, neutrophils, monocytes, or lymphocytes between NTM-PD groups (S1 Fig). A principal component analysis of all white blood cell parameters explained more than 50% of the variance in the first two components but did not separate NTM groups.

Quality assessment of RNA-seq data

Quality control of raw reads did not show bias in nucleotide distribution, sequencing depth, or base calling quality. At least 94.6% of the reads per sample aligned to the reference genome, and at least 49.1% of them aligned to protein-coding regions, see S2 Fig. During exploratory principal component analysis of normalized and batch corrected gene counts, we found no particular grouping by extraction batch, biological sex, or mycobacterial species (after removing the CFB2006 outlier). A principal component analysis of normalized counts did not show a graphical difference according to the timing of sample procurement for RNAseq after dividing the cohort into three groups: before the first positive NTM culture, after the first isolation without progression to NTM-PD, and after the first isolation with progression to NTM-PD (S3 Fig). A PermANOVA test of this distance matrix mas not significant (p = 0.29) [43]. CybersortX deconvolution of sequencing counts showed a good prediction of the initial white blood cell counts. We observed Pearson correlations greater than 0.8 for lymphocyte and neutrophil counts and a moderate correlation (r = 0.4) for monocyte counts (S4 Fig).

Evaluation of whole blood gene expression of candidate genes of NTM-PD in CF

We explored the candidate genes identified by Cowman et al. in our cohort. Among the 213 gene transcripts associated with NTM-PD in their cohort, only two genes (interleukin-2 receptor subunit Beta—IL-2RB and granzyme K—GZMK) were differentially expressed in our study population (FDR < 0.3) [17]. We also explored the mean expression of the differentially expressed genes with the highest fold change in the Cowman cohort. We found no apparent trends or statistical differences using univariable analysis. S5 Fig shows the mean expression of 13 of the top 15 features reported by Cowman et al. in our NTM-PD groups. We also evaluated the genes associated with poorer survival in those with NTM-PD among Cowman’s cohort, as a potentially similar clinical course to the development of NTM-PD in CF. Still, none of the 215 genes associated with decreased survival was found as differentially expressed in our cohort according to the adjusted p-value. Furthermore, only 6 out of these 215 genes had an unadjusted p-value below 0.05.

Whole blood gene expression of individuals who developed NTM-PD in our CF cohort

Differential gene expression with DESeq2 identified 111 differentially expressed genes (DEG) at an FDR cut-off of < 0.3. The top 30 DEG are summarized in Table 2 in descending order of adjusted p-value. The Bland–Altman, and Volcano plots in Fig 1 summarize the differential gene expression analysis results. We used gene set enrichment analysis of the molecular signatures database to explore the biological implications of these gene expression results. The results showed significant positive enrichment (higher expression in those who developed NTM-PD) in pathways involved in the interferon-α response (Adjusted p = 2.5 e^-09), interferon-γ response (Adjusted p = 2.5 e^-09), and IL6-JAK-STAT3 signaling (Adjusted p = 1.88 e^-05). Table 3 includes all enriched pathways with an adjusted p-value below 0.001.

Download:

Fig 1. Volcano plot and MA plot of DESeq2 differential expression analysis.

(A) Bland-Altman plot of normalized mean counts and shrunk (apeglm) Log2 fold-changes. The differentially expressed genes are in red, and the top 15 features are labeled. (B) Volcano plot of differential gene expression analysis with cut-offs of p< 0.001 and Log2 fold-change larger than absolute 0.5. Highlighted in red are genes with higher transcription levels in patients who progressed to NTM-PD, in green are those with lower expression in the same group.

https://doi.org/10.1371/journal.pone.0278296.g001

Download:

Table 2. Top 30 differentially expressed genes in those who did vs. did not develop NTM-PD.

https://doi.org/10.1371/journal.pone.0278296.t002

Download:

Table 3. Gene set enrichment analysis of whole blood gene expression in those who did vs. did not develop NTM-PD.

https://doi.org/10.1371/journal.pone.0278296.t003

Discussion

The main finding from this exploratory study is that CF individuals who developed NTM-PD after initial growth of NTM had increased expression of genes involved in pathways related to interferon responses, tumor necrosis factor-α production, and IL6-JAK-STAT3 signaling [17]. This contrasts with our expectation as we hypothesized that defective cellular immunity, as reflected by decreased gene expression in host immune response pathways, would confer an increased risk of persistent NTM infection and subsequent development of pulmonary disease.

While our results may seem contradictory to the findings reported by Cowman et al., which found defective T lymphocyte and interferon-γ immune responses in patients with NTM-PD, individuals with NTM-PD in their study were compared to control subjects with respiratory disease (COPD or bronchiectasis) but without NTM. As such, the decreased immune responses could have conferred susceptibility to NTM-PD in their study involving subjects without other known host immune-related risk factors for NTM. The airways of individuals with CF already create a hospitable environment for NTM growth and infection; therefore, reduced protective immunity in this setting could play a less significant role.

