Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Elf3 deficiency during zebrafish development alters extracellular matrix organization and disrupts tissue morphogenesis

  • Swapnalee Sarmah ,

    Roles Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Writing – original draft, Writing – review & editing

    jmarrs@iu.edu (JAM); ssarmah@iu.edu (SS)

    Affiliation Department of Biology, Indiana University-Purdue University Indianapolis, Indianapolis, IN, United States of America

    ⨯
  • Matthew R. Hawkins,

    Roles Formal analysis, Investigation, Methodology

    Affiliation Department of Biology, Indiana University-Purdue University Indianapolis, Indianapolis, IN, United States of America

    ⨯
  • Priyadharshini Manikandan,

    Roles Formal analysis, Investigation

    Affiliation Department of Biology, Indiana University-Purdue University Indianapolis, Indianapolis, IN, United States of America

    ⨯
  • Mark Farrell,

    Roles Formal analysis, Investigation, Methodology

    Affiliation Department of Biology, Indiana University-Purdue University Indianapolis, Indianapolis, IN, United States of America

    ⨯
  • James A. Marrs

    Roles Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Project administration, Supervision, Writing – original draft, Writing – review & editing

    jmarrs@iu.edu (JAM); ssarmah@iu.edu (SS)

    Affiliation Department of Biology, Indiana University-Purdue University Indianapolis, Indianapolis, IN, United States of America

    ⨯

Abstract

E26 transformation specific (ETS) family transcription factors are expressed during embryogenesis and are involved in various cellular processes such as proliferation, migration, differentiation, angiogenesis, apoptosis, and survival of cellular lineages to ensure appropriate development. Dysregulated expression of many of the ETS family members is detected in different cancers. The human ELF3, a member of the ETS family of transcription factors, plays a role in the induction and progression of human cancers is well studied. However, little is known about the role of ELF3 in early development. Here, the zebrafish elf3 was cloned, and its expression was analyzed during zebrafish development. Zebrafish elf3 is maternally deposited. At different developmental stages, elf3 expression was detected in different tissue, mainly neural tissues, endoderm-derived tissues, cartilage, heart, pronephric duct, blood vessels, and notochord. The expression levels were high at the tissue boundaries. Elf3 loss-of-function consequences were examined by using translation blocking antisense morpholino oligonucleotides, and effects were validated using CRISPR/Cas9 knockdown. Elf3-knockdown produced short and bent larvae with notochord, craniofacial cartilage, and fin defects. The extracellular matrix (ECM) in the fin and notochord was disorganized. Neural defects were also observed. Optic nerve fasciculation (bundling) and arborization in the optic tectum were defective in Elf3-morphants, and fragmentation of spinal motor neurons were evident. Dysregulation of genes encoding ECM proteins and matrix metalloprotease (MMP) and disorganization of ECM may play a role in the observed defects in Elf3 morphants. We conclude that zebrafish Elf3 is required for epidermal, mesenchymal, and neural tissue development.

Citation: Sarmah S, Hawkins MR, Manikandan P, Farrell M, Marrs JA (2022) Elf3 deficiency during zebrafish development alters extracellular matrix organization and disrupts tissue morphogenesis. PLoS ONE 17(11): e0276255. https://doi.org/10.1371/journal.pone.0276255

Editor: Eric A. Shelden, Washington State University, UNITED STATES

Received: May 16, 2022; Accepted: October 3, 2022; Published: November 16, 2022

Copyright: © 2022 Sarmah et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: Data are available from Genbank (accession number OP605767).

Funding: JAM and SS 1 R21 AA026711 National Institutes of Health/National Institute for Alcoholism and Alcohol Abuse https://www.niaaa.nih.gov/ The funders DID NOT play any role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Elf3 (also called E74 like ETS transcription factor 3, E74-like factor 3, ESX, ERT, ESE-1, EPR-1, JEN) is a member of the E26 transformation specific (ETS) family of transcription factors. ETS transcription factors share a highly conserved DNA binding domain, the ETS domain that possesses 85 to 90 amino acids rich in positively charged and aromatic residues. The ETS domain, which is localized at the C terminus of Elf3, forms three α -helixes and four-stranded β-sheets [1]. The α3 helix of the ETS domain interacts with the major groove of DNA; The 10 bp consensus sequence invariably contains the core motif GGA [2]. In addition to a functionally conserved ETS domain, Elf3 contains other regions required for its function: a SAM/pointed domain and a A/T Hook domain. The pointed domain is present within a subset of the ETS family and is involved in sequence specific DNA binding [3, 4]. A/T Hook domain binds to “AT” rich regions of DNA [5–7].

ELF3 has been reported to play significant roles in the development and progression of human cancers [2, 8–11]. ELF3 is implicated in breast cancer, thyroid cancer, colorectal cancer, lung cancers, oral cancer, pancreatic cancer, ovarian cancer, urothelial bladder carcinoma, prostate cancer, and synovial sarcomas [12–22]. A growing body of research shows that ELF3 can exhibit both tumor suppressor [16, 18, 23] and oncogenic functions in cancers [12, 14, 15, 22], a property seen in many transcription factors with dual biological function (both transcription activation and repression) [21, 24]. Deleterious loss of function mutations of ELF3 were documented and described as tumorigenic in many epithelial tumors [16, 18, 23, 24]. Conversely, ELF3 overexpression was also reported in other cancers including lung adenocarcinoma [12, 13, 15, 19, 24]. There is also evidence that ELF3 positively regulates TGF-βRII, which can inhibit tumorigenesis [11, 25, 26].

In addition to its role in oncogenesis, ELF3 regulates inflammation. ELF3 expression was reportedly restricted to epithelial tissues in normal conditions [5, 25, 27]. However, under inflammatory conditions, ELF3 becomes activated in various tissues and cell types [28–34]. Treatment with pro-inflammatory cytokines, interleukin-1β (IL-1β), and tumor necrosis factor-α (TNF-α) upregulated ELF3 expression in human bronchial airway epithelial cell lines [28–34]. Additionally, ELF3 expression was directly linked to increased expression of interleukin-6 (IL-6) in lung and serum of mice after induced pulmonary inflammation [26, 32]. The level of ELF3 protein was increased in osteoarthritic cartilages [35]. ELF3 acts as a regulator of cartilage catabolism and anabolism by acting as a transactivator for MMP13 transcription and as a repressor for collagen-2α1 (COL2α1) transcription in chondrocytes [35, 36].

ETS family transcription factors are involved in proliferation, migration, differentiation, angiogenesis, apoptosis and survival of cellular lineages during embryonic development [8, 37, 38]. However, little is known about the role of ELF3 in early embryo development. ELF3 regulates HLA-C expression on human placental extravillous trophoblast, which is involved in infection control and other complications in pregnancy [39]. In mice, Elf3 expression increases after fertilization and remains high until the blastocyst stage [9]. Elf3 knockout (Elf3-/-) caused lethality of about 30% of mice in utero. Elf3-deficent pups looked malnourished, lethargic, and had watery diarrhea [32, 40]. Those mice had defective small intestine: poorly developed villi, microvilli and abnormal morphogenesis and differentiation of enterocytes and mucus-secreting goblet cells [40]. ELF3 is involved in terminal differentiation of skin epidermis, epithelia of the cornea, keratinocyte and dendritic cell driven T cell differentiation in human [5, 32, 41–43]. Mouse mammary gland development and involution require Elf3 [32, 44]. Elf3 expression is also high in the retinal pigment epithelium (RPE) in mice [45]. These findings indicate that ELF3 is participates in various normal biological processes and disease conditions. However, its role in early development is poorly understood.

Here we report the distribution and loss-of-function consequences of Elf3 during zebrafish development. Morpholino oligonucleotide (MO) mediated Elf3-knockdown in embryos produced short and bent body, distorted fins, which show cartilage defects. Neural defects were seen in spinal motor neurons, brain and the visual system. Dysregulation and disorganization of extracellular matrix (ECM) components were observed. Our result show that Elf3 is required for epidermal, mesenchymal, and nervous tissue development, which may, in part, be due to defective ECM remodeling during embryogenesis.

Materials and methods

Zebrafish husbandry

Zebrafish (Danio rerio) AB strain was raised and maintained under standard laboratory conditions following Indiana University Policy on Animal Care and Use. IUPUI School of Science Institutional Animal Care and Use Committee approved the use of zebrafish adults for breeding, embryo collection and embryo experiments.