In our study, we compared CF individuals with NTM infection who did vs. did not progress to NTM-PD, and a pro-inflammatory innate immune response characterized the latter. Indeed, much of the lung damage that occurs in CF results from the deleterious effects of an overexuberant inflammatory response to infection, as the host is incapable of controlling microbial growth due to intrinsic host defense defects related to CFTR dysfunction [44, 45]. Our results demonstrating increased immune activity in patients with NTM-PD are consistent with a recent study that compared the bronchoalveolar lavage fluid of CF patients with vs. without NTM infection and found that those with NTM infection had increased immune cells and inflammation [46]. Moreover, regions of the lung with increased inflammation correlated with greater lung tissue damage based on CT scans [46].

Interestingly, several of the top differentially expressed genes found in the Cowman cohort were also downregulated in our cohort. Among them, granzyme K and interleukin 2 receptor β were differentially expressed in our cohort, see S5 Fig. Both genes are primarily expressed by lymphocytes but their relationship with susceptibility to NTM-PD remains unclear. Granzyme K is an effector protein involved in the cytotoxic activity of CD8+ lymphocytes, while interleukin 2 participates in the expansion of T cells. Despite the decreased expression of these genes, the pro-inflammatory response involving innate immune pathways related to interferons and tumor necrosis factor predominated in our enrichment results. The functional significance and the cells responsible for this increased production need to be further elucidated.

Our study has several limitations that should be acknowledged. The parent study was not initially designed for the discovery of new biomarkers or to evaluate the pathological process leading to NTM-PD in patients with CF. Instead, we performed a secondary exploratory analysis with existing samples to confirm if a gene expression pattern associated with NTM-PD was also present in CF patients. As such, we cannot ascertain the temporal relationship between infection with NTM and the gene expression profiles because the time window between NTM positivity and whole blood sampling was variable (median of 20 months). Based on preliminary data, we did not control for this factor as we expected to identify permanent intrinsic deficits in host defense associated with developing NTM-PD. Future studies will benefit from regular blood sampling in the period between the first NTM growth and the development of NTM-PD to determine if the innate immune response ramps up over time. Furthermore, additional factors that may affect the progression to NTM-PD, like the virulence factors of infecting NTM and the lung microbiome composition, should be explored. The gene expression results are unlikely to be biased by the initial proportion of cell populations because baseline CBC data showed no significant differences, and the deconvolution of gene expression data corroborated the distribution of cell populations in the CBC. The interval between the diagnosis of NTM-PD and sampling may also affect the results. Interestingly, a sensitivity analysis excluding 6 samples from patients sampled after starting treatment for NTM-PD displayed a similar pattern of enrichment to our main results (S2 Table). Finally, our cohort represents mostly patients naïve to CFTR modulator therapy as access to lumacaftor/ivacaftor and tezacaftor/ivacaftor was very limited during the study period in Canada due to lack of public and private reimbursement in most cases and elexacaftor/tezacaftor/ivacaftor was not reimbursed until September 2022. Only four patients, including one who progressed to NTM-PD, were receiving modulator therapy when the blood sample was collected (1 on ivacaftor, 2 on lumacaftor/ivacaftor, and 1 on tezacaftor/ivacaftor). As CFTR modulator therapy may change the lung microenvironment and affect the host susceptibility to mycobacterial infection and subsequent development of disease, our results may have limited generalizability to a CFTR modulator treated population but can serve as a baseline comparison for future studies in cohorts receiving these highly effective therapies [47].

In conclusion, our cohort shows that gene expression in patients who develop NTM-PD displays an exaggerated expression of genes that participate in innate immune responses. Overall, this study provides novel insights into the host response to NTM infection in the presence of CFTR dysfunction. The results of this exploratory cohort are valuable for future biomarker discovery and can serve as a validation dataset for other research groups.

Supporting information

S1 Table. Demographic and clinical characteristics of patients infected with MAC or MABs at the time of first positive NTM culture.

https://doi.org/10.1371/journal.pone.0278296.s001

(DOCX)

S2 Table. Gene set enrichment analysis of whole blood gene expression in those who did vs. did not develop NTM-PD, excluding 6 samples taken after diagnosis of NTM-PD.

https://doi.org/10.1371/journal.pone.0278296.s002

(DOCX)

S1 Fig. Absolute whole blood cell population counts in samples used for RNAseq.

Boxplots with the distribution of absolute values for leukocytes, neutrophils, lymphocytes, and monocytes in complete blood counts at the time of blood sample procurement. No significant differences using the unpaired Wilcoxon rank-sum test.

https://doi.org/10.1371/journal.pone.0278296.s003

(TIF)

S2 Fig. Assignment of reads to genomic regions produced by Picard tools.

Coding: protein-coding region. UTR: untranscribed region. Intronic: intronic region. Intergenic: intergenic region. Ribosomal: mapping to ribosomal RNA or proteins. PF not aligned: bases that passed the quality filter and were not aligned.

https://doi.org/10.1371/journal.pone.0278296.s004

(TIF)

S3 Fig. Principal component analysis of normalized and batch corrected count data.