Morpholino oligonucleotides and CRISPR/Cas9 gene targeting

Translation blocking antisense MOs (Gene Tools, Plymouth OR) were designed to target the elf3 5′UTR (elf3-UTR-MO: 5’ TGTGGTGGTCAAAGATTGTTTTCCA 3’) or the elf3 translation start site (elf3-ATG-MO: 5’ TTAGACTAAGTTCGCTTGACGCCAT 3’). elf3-UTR-MO targets -36 to -12 nucleotides upstream of the start codon and elf3-ATG-MO targets 25 nucleotides of elf3 coding sequence. The ENSEMBL transcript ENSDART00000113795.4/ elf3-201 (NCBI Reference Sequence: XM_002666100.3) was used to design the morpholino. A morpholino designed against human β globin pre-mRNA that targets the bases to correct a splice-generating mutation at position 705 was used as a standard control. It was shown that this morpholino has no target and no significant biological activity in zebrafish (Gene Tools). Independent control experiments were also performed using two independent guide RNAs to produce CRISPR/Cas9 knockdowns (S2 Fig in S1 File). To determine the optimum amount of each MO, 1–3 nL MO at different concentrations (0.01 μM–0.5 mM) were injected into 1–2 cell stage embryos. Concentration that consistently produced the phenotype without causing significant death of the embryos was used as the working MO concentration, which is 1 nL of 0.1 mM for each MO. Reproducibility and effectiveness were tested for each MO, showing that repeated experiments produced a consistent phenotype (both elf3 MOs produced phenotypes shown here at similar amounts injected and at similar percentages, which could be reproduced in repeated experiments). Quantitative phenotype analysis is presented in Fig 2D (see below). In addition, CRISPR/Cas9 reagents (gRNA1: 5’ TGAACTACTGCACCATGGAT 3’; gRNA2: 5’ GAATCTGAACTACTGCACCA 3’) targeting elf3 were injected into embryos (see supplementary materials and methods in S1 File), producing some embryos that showed similar phenotypes to the elf3 MO injected embryos (bent body, small eye, small head, craniofacial defects). These elf3 CRISPR targeted embryos showed evidence of insertions or deletions in elf3 sequences after PCR amplification and sequencing their genomic DNA (see supplementary materials and methods in S1 File).

Cloning of full length elf3 cDNA

Total RNA was extracted from about twenty 2 days post fertilization (dpf) embryos using TRIzol, and cDNA was synthesized using 1 μg of total RNA, oligo(dT) primer and M-MLV reverse transcriptase (Promega). We amplified the open reading frame of elf3 using 2 μL of cDNA, elf3-F: ATGGCGTCAAGCGAACTTAGTC and elf3-R: TTAATAACCGGTCTCCTCTATCC primers, Taq DNA polymerase with Thermopol Buffer (NEB). Gel electrophoresis showed the specific amplified product of the expected size (~1.1 kb), which was purified using Qiagen PCR purification kit. We cloned this cDNA into the pCBA3 expression vector, producing the plasmid pCBA3-zf-elf3. The cDNA was sequenced, which was submitted to the GenBank Database (OP605767).

To examine elf3 expression during embryogenesis, total RNA was extracted from 4.5, 8, 20, and 24 hours postfertilization (hpf) embryos, and cDNA synthesis and PCR were done following the same procedures as described above.

In situ hybridization and paraffin section

The plasmid pCBA3-zf-elf3 was cut using Acc1 restriction enzyme and the elf3 coding sequence 500 to 1128 bases were used to make the probe. A BLAST search ensured that there were no similarities between these elf3 nucleotides and other zebrafish mRNA sequences. Digoxigenin labeled antisense probe was made using DIG RNA labeling kit and T7 RNA polymerase, and sense probe was used as a negative control, showing no staining. Whole-mount in situ hybridization of zebrafish embryos were performed as previously described [46]. Images were collected using a Leica MZ12 stereomicroscope.

In situ hybridization stained larvae were embedded in 1.5% agarose in 5% sucrose, and stored in 30% sucrose solution at 4°C overnight. Agarose embedded larvae were mounted with O.C.T. (Sakura Finetechnical Co.). Ten micrometer sections were cut using a Leica CM 3050 cryostat at −20°C and transferred onto Superfrost slides (Fisher). Images were acquired using a Zeiss Observer Z1 microscope (10X o.3 NA objective).

Alcian blue staining

Alcian Blue staining was done as previously described [47]. Briefly, embryos from two independent experiments (~20 larvae per experimental condition per experiment) at 5 dpf were fixed in 4% phosphate-buffered paraformaldehyde (PFA), bleached in 10% H2O2 and 1 M KOH, and stained overnight in 0.1% Alcian Blue solution.

Quantitative PCR analysis

Total RNA was extracted from 2 dpf embryos (~ 20 embryos) using the TRIzol (Sigma). One microgram of total RNA was reverse transcribed to cDNA using M-MLV reverse transcriptase (Promega) and oligo (dT) primer. The cDNA was diluted tenfold with RNase free water. Each target was amplified using 4 μL of cDNA, Power SYBR Green PCR mix (Applied Biosystems) and 0.5 μM of each primer. Ribosomal RNA rsp15 was used as internal control. Primers used to quantify the expression of mmp9, mmp13, mmp2, col2a1, Fn1, rsp15 genes and amplicon sizes are listed in S1 Table in S1 File. These primer sets were shown to produce a single product. Each reaction was performed in triplicate, and at least three independent mRNA samples for both conditions (control and morphant) were used for the experiment. Fold changes in gene expression were calculated using the comparative CT method (ΔΔCT) as previously described [48].

Immunohistochemistry

For whole-mount immunostaining, embryos were fixed in 4% PFA at 4°C overnight. Embryos were placed in blocking solution (PBS containing 0.5% Triton X-100, 1% DMSO, 5% goat serum, 1% bovine serum albumin, and 4% sodium azide) for 2 hours at room temperature. Primary antibodies against HuC/D (Sigma, 1:1000), acetylated tubulin (Sigma, 1:500), Col2α1 (Developmental Studies Hybridoma Bank 1:100), Fibronectin (Sigma, 1:400) were diluted in blocking solutions and incubated 1 to 2 days. Alexa Fluor 488-conjugated and Alexa Fluor 555-conjugated anti-mouse or anti-rabbit secondary antibodies (Molecular Probes, Grand Island, NY, USA) were used at 1:500 dilution. Nuclear staining was performed using TO-PRO-3 iodide at a 1:1000 dilution incubated for 1 hour at room temperature. Images were acquired using a Zeiss Observer Z1 LSM 700 confocal microscope (40X 1.1 NA W or 20X 0.8 NA objectives). Regions of interest in stained embryos/larvae were imaged with several confocal optical z-sections. Zen Black (Zeiss) software was used to produce maximum intensity image projections of the z-section volumes.

Image analysis

Whole-mount acetylated tubulin immunostaining images of embryos were used to measure motor neuron axon lengths. Using ImageJ (free software from the National Institutes of Health, Bethesda MD), confocal images were calibrated to pixels per micron, and individual motor neurons in the anterior trunk were measured.

Pathway analysis

Ingenuity pathway analysis (IPA) software was used to predict molecular interactions based on the manually curated content from human, mouse and rat publications in the Ingenuity knowledge base. “Experimentally observed or highly predicted” setting was used to predict potential Elf3 interactions with other molecules.

Statistics

Unpaired two-tailed student’s t-test was used for comparisons between uninjected control and morpholino injected groups using GraphPad software (GraphPad Software, La Jolla, CA, USA).

Results

Expression of elf3 during zebrafish embryogenesis

Previous studies in our laboratory showed that elf3 was dysregulated by ethanol exposure during early development [46]. Experiments were performed to determine whether Elf3 controls developmental events that are affected by embryonic ethanol exposure, like craniofacial and brain development [49–52]. To determine the expression of elf3 during zebrafish development, elf3 gene sequences were amplified and cloned and sequenced. Zebrafish Elf3 and the human ELF3 protein share 47.31% identity, and ETS domain of zebrafish Elf3 is highly conserved, sharing 91.76% identity with human ELF3 ETS domain (S1 Fig in S1 File).

To determine the temporal and spatial expression patterns of elf3 during zebrafish development, we analyzed mRNA by performing RT-PCR and in situ hybridization at various developmental stages. RT-PCR detected elf3 transcript at 4.5, 8, 20, and 24 hpf embryos (Fig 1A). In situ hybridization detected elf3 mRNA at 1.5 hpf (16 cell; prior to midblastula transtion) embryos, indicating maternal deposition (Fig 1B). In situ hybridization also showed elf3 mRNA enriched cells at 3 hpf, being uniformly distributed in the blastula stage embryo. During somitogenesis, elf3 mRNA was highly expressed in the forebrain, midbrain, midbrain-hindbrain boundary, and hindbrain, and relatively low levels of expression were detected in the posterior region and in the notochord (Fig 1C–1E). At 24 hpf, high elf3 mRNA expression was detected in the eye primordia, developing liver, pancreas, blood vessels, intersomatic boundaries, and CNS regions (Fig 1F). Whole mount preparations of 2 to 4 dpf larvae showed that the expression elf3 was more enriched in olfactory pit, eye, midbrain, midbrain-hindbrain boundary, craniofacial cartilages, liver, pancreas, gut, pronephros, neural tube, vacuolated cells in notochord, neuromast, pectoral fin, heart, cardinal vein, and caudal fin later during development (Fig 1G–1N). Sections of the 3 dpf stained larvae show elf3 expression in brain regions and, interestingly, very strong expression at the boundaries of brain regions (Fig 1O and 1P) and somite boundaries (Fig 1Q and 1R).

thumbnail
Download:
Fig 1. Expression of elf3 mRNA during zebrafish development.

(A) PCR detects elf3 mRNA during blastula (4.5 hpf), gastrula (8 hpf), and somitogenesis (20 and 24 hpf) stages. (B) In situ hybridization analysis shows elf3 mRNA expression in the 16 cell-stage embryos confirming maternal deposition. (C-D) During cleavage and blastula stages, elf3 mRNA is ubiquitously expressed. (E) During early somitogenesis period, elf3 mRNA is expressed more in the anterior region compared to the posterior region. (D-I) In situ hybridization detecting elf3 expression in 1 to 4 dpf larvae shows mRNA expression in distinct tissues. (J-N) High magnification images of 4 dpf stained larvae show elf3 mRNA expression in gut, pronephric duct (J), eye, cartilage (K), gut, heart (L), liver, pectoral fin (M), and in notochord (N). (O-R) 10 μM cryosections of the stained 3 dpf larvae show elf3 mRNA expression in different brain tissues and higher expressions in the boundaries of those tissues (O, P), in somite boundaries (Q) and in the gut and pronephric duct (R). T: telencephalon; C: cerebellum; OP: olfactory pit; Di: diencephalon; FP: floor plate; H: hindbrain; OT: optic tectum; Teg: tegmentum, Hy: hypothalamus; white asterisk: tissue boundary. Scale bar for B; C; D-E; F-G; H-I; K-M; and O-R = 200 μm.

https://doi.org/10.1371/journal.pone.0276255.g001

Knockdown of Elf3 severely affected zebrafish morphogenesis

To determine the function of Elf3 during development, we perform Elf3 loss-of-function experiments by injecting 1 to 2 cell embryos with antisense morpholino oligonucleotide (elf3-UTR-MO or elf3-ATG-MO) designed to block translation of elf3 mRNA. As a negative control, an equal amount of the morpholino designed against human β globin pre-mRNA was also injected into 1 to 2 cell embryos. Either elf3-UTR-MO or elf3-ATG-MO morpholino injected embryos had no significant effects on epiboly progression. At 8.3 hpf, uninjected control embryos reached 82% epiboly (81.7 ± 4.39%; n = 41); control morpholino injected embryos reached approximately 85% (85.2% ± 4.19; n = 54, standard deviation); and the elf3-ATG-MO morpholino injected embryos reached approximately 76% epiboly (75.9% ± 6.48; n = 68).

At 24 hpf, the elf3 MO injected embryos had mild to severe brain morphogenesis defects, including abnormal midbrain-hindbrain boundary formation. Those embryos displayed delayed optic cup development or smaller optic cup (Fig 2A–2C). Severely defective embryos had dead cells in the forebrain ventricle region (Fig 2C). Control MO injected embryos had no defects (S2A, S2B Fig in S1 File). A positive control experiment was done by CRISPR/Cas9 knockdown using 2 independent guide RNAs targeting elf3. Injection of CRISPR/Cas9 reagents produced similar phenotypes as MO injected larvae (S2C-S2G Fig in S1 File). Sequencing genomic DNA of those larvae showed altered sequences of the targeted region suggesting disruption of Elf3 (S2C”-S2G” Fig in S1 File). Body length was measured at 2 dpf, which showed that the Elf3 morphants were shorter than the control embryos (control embryo:100% ±4.5 (n = 39); elf3-UTR-MO injected embryo: 85.16% ±11.35 (n = 65; p<0.001) (Fig 2D).

thumbnail
Download:
Fig 2. Knockdown of Elf3 severely affected zebrafish development.

(A-C) Live images of uninjected and elf3 morpholino injected embryos show development of the eye cup, telencephalon (t), forebrain ventricle, mesencephalon (m), midbrain-hindbrain boundary (mhb), and fourth ventricle in 1 dpf control (A) and moderately affected (B) and severely affected (C) embryos. Blue asterisk in C: dead cells. (D) First two bar graphs represent the body length percent of the control (black bar) and the morphant (grey bar) embryos (control embryo:100% ±4.5 (n = 39); elf3-UTR-MO injected embryo: 85.16% ±11.35 (n = 65; p<0.001). Other bar graphs represent the percent of the control and the morphant embryos with the labeled phenotype. (E-H) Live images of 2 dpf uninjected and elf3 morpholino injected embryos show normal morphology of the control embryo (E) and short body, bent tail, small eye, pericardial edema, twisted notochord, and aberrant fin-folds of the morphant embryos (F-H). (I-N) Live images show normal median and caudal fin-fold in control (I, L), and irregular or absence of fin-fold (black arrows) and lumps in the fin fold (blue arrows) in morphants at 2 and 5 dpf. (O, P) 3D reconstruction of the confocal images of the E-cadherin antibody stained larvae show regularly-shaped fin edge of the control larvae and jagged fin-edges of the morphants. Scale bar for A-C; E-H; and I-N = 200 μm. Scale bar for O, P = 100 μm.

https://doi.org/10.1371/journal.pone.0276255.g002

The Elf3 morphants were grouped as mild-, moderate- and severe-morphant groups. The mildly affected morphants (~43% of the total morphant embryos) were slightly shorter than the uninjected control but otherwise looked similar to control. The moderately affected morphant embryos (~50%) had a short body with a bent tail, pericardial edema, small eye, distorted notochord, aberrant/almost absent fin-folds, and reduced pigmentation (Fig 2D–2H). Severely affected morphants (~ 7%) had either a very short “pig” tail or almost no tail in addition to the defects described above present in moderately affected morphants (Fig 2G and 2H). Tail and fin fold defects became more severe later in the larval stages. Median and caudal fin fold edges were irregular and the morphant larvae often had cyst or clumps of cells in the fin fold (Fig 2M and 2N). The 5 dpf morphants showed structural alteration of actinotrichia fibers, the brush-shaped collagenous structures in the caudal fin while the control larvae had radial symmetrical arrangement of the actinotrichia fibers (Fig 2L–2N). Some larvae displayed almost collapsed fin folds (Fig 2K–2N). Labeling of fin fold epidermal cells by E-cadherin (Cdh1) antibody and 3D imaging confirmed severely distorted fin folds of the morphants (Fig 2O and 2P).

Anterior regions of the control and morphant larvae were compared. Morphant larvae had smaller heads compared to control. Smaller forebrain was evident in 5 dpf larvae (Fig 3A–3C). The morphants also showed jaw defects at 5 dpf (Fig 3A–3C).

thumbnail
Download:
Fig 3. Elf3 knockdown affected craniofacial development.

(A-C) Live images of 5 dpf Elf3 morphants show protruded jaw (blue arrow) and smaller head (black arrow) and eye (B, C) compared to control (A). (D-L) Alcian blue stained head skeleton of control and morphant larvae. Ventral view shows normal cartilages in control (G) and near-normal Meckel’s (m) and ceratohyal cartilages (ch) and poorly developed branchial cartilages (cb 1–5) in morphants (H, I). Dorsal view shows normal neurocranium in control (J) and smaller ethmoid plate (purple arrow), lack of trabecula (tr and *), parachordal cartilage (pc and green arrow) and auditory cartilage (ac and yellow arrow) in morphants (K, L). (M-N”) Col2α1 and E-cadherin (Cdh1) antibody stained 3 dpf larvae marked developing Meckel’s, Ceratohyal, 1st and 2nd branchial arches, and ethmoid plate in control larvae (M-M”) and a pair of cartilage (presumably Ceratohyal) in the morphant larvae (N-N”). Scale bar for A-C; D-F; and G-L = 200 μm. Scale bar for M-N” = 100 μm.

https://doi.org/10.1371/journal.pone.0276255.g003

Deficiency of Elf3 during development causes malformation of craniofacial cartilages

To examine the craniofacial development in the morphants, Alcian blue staining was performed. Alcian blue-stained 5 dpf Elf3 morphant larvae showed relatively normal Meckel’s and ceratohyal cartilages but ceratobranchial arches (1–5) are either lightly stained or not stained, indicating poorly developed branchial cartilages with less proteoglycans in the extracellular matrix. Neurocranium development was also severely affected in Elf3 morphants, lacking the lateral regions of the ethmoid plate, showing deformed or missing trabecula, parachordal cartilage and auditory cartilage. Compromised craniofacial cartilage development was also observed in CRISPR/Cas9 injected larvae (S2C’-S2G’ Fig in S1 File).

In zebrafish, cranial chondrogenesis begins at 2 dpf when migratory neural crest cells arrive at the destination and aggregates into pre-cartilage condensations. These condensations are associated with increased cell adhesion and formation of gap junctions [53]. Cartilage morphogenesis occur by re-organization of the chondroprogenitors, followed by a growth phase. Growth is robust near the joints between cartilages. Chondroprogenitors matures and differentiate into chondrocytes, which is characterized by the deposition of cartilage matrix containing collagen II, IX, and XI and aggrecan [54].

To examine the developing cartilage and chondrocyte differentiation in Elf3 morphant, 2 and 3 dpf larvae were stained with collagen type II alpha-1a (Col2α1) antibody. Pairs of trabecula cartilages with Col2α1 positive chondrocytes were detected in control embryos at 2 dpf. At 3 dpf, Col2α1 was detected in developing Meckel’s, ceratohyal cartilage, 1st and 2nd branchial arches, and ethmoid plate in control larvae (Fig 3M–3M”, S3A–S3A", S3E-S3E” Fig in S1 File). However, Col2α1 expressing cells were dramatically reduced in Elf3 morphant at 3 dpf. Only a few cartilage cells, in what appeared to be trabecula cartilages, had Col2α1 expression (Fig 3N–3N”, S3B–S3B”, S3F–S3F” Fig in S1 File). Immunostaining using anti-E-cadherin (Cdh1) antibody detected high cadherin expression near the growing ends of cartilages of un-injected control larvae (Fig 3M–3M”, S3C–S3C”, S3E’–S3E” Fig in S1 File). Cadherin expression was also considerably reduced in the developing cartilages of the Elf3 morphant larvae (Fig 3N–3N”, S3D–S3D”, S3F–S3F” Fig in S1 File).