Separated by the timing of blood sample procurement for RNAseq into three categories: before first positive NTM culture, after first positive NTM culture without progression to NTM-PD, and after first positive NTM culture with progression to NTM-PD. No apparent separation is seen graphically. A PermANOVA test shows no significant differences in the distance matrices by group (p = 0.29).

https://doi.org/10.1371/journal.pone.0278296.s005

(TIFF)

S4 Fig. CibersortX deconvolution of cell percentages compared to ground truth reference values in CBC.

https://doi.org/10.1371/journal.pone.0278296.s006

(TIF)

S5 Fig. Mean expression values per NTM-PD group in top differentially expressed genes in Cowman analysis.

The p-values represent the results of independent Wilcoxon tests. The feature TRGC1 (T Cell Receptor Gamma Constant 1) was a duplicated probe in the initial analysis, while the uncharacterized locus FLJ45825 was not detected in our dataset. PMS2P1: PMS1 homolog 2, Mismatch Repair System Component Pseudogene 1. CRTAM: Cytotoxic and regulatory T cell Molecule. IFNG: Interferon Gamma. GZMK: Granzyme K. PZP: PZP alpha-2-macroglobulin like. XCL2: X-C motif chemokine ligand 2. AK5: Adenylate kinase 5. FCRL3: Fc receptor Like 3. PPIH: Peptidylprolyl isomerase H. A2M: Alpha-2-macroglobulin. TIGIT: T cell immunoreceptor with Ig and ITIM domains. MUC12: Mucin 12, cell surface associated.

https://doi.org/10.1371/journal.pone.0278296.s007

(TIF)

Acknowledgments

The authors would like to acknowledge the feedback and support of Kang Dong in the review of the bioinformatics pipeline employed for analysis. This research was supported in part through computational resources and services provided by Advanced Research Computing at the University of British Columbia.