Knockdown of Elf3 disrupts the expression pattern of Col2α1 in the fin folds and notochord

Proper cell-cell and cell-matrix interactions are essential for tissue formation. Epidermal cell shape changes and correct ECM assembly are essential steps in zebrafish median fin fold and caudal fin morphogenesis [55, 56]. These tightly regulated processes lay the foundation for subsequent steps of fin development [55]. Fin ray expansion occurs by the assembly of actinotrichia and lepidotrichia at the basal membrane of epidermal cells [56–58]. Collagens like Col2a1 and Col1a1 are essential for actinotrichia formation [56, 59–61]. Severely deformed actinotrichia of Elf3 morphants prompted us to examine the expression of Col2α1 in the median fin fold and actinotrichia. Col2α1 was distributed along the actinotrichia in control larvae at 2 and 3 dpf, which was arranged as a patterned fibrillar network of collagen that extended towards the edge of the fin (Fig 4A–4C). However, reduced fibrillar network and reduced Col2α1 expression were seen in the caudal fin of Elf3 morphants at 2 dpf (Fig 4B). At 3 dpf, moderately defective larvae had weaker Col2α1 expression in the actinotrichia compared to control, and the Col2α1 fibrils were disorganized (Fig 4C and 4D and insets). Severely defective larvae showed abnormal accumulation of Col2α1 with no fibrillary patterning in the caudal fin. Instead, high levels of poorly organized Col2α1 aggregates were present in the morphant (Fig 4E). Examination of Col2α1 expression in the median fin fold of control and Elf3 morphant revealed the presence of well-organized, thick Col2α1 fibrils in the control larvae. Severe disruption and disorganization of median fin fold collagen fibrils were seen in the Elf3 knockdown larvae (Fig 4F–4Q).

thumbnail
Download:
Fig 4. Elf3 deficiency led to disruption of Col2α1 expression in the fin and notochord.

(A-E) 3D reconstruction of the confocal images of the Col2α1 antibody stained embryos show dense Col2α1 fibrils radially distributed throughout the whole caudal fin in the control (A, C) and less dense, irregularly distributed fibrils in moderately affected morphants (B, D); severely affected morphant showed abnormal accumulation of Col2α1, but no fibrillary pattern (E). Insets show high magnification of the marked rectangle area. yellow arrow: abnormal Col2α1 accumulation within notochord; white arrow: Col2α1 fibrils. (F-Q) Optical section of the confocal images of the Col2α1 antibody stained embryos show severely disrupted and disorganization median fin fold collagen fibrils in the elf3 morphants at 2 dpf (G, H, J, K) and 3 dpf larva (M, N, P, Q) and nicely organized, thick fibrils in the control (F, I, L, O). Scale bar for A, B = 50 μm; for C-E = 100 μm; and for F-Q = 100 μm.

https://doi.org/10.1371/journal.pone.0276255.g004

Elf3 morphants were shorter, bent, and had distorted/wavy notochords. The notochord functions as a hydrostatic skeleton in chordate embryos, rigid support provided by fluid pressure in the notochord vacuoles. Mechanical properties of notochord partially depend on its external fibrous matrix, which exerts the appropriate stiffness essential for lengthening of the embryo and maintenance of a straight axis. The notochord sheath cells produce the notochord fibrous matrix, which consist of Col2α1, other collagens, laminins, and other matrix molecules [62, 63]. The expression of Col2α1 was examined in the control and morphant embryos at 2 and 3 dpf. In the control embryo, Col2α1 was dispersed throughout the notochord in a uniform pattern at 2 dpf (Fig 4A, 4F and 4I). However, morphant embryos had disorganized Col2α1 expression patterns within the notochord. Moderately affected embryos had overall diminished Col2α1expression with fewer unevenly distributed higher Col2α1 expressing areas (Fig 4B, 4G and 4H). Severely affected embryos also had reduced Col2α1 expression in some areas and an accumulation of Col2α1 aggregates in other parts of the notochord (Fig 4B, 4G, 4H, 4J and 4K). The aggregates of Col2α1 were frequently seen in the bent notochord regions (Fig 4H–4K). At 3 dpf, control larvae had bands of high Col2α1 expressing areas in the anterior region of the notochord but not in the posterior region. Low levels of Col2α1 were evenly distributed between the bands and in the entire posterior region of the notochord of 3 dpf control larvae, which resembled the distribution of Col2α1 in 2 dpf embryos (Fig 4L–4O). In contrast, 3 dpf morphant larvae either did not have the segments of high Col2α1 expressing regions, rather showing low levels of collagen throughout the notochord (Fig 4M–4P) or irregularly spaced faint segments with very little or no Col2α1 expression in other parts of the notochord (Fig 4N–4Q). These observations confirmed that elf3 gene function was required for proper ECM organization in the zebrafish fin and notochord, and Elf3 deficiency was associated with disorganization of the matrix.

Elf3 deficiency disrupted optic nerve fasciculation and terminal axonal arborization in the optic tectum

Elf3 morphants exhibited delays in the eye cup formation and had smaller eyes. To examine the visual system of the morphants, acetylated-tubulin antibody labeling was performed that stains axons, including those in the optic nerve and optic tectum. Three-dimensional renderings of the confocal sections of the stained control embryos showed tightly fasciculated optic nerve projections of the retinal ganglion axons from each retina, which crossed at the optic chiasm and subsequently, projected toward the contralateral optic tectum (Fig 5A and 5A’). However, acetylated-tubulin stained optic nerves were smaller, the fibers were loosely packed and diffused in the morphants, indicating fasciculation defects. The defect was apparent near the optic chiasm where the axons defasciculated and spurious projections were clearly visible, indicating defects in midline pathfinding (Fig 5B, 5C, 5B’ and 5C’). Moreover, the optic chiasm in the Elf3 morphants were wider than the control embryos (Fig 5B and 5B’). Severely defective morphants displayed weaker acetylated-tubulin staining in the optic nerve, perhaps due to reduced ganglion cell numbers, but the staining in other nerves in the forebrain were not remarkably different from controls (Fig 5C and 5C’).

thumbnail
Download:
Fig 5. Elf3 deficiency caused optic nerve fasciculation and arborization in the optic tectum defects and fragmentation of spinal motor neurons.

(A-C) Confocal imaging of acetylated tubulin stained embryos and 3D rendering shows tightly fasciculated optic nerves crossing at the optic chiasm in the control embryo (A) and a smaller de-fasciculated nerve in the morphants (B, C). (A’-C’) High magnification of the marked rectangle area in A-C. yellow asterisk show fibers de-fasciculated. (D-F) Confocal imaging of acetylated tubulin stained embryos and 3D rendering shows optic nerves arborized extensively within the tectal neuropil in the control embryo (D), and either fewer or no axon projections within that region in the Elf3 morphants (E, F). yellow perforated lines: presumptive tectal neuropil region; #: no axon projections. (G-I) 3D renderings of the confocal sections of acetylated tubulin stained 2 dpf control embryos showed thick bundles of caudal motor neurons arborized within muscle in control embryo (G, G’) and fragmented, abnormally branched and shorter axons in the morphants (H, H’, I, I’). (G’-I’) High magnification of the marked rectangle area in G-I. Arrow: short axon; #: fragmented axon. Scale bar for A-C, D-F and G-I = 100 μm.

https://doi.org/10.1371/journal.pone.0276255.g005

After crossing the midline, the optic nerves extend to the contralateral optic tectum in zebrafish where the nerve fibers ramified (branching) within the neuropil of the optic tectum, which are normally confined into the neuropil region. Acetylated-tubulin stained control embryos showed extensive arborization of optic nerve axons within the tectal neuropil (Fig 5D). However, Elf3 morphants had either few or no axon projections within that region, indicating that the optic nerves either did not extend into or had retracted from the tectum (Fig 5E and 5F). Axons may overshoot the optic tectum in the morphants (Fig 5E and 5F), suggesting possible axon pathfinding defects. Severely defective morphant embryos had reduced or degenerated axons.

Deficiency of Elf3 changed spinal motor neuron morphology

In acetylated tubulin stained embryos, we noted defects in spinal motor neuron morphology in Elf3 morphants, indicating axonal growth and fasciculation defects. The morphology of neurons examined in 3D renderings of the confocal sections of acetylated tubulin stained 2 dpf control embryos showed thick bundles of caudal motor neurons that exited the spinal cord, spanned the entire ventral musculature, and arborized within muscle (Fig 5G and 5G’). However, Elf3 morphants had weakly stained spinal motor neurons that were fragmented or showed varicosities (swellings), and the axons were abnormally branched (Fig 5H, 5I, 5H’ and 5I’). Some of those axon projections were much shorter than normal (Fig 5H and 5H’). Measurements of the motor neurons in the anterior trunk showed that average axon lengths were reduced from 113.6 μm in controls (n = 18 neurons in 3 individuals, SD 14.65) to 68.3 μm in Elf3 morphants (n = 30 neurons in 4 individuals, SD 20.72), which was statistically significant (P<0.0001). Severely defective embryos showed more abnormal branching of shorter and fragmented axons (Fig 5I and 5I’). Taken together, Elf3 knockdown caused abnormal axonal pathfinding and axon degeneration in specific cell types.

Elf3 functional interactions identified by pathway analysis

To identify potential molecular mechanisms for the developmental defects in Elf3 morphants, we performed IPA that predicts interactions of Elf3 with other molecules based on the manually curated content (from human, mouse, rat publications) in the Ingenuity Knowledge Base. IPA predicted 89 direct relationship (experimentally observed or highly predicted) and 89 nodes that are downstream of Elf3 (Fig 6A). Those molecules include transcription regulators, a translation regulator, a transmembrane receptor, peptidases, kinases, intracellular proteins, a growth factor, extracellular proteins, enzymes and cytokines. Out of fourteen IPA predicted transcription regulators, orthologous of thirteen of those (SOX9, JUN, SP1, CREBBP, RELA, TAF9, TBP, MYC, EP300, NFE2L2, MED23, EWSR1A, CALR) are expressed during zebrafish embryogenesis. To test how Elf3 knockdown affected the expression of these molecules, in situ hybridization and RT-PCR was performed. Sox9 plays multiple roles during zebrafish development, including cartilage, pectoral fin, eye, and neural crest development [64–66]. The Elf3 morphants showed defects in those tissues, which prompted us to analyze the expression of sox9b, one of the homologues of sox9 by in situ hybridization. The probe detected sox9b in the retina, brain ventricular zone, craniofacial cartilages, and pectoral fin in the control embryos at 2 dpf (Fig 6B). Morphant embryos showed expression of sox9b in similar regions, but the intensity of the staining was lower than the controls indicating reduced sox9b expression (Fig 6C and 6D). Severely defective embryos showed little or no staining in the prospective branchial arch regions and very weak pectoral fin staining.

thumbnail
Download:
Fig 6. Dysregulation of extracellular matrix proteins in Elf3 morphants.

(A) IPA predicted direct relationships and downstream targets of Elf3. (B-D) In situ hybridization detecting sox9b expression at 2 dpf show strong expression in the retina, brain ventricular zone, craniofacial cartilages, and pectoral fin in the control embryos (B) and weaker expression in those areas in the morphants (C, D). arrow: developing craniofacial cartilages. (E) Quantitative RT-PCR assays comparing transcripts of mmp13, mmp9, mmp2, fn, and col2α1 (average fold change from at least 3 independent experiments) show altered levels of expression of those genes in morphants compared to control, Student’s t-test: P<0.05. Scale bar for B-D = 200 μm.

https://doi.org/10.1371/journal.pone.0276255.g006

IPA indicated that Elf3 regulates the expression of many extracellular matrix proteins, including MMPs, Col2α1, and fibronectin. MMPs plays critical role in ECM remodeling and homeostasis and are essential for normal tissue development. Abnormal distribution of Col2α1 in various tissues in Elf3 morphants (Fig 4) supports this connection. Expression of Col2α1, other ECM molecules and ECM regulators (MMPs) were examined in Elf3 morphants. Quantitative PCR was done to measure the expression of transcripts for ECM proteins: Mmp13, Mmp9, Mmp2, Col2α1, and fibronectin. Elf3 knockdown significantly increased the levels of mmp13, mmp9, mmp2, and fn transcripts (~5 to 3 fold) in Elf3 morphants over control embryos at 2 dpf. The level of col2α1 transcripts was minimally decreased (~0.7 fold) in Elf3 morphants as compared to control embryos, but this decrease was not significantly different from the control (Fig 6E). Taken together, Elf3 deficiency dysregulates the expression of extracellular matrix proteins, potentially causing ECM disorganization.

Discussion

This study shows the importance of elf3 during vertebrate embryogenesis and strengthens the findings of mouse knockout study that showed its requirement during mouse development [40]. Elf3 function was required for proper development of multiple organs and tissues in zebrafish.

Maternal elf3 expression during epiboly was detected, but Elf3 knockdown did not affect this early developmental process. The role Elf3 on other early embryogenesis processes require additional studies. It is possible that early functions of Elf3 may be redundant.

High level of elf3 mRNA was detected in specific regions of the developing central nervous system in zebrafish. Gene expression analyses during early human brain development also detected ELF3 RNA in various brain segments (forebrain, midbrain, hindbrain, and spinal cord) of the mid-Carnegie stages embryos to fetus stages [67, 68]. The time of appearance and the RNA levels in brain regions was variable during human development. Elf3 knockdown affected brain morphology and produced a small eye phenotype in zebrafish. The morphants exhibited defects in the optic nerve fasciculation/arborization and spinal motor neuron projections. These observations indicate that Elf3 is required for proper neural morphogenesis. Additional studies focusing on Elf3’s role during neural development are needed to understand function.

The posterior axis did not develop normally in Elf3 morphants. Shorter anterior-posterior axis was also reported after ectopic expression of Ets-related gene (Erg) in Xenopus [69]. The distribution of Col2α1, a major component of ECM in notochord, was aberrant in Elf3 morphants. The vacuolar cells of notochord, which secrete Col2α, express elf3, indicating potential mechanism for notochord defect. For proper notochord morphogenesis, correct deposition and organization of the ECM are essential. Loss of col8a1a or col1a1a produced notochord defects in zebrafish similar to Elf3 knockdown [70, 71]. It is possible that notochord deformities and shortening of posterior axis in the Elf3 morphants was associated with disorganization of Col2α and other ECM components. Uneven distribution of Col2α1 in notochord and fins, showing areas with reduced expression and other areas containing aggregates, raises the possibility of ECM assembly/remodeling defects. A mouse study showed abnormally distributed and increased laminin-1 (a major ECM constituent of intestinal and connective tissues) staining in the small intestine and disorganization of the connective tissues underlying the villus lamina propria of the Elf3-deficient embryos [40]. Both mouse and zebrafish studies showed the role of Elf3 in cell-matrix interactions (see below).

Elf3 morphants showed craniofacial cartilage defects. Roles of other Ets family members in cartilage development were shown previously. Overexpression of Ets-related gene (Erg) in mouse sclerotome changed cellular morphology, reduced Alcian blue staining, decreased Sox9 and inhibited chondrogenesis [72]. Increased dosage of Ets2 led to skeletal abnormalities similar to trisomy-16 mice and Down’s syndrome in human [73]. Another member, Ets1 regulates notochord formation [74]. Elf3-deficient zebrafish embryos had poorly developed branchial arches with fewer Col2α1 producing cells within those arches. Those embryos also displayed reduced sox9b expression. These observations, along with the missing pieces of neurocranium cartilages, suggest that the neurocranium defects in Elf3 morphants could arise early during chrondoprogenitor formation and migration. Presence of all branchial arches but reduced Alcian blue staining suggested near-normal initial steps but compromised chondrocyte differentiation step of branchial cartilage development.

Fin tissue architecture was defective in Elf3 morphants with frequent cysts or clumps of cells, which suggested problems in cell-cell and cell-matrix interactions. Altered fin organization was also reported after Mmp13 knockdown in zebrafish [22]. Hepatocyte growth factor activator inhibitor gene 1 (hai1) morphant exhibited lateral and caudal fin defects like the Elf3 morphant, which was shown to be associated to increased mmp9 expression [75]. Knockdown of mmp9 partially rescued fin defects of hai1 morphant [75]. IPA identified that Elf3 interacts with multiple ECM proteins, including mmp9 and mmp13, suggesting a regulatory role for Elf3 in ECM remodeling. Our experiments detected changes in ECM protein Col2α1 expression in fin. A dose-dependent requirement for Elf3 in maintaining the tissue architecture has been recognized.

MMPs play crucial roles during axonal growth and guidance [76]. Receptors in the axonal growth cones receive signals from their environment that direct axons to extend to their targets and arborize. MMPs modulate extracellular signaling pathways by selectively exposing cryptic ECM sites, inducing proteolysis of receptors and ligands [77, 78]. Xenopus studies showed that MMPs are important for both axon guidance and extension in the developing visual system [79, 80]. Inhibition of a broad-spectrum metalloproteinase by EDTA treatment reduced retinal axon ramification in the optic tectum of zebrafish [81]. Roles for MMP9 were reported for axonal outgrowth in the developing cerebellum of mice [82]. Paclitaxel is a widely used chemotherapy drug that also induces variable peripheral neuropathy in patients. A zebrafish study showed that Paclitaxel treatment induced axon degeneration in embryos and adult fish by ectopically inducing Mmp13 [83]. These studies underscored the importance of appropriate levels of MMPs for development and homeostasis. Our study showed upregulation of mmp13, mmp9, and mmp2 after Elf3 knockdown. We speculate that optic nerve and motor neuron defects seen in Elf3 deficient embryos result from ECM remodeling and pathfinding signal recognition defects caused by MMP dysregulation, affecting axon projection and target recognition.