References

1. Sanders DB, Fink AK. Background and Epidemiology. Pediatric Clinics of North America. 2016;63: 567–584. pmid:27469176
- View Article
- PubMed/NCBI
- Google Scholar
2. O’Sullivan BP, Freedman SD. Cystic fibrosis. The Lancet. 2009;373: 1891–1904.
- View Article
- Google Scholar
3. Foundation CF. Cystic Fibrosis Foundation Patient Registry 2019 Annual Data Report. Cystic Fibrosis Foundation; 2020.
4. Floto RA, Olivier KN, Saiman L, Daley CL, Herrmann JL, Nick JA, et al. US Cystic Fibrosis Foundation and European Cystic Fibrosis Society consensus recommendations for the management of non-tuberculous mycobacteria in individuals with cystic fibrosis. Thorax. 2016;71: i1–i22. pmid:26666259
- View Article
- PubMed/NCBI
- Google Scholar
5. Martiniano SL, Sontag MK, Daley CL, Nick JA, Sagel SD. Clinical significance of a first positive nontuberculous mycobacteria culture in cystic fibrosis. Annals of the American Thoracic Society. 2014;11: 36–44. pmid:24251858
- View Article
- PubMed/NCBI
- Google Scholar
6. Qvist T, Taylor-Robinson D, Waldmann E, Olesen HV, Hansen CR, Mathiesen IH, et al. Comparing the harmful effects of nontuberculous mycobacteria and Gram negative bacteria on lung function in patients with cystic fibrosis. Journal of Cystic Fibrosis. 2016;15: 380–385. pmid:26482717
- View Article
- PubMed/NCBI
- Google Scholar
7. Charles R Esther J, Esserman DA, Gilligan P, Kerr A, Noone PG, Esther CR, et al. Chronic Mycobacterium abscessus infection and lung function decline in cystic fibrosis. Journal of cystic fibrosis: official journal of the European Cystic Fibrosis Society. 2010;9: 117–123. pmid:20071249
- View Article
- PubMed/NCBI
- Google Scholar
8. Tissot A, Thomas MF, Corris PA, Brodlie M. NonTuberculous Mycobacteria infection and lung transplantation in cystic fibrosis: a worldwide survey of clinical practice. BMC pulmonary medicine. 2018;18. pmid:29788939
- View Article
- PubMed/NCBI
- Google Scholar
9. Catherinot E, Roux AL, Vibet MA, Bellis G, Ravilly S, Lemonnier L, et al. Mycobacterium avium and Mycobacterium abscessus complex target distinct cystic fibrosis patient subpopulations. Journal of Cystic Fibrosis. 2013;12: 74–80. pmid:22857820
- View Article
- PubMed/NCBI
- Google Scholar
10. Daley CL, Iaccarino JM, Lange C, Cambau E, Wallace RJ, Andrejak C, et al. Treatment of nontuberculous mycobacterial pulmonary disease: An official ATS/ERS/ESCMID/IDSA clinical practice guideline. European Respiratory Journal. 2020;56.
- View Article
- Google Scholar
11. Viviani L, Harrison MJ, Zolin A, Haworth CS, Floto RA. Epidemiology of nontuberculous mycobacteria (NTM) amongst individuals with cystic fibrosis (CF). Journal of Cystic Fibrosis. 2016;15: 619–623. pmid:27050794
- View Article
- PubMed/NCBI
- Google Scholar
12. Levy I, Grisaru-Soen G, Lerner-Geva L, Kerem E, Blau H, Bentur L, et al. Multicenter cross-sectional study of nontuberculous mycobacterial infections among cystic fibrosis patients, Israel. Emerging infectious diseases. 2008;14: 378–384. pmid:18325250
- View Article
- PubMed/NCBI
- Google Scholar
13. Coolen N, Morand P, Martin C, Hubert D, Kanaan R, Chapron J, et al. Reduced risk of nontuberculous mycobacteria in cystic fibrosis adults receiving long-term azithromycin. Journal of Cystic Fibrosis. 2015;14: 594–599. pmid:25735458
- View Article
- PubMed/NCBI
- Google Scholar
14. Olivier KN, Weber DJ, Lee JH, Handler A, Tudor G, Molina PL, et al. Nontuberculous mycobacteria. II: nested-cohort study of impact on cystic fibrosis lung disease. American journal of respiratory and critical care medicine. 2003;167: 835–840. pmid:12433669
- View Article
- PubMed/NCBI
- Google Scholar
15. Caverly LJ, Zimbric M, Azar M, Opron K, LiPuma JJ. Cystic fibrosis airway microbiota associated with outcomes of nontuberculous mycobacterial infection. ERJ Open Research. 2021;7: 00578–02020. pmid:33898611
- View Article
- PubMed/NCBI
- Google Scholar
16. Lipner EM, Garcia BJ, Strong M. Network analysis of human genes influencing susceptibility to mycobacterial infections. PLoS ONE. 2016;11. pmid:26751573
- View Article
- PubMed/NCBI
- Google Scholar
17. Cowman SA, Jacob J, Hansell DM, Kelleher P, Wilson R, Cookson WOC, et al. Whole-blood gene expression in pulmonary nontuberculous mycobacterial infection. American Journal of Respiratory Cell and Molecular Biology. 2018;58: 510–518. pmid:29206475
- View Article
- PubMed/NCBI
- Google Scholar
18. Farrell PM, White TB, Ren CL, Hempstead SE, Accurso F, Derichs N, et al. Diagnosis of Cystic Fibrosis: Consensus Guidelines from the Cystic Fibrosis Foundation. Journal of Pediatrics. 2017;181: S4–S15.e1. pmid:28129811
- View Article
- PubMed/NCBI
- Google Scholar
19. Quanjer PH, Stanojevic S, Cole TJ, Baur X, Hall GL, Culver BH, et al. Multi-ethnic reference values for spirometry for the 3–95-yr age range: the global lung function 2012 equations. European Respiratory Journal. 2012;40: 1324–1343. pmid:22743675
- View Article
- PubMed/NCBI
- Google Scholar
20. R Core Team. R: A Language and Environment for Statistical Computing. Vienna, Austria: R Foundation for Statistical Computing; 2022. https://www.R-project.org/