IPA identified interactions between Elf3 and many proteins belonging to various functional classes, which have been implicated in important developmental processes. Elf3 deficiency during development may directly or indirectly interferes with several signaling pathways and cellular processes, leading to the observed developmental defects. Our study showed that Elf3 is critical for embryonic development, and it is required for proper morphogenesis of the anterior-posterior body axis, craniofacial cartilages, fin tissue, optic nerve retinotectal projection and motor neuron pathfinding in zebrafish. Prior studies showed that the mouse knockout affected intestinal development, and Xenopus studies used gain-of-function, overexpression to show effects on axis development. Our findings show a set of new phenotypes that result from Elf3 loss-of-function and bioinformatics analysis points to potential pathways for gene activity. We hypothesize that these defects in Elf3 morphants are associated with ECM assembly and regulation, particularly collagen, producing defects in the craniofacial cartilage, notochord, and fins. Small brains and eyes were noted, and motor neuron projections were shorter and disorganized. In conclusion, our study showed that Elf3 is required for epidermal, mesenchymal, and neural tissue formation during development. Additional research is needed to fully understand the role of Elf3, a critical regulator of developmental signaling pathways, cellular processes, and cell-matrix interactions during development.

Acknowledgments

We thank the members of the Marrs laboratory for helpful discussion. We thank Patrick Milder for helping with CRISPR/Cas9 injections. Thanks also to Leah Ziliak, Renee Louche, and Kelechi Echeumuna for helping with image analysis.

References

  1. 1. Oikawa T, Yamada T. Molecular biology of the Ets family of transcription factors. Gene. 2003;303:11–34. Epub 2003/02/01. pmid:12559563.
  2. 2. Wasylyk B, Hahn SL, Giovane A. The Ets family of transcription factors. Eur J Biochem. 1993;211(1–2):7–18. Epub 1993/01/15. pmid:8425553.
  3. 3. Potter MD, Buijs A, Kreider B, van Rompaey L, Grosveld GC. Identification and characterization of a new human ETS-family transcription factor, TEL2, that is expressed in hematopoietic tissues and can associate with TEL1/ETV6. Blood. 2000;95(11):3341–8. Epub 2000/05/29. pmid:10828014.
  4. 4. Mackereth CD, Schärpf M, Gentile LN, MacIntosh SE, Slupsky CM, McIntosh LP. Diversity in structure and function of the Ets family PNT domains. J Mol Biol. 2004;342(4):1249–64. Epub 2004/09/08. pmid:15351649.
  5. 5. Oettgen P, Alani RM, Barcinski MA, Brown L, Akbarali Y, Boltax J, et al. Isolation and characterization of a novel epithelium-specific transcription factor, ESE-1, a member of the ets family. Mol Cell Biol. 1997;17(8):4419–33. Epub 1997/08/01. pmid:9234700; PubMed Central PMCID: PMC232296.
  6. 6. Aravind L, Landsman D. AT-hook motifs identified in a wide variety of DNA-binding proteins. Nucleic Acids Res. 1998;26(19):4413–21. Epub 1998/09/22. pmid:9742243; PubMed Central PMCID: PMC147871.
  7. 7. Kopp JL, Wilder PJ, Desler M, Kinarsky L, Rizzino A. Different domains of the transcription factor ELF3 are required in a promoter-specific manner and multiple domains control its binding to DNA. J Biol Chem. 2007;282(5):3027–41. Epub 2006/12/07. pmid:17148437.
  8. 8. Remy P, Baltzinger M. The Ets-transcription factor family in embryonic development: lessons from the amphibian and bird. Oncogene. 2000;19(55):6417–31. Epub 2001/02/15. pmid:11175358.
  9. 9. Kageyama S, Liu H, Nagata M, Aoki F. The role of ETS transcription factors in transcription and development of mouse preimplantation embryos. Biochem Biophys Res Commun. 2006;344(2):675–9. Epub 2006/04/25. pmid:16630543.
  10. 10. Jedlicka P, Gutierrez-Hartmann A. Ets transcription factors in intestinal morphogenesis, homeostasis and disease. Histol Histopathol. 2008;23(11):1417–24. Epub 2008/09/12. pmid:18785124; PubMed Central PMCID: PMC2716142.
  11. 11. Flentjar N, Chu PY, Ng AY, Johnstone CN, Heath JK, Ernst M, et al. TGF-betaRII rescues development of small intestinal epithelial cells in Elf3-deficient mice. Gastroenterology. 2007;132(4):1410–9. Epub 2007/04/06. pmid:17408644.
  12. 12. Wang H, Yu Z, Huo S, Chen Z, Ou Z, Mai J, et al. Overexpression of ELF3 facilitates cell growth and metastasis through PI3K/Akt and ERK signaling pathways in non-small cell lung cancer. Int J Biochem Cell Biol. 2018;94:98–106. Epub 2017/12/07. pmid:29208568.
  13. 13. Eckel KL, Tentler JJ, Cappetta GJ, Diamond SE, Gutierrez-Hartmann A. The epithelial-specific ETS transcription factor ESX/ESE-1/Elf-3 modulates breast cancer-associated gene expression. DNA Cell Biol. 2003;22(2):79–94. Epub 2003/04/26. pmid:12713734.
  14. 14. Chen H, Chen W, Zhang X, Hu L, Tang G, Kong J, et al. E26 transformation (ETS)‑specific related transcription factor‑3 (ELF3) orchestrates a positive feedback loop that constitutively activates the MAPK/Erk pathway to drive thyroid cancer. Oncol Rep. 2019;41(1):570–8. Epub 2018/10/27. pmid:30365150.
  15. 15. Takaoka A, Ishikawa T, Okazaki S, Watanabe S, Miya F, Tsunoda T, et al. ELF3 Overexpression as Prognostic Biomarker for Recurrence of Stage II Colorectal Cancer. In Vivo. 2021;35(1):191–201. Epub 2021/01/07. pmid:33402466; PubMed Central PMCID: PMC7880722.
  16. 16. Gingras MC, Covington KR, Chang DK, Donehower LA, Gill AJ, Ittmann MM, et al. Ampullary Cancers Harbor ELF3 Tumor Suppressor Gene Mutations and Exhibit Frequent WNT Dysregulation. Cell Rep. 2016;14(4):907–19. Epub 2016/01/26. pmid:26804919; PubMed Central PMCID: PMC4982376.
  17. 17. Yachida S, Wood LD, Suzuki M, Takai E, Totoki Y, Kato M, et al. Genomic Sequencing Identifies ELF3 as a Driver of Ampullary Carcinoma. Cancer Cell. 2016;29(2):229–40. Epub 2016/01/26. pmid:26806338; PubMed Central PMCID: PMC5503303.
  18. 18. Yeung TL, Leung CS, Wong KK, Gutierrez-Hartmann A, Kwong J, Gershenson DM, et al. ELF3 is a negative regulator of epithelial-mesenchymal transition in ovarian cancer cells. Oncotarget. 2017;8(10):16951–63. Epub 2017/02/16. pmid:28199976; PubMed Central PMCID: PMC5370013.
  19. 19. Xu H, Wang H, Li G, Jin X, Chen B. The Immune-Related Gene ELF3 is a Novel Biomarker for the Prognosis of Ovarian Cancer. Int J Gen Med. 2021;14:5537–48. Epub 2021/09/18. pmid:34531679; PubMed Central PMCID: PMC8439714.
  20. 20. Guneri-Sozeri PY, Erkek-Ozhan S. Identification of the gene expression changes and gene regulatory aspects in ELF3 mutant bladder cancer. Mol Biol Rep. 2022;49(4):3135–47. Epub 2022/02/25. pmid:35199247.
  21. 21. Kohno Y, Okamoto T, Ishibe T, Nagayama S, Shima Y, Nishijo K, et al. Expression of claudin7 is tightly associated with epithelial structures in synovial sarcomas and regulated by an Ets family transcription factor, ELF3. J Biol Chem. 2006;281(50):38941–50. Epub 2006/10/25. pmid:17060315.
  22. 22. Hillegass JM, Villano CM, Cooper KR, White LA. Matrix metalloproteinase-13 is required for zebra fish (Danio rerio) development and is a target for glucocorticoids. Toxicol Sci. 2007;100(1):168–79. Epub 2007/08/31. pmid:17728286.
  23. 23. Shatnawi A, Norris JD, Chaveroux C, Jasper JS, Sherk AB, McDonnell DP, et al. ELF3 is a repressor of androgen receptor action in prostate cancer cells. Oncogene. 2014;33(7):862–71. Epub 2013/02/26. pmid:23435425; PubMed Central PMCID: PMC4103030.
  24. 24. Enfield KSS, Marshall EA, Anderson C, Ng KW, Rahmati S, Xu Z, et al. Epithelial tumor suppressor ELF3 is a lineage-specific amplified oncogene in lung adenocarcinoma. Nat Commun. 2019;10(1):5438. Epub 2019/11/30. pmid:31780666; PubMed Central PMCID: PMC6882813.
  25. 25. Chang J, Lee C, Hahm KB, Yi Y, Choi SG, Kim SJ. Over-expression of ERT(ESX/ESE-1/ELF3), an ets-related transcription factor, induces endogenous TGF-beta type II receptor expression and restores the TGF-beta signaling pathway in Hs578t human breast cancer cells. Oncogene. 2000;19(1):151–4. Epub 2000/01/25. pmid:10644990.
  26. 26. Oliver JR, Kushwah R, Wu J, Pan J, Cutz E, Yeger H, et al. Elf3 plays a role in regulating bronchiolar epithelial repair kinetics following Clara cell-specific injury. Lab Invest. 2011;91(10):1514–29. Epub 2011/06/29. pmid:21709667.
  27. 27. Tymms MJ, Ng AY, Thomas RS, Schutte BC, Zhou J, Eyre HJ, et al. A novel epithelial-expressed ETS gene, ELF3: human and murine cDNA sequences, murine genomic organization, human mapping to 1q32.2 and expression in tissues and cancer. Oncogene. 1997;15(20):2449–62. Epub 1997/12/12. pmid:9395241.
  28. 28. Rudders S, Gaspar J, Madore R, Voland C, Grall F, Patel A, et al. ESE-1 is a novel transcriptional mediator of inflammation that interacts with NF-kappa B to regulate the inducible nitric-oxide synthase gene. J Biol Chem. 2001;276(5):3302–9. Epub 2000/10/19. pmid:11036073.
  29. 29. Grall F, Gu X, Tan L, Cho JY, Inan MS, Pettit AR, et al. Responses to the proinflammatory cytokines interleukin-1 and tumor necrosis factor alpha in cells derived from rheumatoid synovium and other joint tissues involve nuclear factor kappaB-mediated induction of the Ets transcription factor ESE-1. Arthritis Rheum. 2003;48(5):1249–60. Epub 2003/05/15. pmid:12746898.
  30. 30. Wu J, Duan R, Cao H, Field D, Newnham CM, Koehler DR, et al. Regulation of epithelium-specific Ets-like factors ESE-1 and ESE-3 in airway epithelial cells: potential roles in airway inflammation. Cell Res. 2008;18(6):649–63. Epub 2008/05/14. pmid:18475289; PubMed Central PMCID: PMC4494831.
  31. 31. Fossum SL, Mutolo MJ, Yang R, Dang H, O’Neal WK, Knowles MR, et al. Ets homologous factor regulates pathways controlling response to injury in airway epithelial cells. Nucleic Acids Res. 2014;42(22):13588–98. Epub 2014/11/22. pmid:25414352; PubMed Central PMCID: PMC4267623.
  32. 32. Oliver JR, Kushwah R, Hu J. Multiple roles of the epithelium-specific ETS transcription factor, ESE-1, in development and disease. Lab Invest. 2012;92(3):320–30. Epub 2011/12/14. pmid:22157719.
  33. 33. Brown C, Gaspar J, Pettit A, Lee R, Gu X, Wang H, et al. ESE-1 is a novel transcriptional mediator of angiopoietin-1 expression in the setting of inflammation. J Biol Chem. 2004;279(13):12794–803. Epub 2004/01/13. pmid:14715662.
  34. 34. Peng H, Tan L, Osaki M, Zhan Y, Ijiri K, Tsuchimochi K, et al. ESE-1 is a potent repressor of type II collagen gene (COL2A1) transcription in human chondrocytes. J Cell Physiol. 2008;215(2):562–73. Epub 2007/11/30. pmid:18044710; PubMed Central PMCID: PMC3937869.
  35. 35. Otero M, Plumb DA, Tsuchimochi K, Dragomir CL, Hashimoto K, Peng H, et al. E74-like factor 3 (ELF3) impacts on matrix metalloproteinase 13 (MMP13) transcriptional control in articular chondrocytes under proinflammatory stress. J Biol Chem. 2012;287(5):3559–72. Epub 2011/12/14. pmid:22158614; PubMed Central PMCID: PMC3271009.
  36. 36. Otero M, Peng H, Hachem KE, Culley KL, Wondimu EB, Quinn J, et al. ELF3 modulates type II collagen gene (COL2A1) transcription in chondrocytes by inhibiting SOX9-CBP/p300-driven histone acetyltransferase activity. Connect Tissue Res. 2017;58(1):15–26. Epub 2016/06/17. pmid:27310669; PubMed Central PMCID: PMC5326708.
  37. 37. Wei G, Srinivasan R, Cantemir-Stone CZ, Sharma SM, Santhanam R, Weinstein M, et al. Ets1 and Ets2 are required for endothelial cell survival during embryonic angiogenesis. Blood. 2009;114(5):1123–30. Epub 2009/05/05. pmid:19411629; PubMed Central PMCID: PMC2721789.
  38. 38. Vivekanand P. Lessons from Drosophila Pointed, an ETS family transcription factor and key nuclear effector of the RTK signaling pathway. Genesis. 2018;56(11–12):e23257. Epub 2018/10/16. pmid:30318758.
  39. 39. Li Q, Meissner TB, Wang F, Du Z, Ma S, Kshirsagar S, et al. ELF3 activated by a superenhancer and an autoregulatory feedback loop is required for high-level HLA-C expression on extravillous trophoblasts. Proc Natl Acad Sci U S A. 2021;118(9). Epub 2021/02/25. pmid:33622787; PubMed Central PMCID: PMC7936349.
  40. 40. Ng AY, Waring P, Ristevski S, Wang C, Wilson T, Pritchard M, et al. Inactivation of the transcription factor Elf3 in mice results in dysmorphogenesis and altered differentiation of intestinal epithelium. Gastroenterology. 2002;122(5):1455–66. Epub 2002/05/02. pmid:11984530.