21. Wickham H, Averick M, Bryan J, Chang W, McGowan L, François R, et al. Welcome to the Tidyverse. Journal of Open Source Software. 2019;4: 1686.
- View Article
- Google Scholar
22. RStudio Team. RStudio: Integrated Development Environment for R. Boston, MA: RStudio, PBC.; 2020. http://www.rstudio.com/
23. Kassambara A. ggpubr: “ggplot2” Based Publication Ready Plots. 2020. https://CRAN.R-project.org/package=ggpubr
24. Wickham H. ggplot2: Elegant Graphics for Data Analysis. Springer-Verlag New York; 2016. https://ggplot2.tidyverse.org
25. PreAnalytix. PAXgene^® Blood miRNA Kit Handbook. 2020. https://www.qiagen.com/us/resources/download.aspx?id=fa752f15-2496-4805-ac3a-a1b541135dea&lang=en
26. Andrews S, Krueger F, Segonds-Pichon A, Biggins L, Krueger C, Wingett S. FastQC. A Quality Control Tool for High Throughput Sequence Data [Online]. Babraham, UK; 2012.
27. Frankish A, Diekhans M, Ferreira AM, Johnson R, Jungreis I, Loveland J, et al. GENCODE reference annotation for the human and mouse genomes. Nucleic acids research. 2019;47: D766–D773. pmid:30357393
- View Article
- PubMed/NCBI
- Google Scholar
28. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29: 15–21. pmid:23104886
- View Article
- PubMed/NCBI
- Google Scholar
29. Li B, Dewey CN. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC bioinformatics. 2011;12. pmid:21816040
- View Article
- PubMed/NCBI
- Google Scholar
30. Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016;32: 3047–3048. pmid:27312411
- View Article
- PubMed/NCBI
- Google Scholar
31. Picard toolkit. Broad Institute, GitHub repository. Broad Institute; 2019. https://broadinstitute.github.io/picard/
32. Soneson C, Love MI, Robinson MD. Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences. F1000Research. 2015;4: 1521. pmid:26925227
- View Article
- PubMed/NCBI
- Google Scholar
33. Huber W, Carey VJ, Gentleman R, Anders S, Carlson M, Carvalho BS, et al. Orchestrating high-throughput genomic analysis with Bioconductor. Nature Methods. 2015;12: 115–121. pmid:25633503
- View Article
- PubMed/NCBI
- Google Scholar
34. Rainer J, Gatto L, Weichenberger CX. ensembldb: an R package to create and use Ensembl-based annotation resources. Bioinformatics. 2019. pmid:30689724
- View Article
- PubMed/NCBI
- Google Scholar
35. Zhang Y, Parmigiani G, Johnson WE. ComBat-seq: batch effect adjustment for RNA-seq count data. NAR Genomics and Bioinformatics. 2020;2. pmid:33015620
- View Article
- PubMed/NCBI
- Google Scholar
36. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 2014;15: 1–21. pmid:25516281
- View Article
- PubMed/NCBI
- Google Scholar
37. Korotkevich G, Sukhov V, Sergushichev A. Fast gene set enrichment analysis. bioRxiv. 2019.
- View Article
- Google Scholar
38. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proceedings of the National Academy of Sciences. 2005;102: 15545–15550. pmid:16199517
- View Article
- PubMed/NCBI
- Google Scholar
39. Liberzon A, Birger C, Thorvaldsdóttir H, Ghandi M, Mesirov JP, Tamayo P. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell systems. 2015;1: 417. pmid:26771021
- View Article
- PubMed/NCBI
- Google Scholar
40. Liberzon A, Subramanian A, Pinchback R, Thorvaldsdóttir H, Tamayo P, Mesirov JP. Molecular signatures database (MSigDB) 3.0. Bioinformatics. 2011;27: 1739–1740. pmid:21546393
- View Article
- PubMed/NCBI
- Google Scholar
41. Newman AM, Steen CB, Liu CL, Gentles AJ, Chaudhuri AA, Scherer F, et al. Determining cell type abundance and expression from bulk tissues with digital cytometry. Nature Biotechnology. 2019;37: 773–782. pmid:31061481
- View Article
- PubMed/NCBI
- Google Scholar
42. Brazma A, Ball C, Bumgarner R, Furlanello C, Miller M, Quackenbush J, et al. MINSEQE: Minimum Information about a high-throughput Nucleotide SeQuencing Experiment—a proposal for standards in functional genomic data reporting. 2012 [cited 31 Oct 2022].
43. Zapala MA, Schork NJ. Multivariate regression analysis of distance matrices for testing associations between gene expression patterns and related variables. Proc Natl Acad Sci U S A. 2006;103: 19430–19435. pmid:17146048
- View Article
- PubMed/NCBI
- Google Scholar
44. Gannon AD, Darch SE. Same game, different players: Emerging pathogens of the CF lung. mBio. 2021;12: 1–13. pmid:33436426
- View Article
- PubMed/NCBI
- Google Scholar
45. Bernut A, Dupont C, Ogryzko NV, Neyret A, Herrmann JL, Floto RA, et al. CFTR Protects against Mycobacterium abscessus Infection by Fine-Tuning Host Oxidative Defenses. Cell reports. 2019;26: 1828–1840.e4. pmid:30759393
- View Article
- PubMed/NCBI
- Google Scholar
46. Hayes Don Jr, Shukla RK, Cheng Y, Gecili E, Merling MR, Szczesniak RD, et al. Tissue-localized immune responses in people with cystic fibrosis and respiratory nontuberculous mycobacteria infection. JCI Insight. 2022. pmid:35536650
- View Article
- PubMed/NCBI
- Google Scholar
47. Ricotta EE, Prevots DR, Olivier KN. CFTR modulator use and risk of nontuberculous mycobacteria positivity in cystic fibrosis, 2011–2018. ERJ Open Research. 2022;8. pmid:35415188
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Sanders DB, Fink AK. Background and Epidemiology. Pediatric Clinics of North America. 2016;63: 567–584. pmid:27469176
View Article
PubMed/NCBI
Google Scholar