  41. 41. Brembeck FH, Opitz OG, Libermann TA, Rustgi AK. Dual function of the epithelial specific ets transcription factor, ELF3, in modulating differentiation. Oncogene. 2000;19(15):1941–9. Epub 2000/04/22. pmid:10773884.
  42. 42. Yoshida N, Yoshida S, Araie M, Handa H, Nabeshima Y. Ets family transcription factor ESE-1 is expressed in corneal epithelial cells and is involved in their differentiation. Mech Dev. 2000;97(1–2):27–34. Epub 2000/10/12. pmid:11025204.
  43. 43. Andreoli JM, Jang SI, Chung E, Coticchia CM, Steinert PM, Markova NG. The expression of a novel, epithelium-specific ets transcription factor is restricted to the most differentiated layers in the epidermis. Nucleic Acids Res. 1997;25(21):4287–95. Epub 1997/10/23. pmid:9336459; PubMed Central PMCID: PMC147045.
  44. 44. Neve R, Chang CH, Scott GK, Wong A, Friis RR, Hynes NE, et al. The epithelium-specific ets transcription factor ESX is associated with mammary gland development and involution. Faseb j. 1998;12(14):1541–50. Epub 1998/11/07. pmid:9806763.
  45. 45. Jobling AI, Fang Z, Koleski D, Tymms MJ. Expression of the ETS transcription factor ELF3 in the retinal pigment epithelium. Invest Ophthalmol Vis Sci. 2002;43(11):3530–7. Epub 2002/10/31. pmid:12407165.
  46. 46. Sarmah S, Srivastava R, McClintick JN, Janga SC, Edenberg HJ, Marrs JA. Embryonic ethanol exposure alters expression of sox2 and other early transcripts in zebrafish, producing gastrulation defects. Sci Rep. 2020;10(1):3951. Epub 2020/03/05. pmid:32127575; PubMed Central PMCID: PMC7054311.
  47. 47. Sarmah S, Barrallo-Gimeno A, Melville DB, Topczewski J, Solnica-Krezel L, Knapik EW. Sec24D-dependent transport of extracellular matrix proteins is required for zebrafish skeletal morphogenesis. PLoS One. 2010;5(4):e10367. Epub 2010/05/06. pmid:20442775; PubMed Central PMCID: PMC2860987.
  48. 48. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8. Epub 2002/02/16. pmid:11846609.
  49. 49. Sarmah S, Muralidharan P, Curtis CL, McClintick JN, Buente BB, Holdgrafer DJ, et al. Ethanol exposure disrupts extraembryonic microtubule cytoskeleton and embryonic blastomere cell adhesion, producing epiboly and gastrulation defects. Biol Open. 2013;2(10):1013–21. Epub 2013/10/30. pmid:24167711; PubMed Central PMCID: PMC3798184.
  50. 50. Sarmah S, Marrs JA. Complex cardiac defects after ethanol exposure during discrete cardiogenic events in zebrafish: prevention with folic acid. Dev Dyn. 2013;242(10):1184–201. Epub 2013/07/09. pmid:23832875; PubMed Central PMCID: PMC4260933.
  51. 51. Muralidharan P, Sarmah S, Marrs JA. Zebrafish retinal defects induced by ethanol exposure are rescued by retinoic acid and folic acid supplement. Alcohol. 2015;49(2):149–63. Epub 2014/12/30. pmid:25541501; PubMed Central PMCID: PMC4339401.
  52. 52. Marrs JA, Clendenon SG, Ratcliffe DR, Fielding SM, Liu Q, Bosron WF. Zebrafish fetal alcohol syndrome model: effects of ethanol are rescued by retinoic acid supplement. Alcohol. 2010;44(7–8):707–15. Epub 2009/12/29. pmid:20036484; PubMed Central PMCID: PMC2889201.
  53. 53. Goldring MB, Tsuchimochi K, Ijiri K. The control of chondrogenesis. J Cell Biochem. 2006;97(1):33–44. Epub 2005/10/11. pmid:16215986.
  54. 54. Yelick PC, Schilling TF. Molecular dissection of craniofacial development using zebrafish. Crit Rev Oral Biol Med. 2002;13(4):308–22. Epub 2002/08/23. pmid:12191958.
  55. 55. Dane PJ, Tucker JB. Modulation of epidermal cell shaping and extracellular matrix during caudal fin morphogenesis in the zebra fish Brachydanio rerio. J Embryol Exp Morphol. 1985;87:145–61. Epub 1985/06/01. pmid:4031750.
  56. 56. Liedtke D, Orth M, Meissler M, Geuer S, Knaup S, Köblitz I, et al. ECM alterations in Fndc3a (Fibronectin Domain Containing Protein 3A) deficient zebrafish cause temporal fin development and regeneration defects. Sci Rep. 2019;9(1):13383. Epub 2019/09/19. pmid:31527654; PubMed Central PMCID: PMC6746793.
  57. 57. Grandel H, Schulte-Merker S. The development of the paired fins in the zebrafish (Danio rerio). Mech Dev. 1998;79(1–2):99–120. Epub 1999/06/01. pmid:10349624.
  58. 58. Zhang J, Wagh P, Guay D, Sanchez-Pulido L, Padhi BK, Korzh V, et al. Loss of fish actinotrichia proteins and the fin-to-limb transition. Nature. 2010;466(7303):234–7. Epub 2010/06/25. pmid:20574421.
  59. 59. König D, Page L, Chassot B, Jaźwińska A. Dynamics of actinotrichia regeneration in the adult zebrafish fin. Dev Biol. 2018;433(2):416–32. Epub 2017/08/02. pmid:28760345.
  60. 60. Phan HE, Northorp M, Lalonde RL, Ngo D, Akimenko MA. Differential actinodin1 regulation in embryonic development and adult fin regeneration in Danio rerio. PLoS One. 2019;14(5):e0216370. Epub 2019/05/03. pmid:31048899; PubMed Central PMCID: PMC6497306.
  61. 61. Durán I, Marí-Beffa M, Santamaría JA, Becerra J, Santos-Ruiz L. Actinotrichia collagens and their role in fin formation. Dev Biol. 2011;354(1):160–72. Epub 2011/03/23. pmid:21420398.
  62. 62. Scott A, Stemple DL. Zebrafish notochordal basement membrane: signaling and structure. Curr Top Dev Biol. 2005;65:229–53. Epub 2005/01/12. pmid:15642386.
  63. 63. Adams DS, Keller R, Koehl MA. The mechanics of notochord elongation, straightening and stiffening in the embryo of Xenopus laevis. Development. 1990;110(1):115–30. Epub 1990/09/01. pmid:2081454.
  64. 64. Cheung M, Briscoe J. Neural crest development is regulated by the transcription factor Sox9. Development. 2003;130(23):5681–93. Epub 2003/10/03. pmid:14522876.
  65. 65. Yan YL, Willoughby J, Liu D, Crump JG, Wilson C, Miller CT, et al. A pair of Sox: distinct and overlapping functions of zebrafish sox9 co-orthologs in craniofacial and pectoral fin development. Development. 2005;132(5):1069–83. Epub 2005/02/04. pmid:15689370.
  66. 66. Yokoi H, Yan YL, Miller MR, BreMiller RA, Catchen JM, Johnson EA, et al. Expression profiling of zebrafish sox9 mutants reveals that Sox9 is required for retinal differentiation. Dev Biol. 2009;329(1):1–15. Epub 2009/02/13. pmid:19210963; PubMed Central PMCID: PMC2706370.
  67. 67. RNA-seq of coding RNA: Human Developmental Biology Resource (HDBR) expression resource of prenatal human brain development. Available from: https://www.ebi.ac.uk/gxa/experiments/E-MTAB-4840/Results?geneQuery=%5B%7B%22value%22%3A%22ENSG00000163435%22%7D%5D&filterFactors=%7B%22DEVELOPMENTAL_STAGE%22%3A%5B%22Carnegie+Stage+14%22%5D%7D.
    • 68. Lindsay SJ, Xu Y, Lisgo SN, Harkin LF, Copp AJ, Gerrelli D, et al. HDBR Expression: A Unique Resource for Global and Individual Gene Expression Studies during Early Human Brain Development. Front Neuroanat. 2016;10:86. Epub 2016/11/12. pmid:27833533; PubMed Central PMCID: PMC5080337.
    • 69. Baltzinger M, Mager-Heckel AM, Remy P. Xl erg: expression pattern and overexpression during development plead for a role in endothelial cell differentiation. Dev Dyn. 1999;216(4–5):420–33. Epub 2000/01/14. pmid:10633861.
    • 70. Gray RS, Wilm TP, Smith J, Bagnat M, Dale RM, Topczewski J, et al. Loss of col8a1a function during zebrafish embryogenesis results in congenital vertebral malformations. Dev Biol. 2014;386(1):72–85. Epub 2013/12/18. pmid:24333517; PubMed Central PMCID: PMC3938106.
    • 71. Gistelinck C, Kwon RY, Malfait F, Symoens S, Harris MP, Henke K, et al. Zebrafish type I collagen mutants faithfully recapitulate human type I collagenopathies. Proc Natl Acad Sci U S A. 2018;115(34):E8037–e46. Epub 2018/08/08. pmid:30082390; PubMed Central PMCID: PMC6112716.
    • 72. Cox MK, Appelboom BL, Ban GI, Serra R. Erg cooperates with TGF-β to control mesenchymal differentiation. Exp Cell Res. 2014;328(2):410–8. Epub 2014/08/21. pmid:25139621; PubMed Central PMCID: PMC4252592.
    • 73. Sumarsono SH, Wilson TJ, Tymms MJ, Venter DJ, Corrick CM, Kola R, et al. Down’s syndrome-like skeletal abnormalities in Ets2 transgenic mice. Nature. 1996;379(6565):534–7. Epub 1996/02/08. pmid:8596630.
    • 74. Wang C, Kam RK, Shi W, Xia Y, Chen X, Cao Y, et al. The Proto-oncogene Transcription Factor Ets1 Regulates Neural Crest Development through Histone Deacetylase 1 to Mediate Output of Bone Morphogenetic Protein Signaling. J Biol Chem. 2015;290(36):21925–38. Epub 2015/07/23. pmid:26198637; PubMed Central PMCID: PMC4571947.
    • 75. LeBert DC, Squirrell JM, Rindy J, Broadbridge E, Lui Y, Zakrzewska A, et al. Matrix metalloproteinase 9 modulates collagen matrices and wound repair. Development. 2015;142(12):2136–46. Epub 2015/05/28. pmid:26015541; PubMed Central PMCID: PMC4483770.
    • 76. Chan ZC, Oentaryo MJ, Lee CW. MMP-mediated modulation of ECM environment during axonal growth and NMJ development. Neurosci Lett. 2020;724:134822. Epub 2020/02/18. pmid:32061716.
    • 77. Galko MJ, Tessier-Lavigne M. Function of an axonal chemoattractant modulated by metalloprotease activity. Science. 2000;289(5483):1365–7. Epub 2000/08/26. pmid:10958786.
    • 78. McCawley LJ, Matrisian LM. Matrix metalloproteinases: they’re not just for matrix anymore! Curr Opin Cell Biol. 2001;13(5):534–40. Epub 2001/09/07. pmid:11544020.
    • 79. Webber CA, Hocking JC, Yong VW, Stange CL, McFarlane S. Metalloproteases and guidance of retinal axons in the developing visual system. J Neurosci. 2002;22(18):8091–100. Epub 2002/09/12. pmid:12223563; PubMed Central PMCID: PMC6758082.
    • 80. Hehr CL, Hocking JC, McFarlane S. Matrix metalloproteinases are required for retinal ganglion cell axon guidance at select decision points. Development. 2005;132(15):3371–9. Epub 2005/06/25. pmid:15975939.
    • 81. Janssens E, Gaublomme D, De Groef L, Darras VM, Arckens L, Delorme N, et al. Matrix metalloproteinase 14 in the zebrafish: an eye on retinal and retinotectal development. PLoS One. 2013;8(1):e52915. Epub 2013/01/18. pmid:23326364; PubMed Central PMCID: PMC3541391.
    • 82. Vaillant C, Meissirel C, Mutin M, Belin MF, Lund LR, Thomasset N. MMP-9 deficiency affects axonal outgrowth, migration, and apoptosis in the developing cerebellum. Mol Cell Neurosci. 2003;24(2):395–408. Epub 2003/10/24. pmid:14572461.
    • 83. Lisse TS, Middleton LJ, Pellegrini AD, Martin PB, Spaulding EL, Lopes O, et al. Paclitaxel-induced epithelial damage and ectopic MMP-13 expression promotes neurotoxicity in zebrafish. Proc Natl Acad Sci U S A. 2016;113(15):E2189–98. Epub 2016/04/02. pmid:27035978; PubMed Central PMCID: PMC4839466.