[2] View Article

[3] PubMed/NCBI

[4] Google Scholar

[ref2] 2. O’Sullivan BP, Freedman SD. Cystic fibrosis. The Lancet. 2009;373: 1891–1904.
View Article
Google Scholar

[6] View Article

[7] Google Scholar

[ref3] 3. Foundation CF. Cystic Fibrosis Foundation Patient Registry 2019 Annual Data Report. Cystic Fibrosis Foundation; 2020.

[ref4] 4. Floto RA, Olivier KN, Saiman L, Daley CL, Herrmann JL, Nick JA, et al. US Cystic Fibrosis Foundation and European Cystic Fibrosis Society consensus recommendations for the management of non-tuberculous mycobacteria in individuals with cystic fibrosis. Thorax. 2016;71: i1–i22. pmid:26666259
View Article
PubMed/NCBI
Google Scholar

[10] View Article

[11] PubMed/NCBI

[12] Google Scholar

[ref5] 5. Martiniano SL, Sontag MK, Daley CL, Nick JA, Sagel SD. Clinical significance of a first positive nontuberculous mycobacteria culture in cystic fibrosis. Annals of the American Thoracic Society. 2014;11: 36–44. pmid:24251858
View Article
PubMed/NCBI
Google Scholar

[14] View Article

[15] PubMed/NCBI

[16] Google Scholar

[ref6] 6. Qvist T, Taylor-Robinson D, Waldmann E, Olesen HV, Hansen CR, Mathiesen IH, et al. Comparing the harmful effects of nontuberculous mycobacteria and Gram negative bacteria on lung function in patients with cystic fibrosis. Journal of Cystic Fibrosis. 2016;15: 380–385. pmid:26482717
View Article
PubMed/NCBI
Google Scholar

[18] View Article

[19] PubMed/NCBI

[20] Google Scholar

[ref7] 7. Charles R Esther J, Esserman DA, Gilligan P, Kerr A, Noone PG, Esther CR, et al. Chronic Mycobacterium abscessus infection and lung function decline in cystic fibrosis. Journal of cystic fibrosis: official journal of the European Cystic Fibrosis Society. 2010;9: 117–123. pmid:20071249
View Article
PubMed/NCBI
Google Scholar

[22] View Article

[23] PubMed/NCBI

[24] Google Scholar

[ref8] 8. Tissot A, Thomas MF, Corris PA, Brodlie M. NonTuberculous Mycobacteria infection and lung transplantation in cystic fibrosis: a worldwide survey of clinical practice. BMC pulmonary medicine. 2018;18. pmid:29788939
View Article
PubMed/NCBI
Google Scholar

[26] View Article

[27] PubMed/NCBI

[28] Google Scholar

[ref9] 9. Catherinot E, Roux AL, Vibet MA, Bellis G, Ravilly S, Lemonnier L, et al. Mycobacterium avium and Mycobacterium abscessus complex target distinct cystic fibrosis patient subpopulations. Journal of Cystic Fibrosis. 2013;12: 74–80. pmid:22857820
View Article
PubMed/NCBI
Google Scholar

[30] View Article

[31] PubMed/NCBI

[32] Google Scholar

[ref10] 10. Daley CL, Iaccarino JM, Lange C, Cambau E, Wallace RJ, Andrejak C, et al. Treatment of nontuberculous mycobacterial pulmonary disease: An official ATS/ERS/ESCMID/IDSA clinical practice guideline. European Respiratory Journal. 2020;56.
View Article
Google Scholar

[34] View Article

[35] Google Scholar

[ref11] 11. Viviani L, Harrison MJ, Zolin A, Haworth CS, Floto RA. Epidemiology of nontuberculous mycobacteria (NTM) amongst individuals with cystic fibrosis (CF). Journal of Cystic Fibrosis. 2016;15: 619–623. pmid:27050794
View Article
PubMed/NCBI
Google Scholar

[37] View Article

[38] PubMed/NCBI

[39] Google Scholar

[ref12] 12. Levy I, Grisaru-Soen G, Lerner-Geva L, Kerem E, Blau H, Bentur L, et al. Multicenter cross-sectional study of nontuberculous mycobacterial infections among cystic fibrosis patients, Israel. Emerging infectious diseases. 2008;14: 378–384. pmid:18325250
View Article
PubMed/NCBI
Google Scholar

[41] View Article

[42] PubMed/NCBI

[43] Google Scholar

[ref13] 13. Coolen N, Morand P, Martin C, Hubert D, Kanaan R, Chapron J, et al. Reduced risk of nontuberculous mycobacteria in cystic fibrosis adults receiving long-term azithromycin. Journal of Cystic Fibrosis. 2015;14: 594–599. pmid:25735458
View Article
PubMed/NCBI
Google Scholar

[45] View Article

[46] PubMed/NCBI

[47] Google Scholar

[ref14] 14. Olivier KN, Weber DJ, Lee JH, Handler A, Tudor G, Molina PL, et al. Nontuberculous mycobacteria. II: nested-cohort study of impact on cystic fibrosis lung disease. American journal of respiratory and critical care medicine. 2003;167: 835–840. pmid:12433669
View Article
PubMed/NCBI
Google Scholar

[49] View Article

[50] PubMed/NCBI

[51] Google Scholar

[ref15] 15. Caverly LJ, Zimbric M, Azar M, Opron K, LiPuma JJ. Cystic fibrosis airway microbiota associated with outcomes of nontuberculous mycobacterial infection. ERJ Open Research. 2021;7: 00578–02020. pmid:33898611
View Article
PubMed/NCBI
Google Scholar

[53] View Article

[54] PubMed/NCBI

[55] Google Scholar

[ref16] 16. Lipner EM, Garcia BJ, Strong M. Network analysis of human genes influencing susceptibility to mycobacterial infections. PLoS ONE. 2016;11. pmid:26751573
View Article
PubMed/NCBI
Google Scholar

[57] View Article

[58] PubMed/NCBI

[59] Google Scholar

[ref17] 17. Cowman SA, Jacob J, Hansell DM, Kelleher P, Wilson R, Cookson WOC, et al. Whole-blood gene expression in pulmonary nontuberculous mycobacterial infection. American Journal of Respiratory Cell and Molecular Biology. 2018;58: 510–518. pmid:29206475
View Article
PubMed/NCBI
Google Scholar

[61] View Article

[62] PubMed/NCBI

[63] Google Scholar

[ref18] 18. Farrell PM, White TB, Ren CL, Hempstead SE, Accurso F, Derichs N, et al. Diagnosis of Cystic Fibrosis: Consensus Guidelines from the Cystic Fibrosis Foundation. Journal of Pediatrics. 2017;181: S4–S15.e1. pmid:28129811
View Article
PubMed/NCBI
Google Scholar

[65] View Article

[66] PubMed/NCBI

[67] Google Scholar

[ref19] 19. Quanjer PH, Stanojevic S, Cole TJ, Baur X, Hall GL, Culver BH, et al. Multi-ethnic reference values for spirometry for the 3–95-yr age range: the global lung function 2012 equations. European Respiratory Journal. 2012;40: 1324–1343. pmid:22743675
View Article
PubMed/NCBI
Google Scholar

[69] View Article

[70] PubMed/NCBI

[71] Google Scholar

[ref20] 20. R Core Team. R: A Language and Environment for Statistical Computing. Vienna, Austria: R Foundation for Statistical Computing; 2022. https://www.R-project.org/

[ref21] 21. Wickham H, Averick M, Bryan J, Chang W, McGowan L, François R, et al. Welcome to the Tidyverse. Journal of Open Source Software. 2019;4: 1686.
View Article
Google Scholar

[74] View Article

[75] Google Scholar

[ref22] 22. RStudio Team. RStudio: Integrated Development Environment for R. Boston, MA: RStudio, PBC.; 2020. http://www.rstudio.com/

[ref23] 23. Kassambara A. ggpubr: “ggplot2” Based Publication Ready Plots. 2020. https://CRAN.R-project.org/package=ggpubr

[ref24] 24. Wickham H. ggplot2: Elegant Graphics for Data Analysis. Springer-Verlag New York; 2016. https://ggplot2.tidyverse.org

[ref25] 25. PreAnalytix. PAXgene^® Blood miRNA Kit Handbook. 2020. https://www.qiagen.com/us/resources/download.aspx?id=fa752f15-2496-4805-ac3a-a1b541135dea&lang=en

[ref26] 26. Andrews S, Krueger F, Segonds-Pichon A, Biggins L, Krueger C, Wingett S. FastQC. A Quality Control Tool for High Throughput Sequence Data [Online]. Babraham, UK; 2012.

[ref27] 27. Frankish A, Diekhans M, Ferreira AM, Johnson R, Jungreis I, Loveland J, et al. GENCODE reference annotation for the human and mouse genomes. Nucleic acids research. 2019;47: D766–D773. pmid:30357393
View Article
PubMed/NCBI
Google Scholar

[82] View Article

[83] PubMed/NCBI

[84] Google Scholar

[ref28] 28. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29: 15–21. pmid:23104886
View Article
PubMed/NCBI
Google Scholar

[86] View Article

[87] PubMed/NCBI

[88] Google Scholar

[ref29] 29. Li B, Dewey CN. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC bioinformatics. 2011;12. pmid:21816040
View Article
PubMed/NCBI
Google Scholar

[90] View Article

[91] PubMed/NCBI

[92] Google Scholar

[ref30] 30. Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016;32: 3047–3048. pmid:27312411
View Article
PubMed/NCBI
Google Scholar

[94] View Article

[95] PubMed/NCBI

[96] Google Scholar

[ref31] 31. Picard toolkit. Broad Institute, GitHub repository. Broad Institute; 2019. https://broadinstitute.github.io/picard/

[ref32] 32. Soneson C, Love MI, Robinson MD. Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences. F1000Research. 2015;4: 1521. pmid:26925227
View Article
PubMed/NCBI
Google Scholar

[99] View Article

[100] PubMed/NCBI

[101] Google Scholar

[ref33] 33. Huber W, Carey VJ, Gentleman R, Anders S, Carlson M, Carvalho BS, et al. Orchestrating high-throughput genomic analysis with Bioconductor. Nature Methods. 2015;12: 115–121. pmid:25633503
View Article
PubMed/NCBI
Google Scholar

[103] View Article

[104] PubMed/NCBI

[105] Google Scholar

[ref34] 34. Rainer J, Gatto L, Weichenberger CX. ensembldb: an R package to create and use Ensembl-based annotation resources. Bioinformatics. 2019. pmid:30689724
View Article
PubMed/NCBI
Google Scholar

[107] View Article

[108] PubMed/NCBI

[109] Google Scholar

[ref35] 35. Zhang Y, Parmigiani G, Johnson WE. ComBat-seq: batch effect adjustment for RNA-seq count data. NAR Genomics and Bioinformatics. 2020;2. pmid:33015620
View Article
PubMed/NCBI
Google Scholar

[111] View Article

[112] PubMed/NCBI

[113] Google Scholar

[ref36] 36. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 2014;15: 1–21. pmid:25516281
View Article
PubMed/NCBI
Google Scholar

[115] View Article

[116] PubMed/NCBI

[117] Google Scholar

[ref37] 37. Korotkevich G, Sukhov V, Sergushichev A. Fast gene set enrichment analysis. bioRxiv. 2019.
View Article
Google Scholar

[119] View Article

[120] Google Scholar

[ref38] 38. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proceedings of the National Academy of Sciences. 2005;102: 15545–15550. pmid:16199517
View Article
PubMed/NCBI
Google Scholar

[122] View Article

[123] PubMed/NCBI

[124] Google Scholar

[ref39] 39. Liberzon A, Birger C, Thorvaldsdóttir H, Ghandi M, Mesirov JP, Tamayo P. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell systems. 2015;1: 417. pmid:26771021
View Article
PubMed/NCBI
Google Scholar

[126] View Article

[127] PubMed/NCBI

[128] Google Scholar

[ref40] 40. Liberzon A, Subramanian A, Pinchback R, Thorvaldsdóttir H, Tamayo P, Mesirov JP. Molecular signatures database (MSigDB) 3.0. Bioinformatics. 2011;27: 1739–1740. pmid:21546393
View Article
PubMed/NCBI
Google Scholar

[130] View Article

[131] PubMed/NCBI

[132] Google Scholar

[ref41] 41. Newman AM, Steen CB, Liu CL, Gentles AJ, Chaudhuri AA, Scherer F, et al. Determining cell type abundance and expression from bulk tissues with digital cytometry. Nature Biotechnology. 2019;37: 773–782. pmid:31061481
View Article
PubMed/NCBI
Google Scholar

[134] View Article

[135] PubMed/NCBI

[136] Google Scholar

[ref42] 42. Brazma A, Ball C, Bumgarner R, Furlanello C, Miller M, Quackenbush J, et al. MINSEQE: Minimum Information about a high-throughput Nucleotide SeQuencing Experiment—a proposal for standards in functional genomic data reporting. 2012 [cited 31 Oct 2022].

[ref43] 43. Zapala MA, Schork NJ. Multivariate regression analysis of distance matrices for testing associations between gene expression patterns and related variables. Proc Natl Acad Sci U S A. 2006;103: 19430–19435. pmid:17146048
View Article
PubMed/NCBI
Google Scholar

[139] View Article

[140] PubMed/NCBI

[141] Google Scholar

[ref44] 44. Gannon AD, Darch SE. Same game, different players: Emerging pathogens of the CF lung. mBio. 2021;12: 1–13. pmid:33436426
View Article
PubMed/NCBI
Google Scholar

[143] View Article

[144] PubMed/NCBI

[145] Google Scholar

[ref45] 45. Bernut A, Dupont C, Ogryzko NV, Neyret A, Herrmann JL, Floto RA, et al. CFTR Protects against Mycobacterium abscessus Infection by Fine-Tuning Host Oxidative Defenses. Cell reports. 2019;26: 1828–1840.e4. pmid:30759393
View Article
PubMed/NCBI
Google Scholar

[147] View Article

[148] PubMed/NCBI

[149] Google Scholar

[ref46] 46. Hayes Don Jr, Shukla RK, Cheng Y, Gecili E, Merling MR, Szczesniak RD, et al. Tissue-localized immune responses in people with cystic fibrosis and respiratory nontuberculous mycobacteria infection. JCI Insight. 2022. pmid:35536650
View Article
PubMed/NCBI
Google Scholar

[151] View Article

[152] PubMed/NCBI

[153] Google Scholar

[ref47] 47. Ricotta EE, Prevots DR, Olivier KN. CFTR modulator use and risk of nontuberculous mycobacteria positivity in cystic fibrosis, 2011–2018. ERJ Open Research. 2022;8. pmid:35415188
View Article
PubMed/NCBI
Google Scholar

[155] View Article

[156] PubMed/NCBI

[157] Google Scholar

Figures

Abstract

Background

Methods

Results

Conclusion

Introduction

Methods

Study population and clinical data

Clinical and demographic data analysis

RNA extraction and RNA sequencing experiments

RNA-seq data analysis

Results

Study cohort selection

Clinical and demographic characteristics of the cohort.

Quality assessment of RNA-seq data

Evaluation of whole blood gene expression of candidate genes of NTM-PD in CF

Whole blood gene expression of individuals who developed NTM-PD in our CF cohort

Discussion

Supporting information

S1 Table. Demographic and clinical characteristics of patients infected with MAC or MABs at the time of first positive NTM culture.

S2 Table. Gene set enrichment analysis of whole blood gene expression in those who did vs. did not develop NTM-PD, excluding 6 samples taken after diagnosis of NTM-PD.

S1 Fig. Absolute whole blood cell population counts in samples used for RNAseq.

S2 Fig. Assignment of reads to genomic regions produced by Picard tools.

S3 Fig. Principal component analysis of normalized and batch corrected count data.

S4 Fig. CibersortX deconvolution of cell percentages compared to ground truth reference values in CBC.

S5 Fig. Mean expression values per NTM-PD group in top differentially expressed genes in Cowman analysis.

Acknowledgments

References