Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Genetic ablation of metabotropic glutamate receptor 5 in rats results in an autism-like behavioral phenotype

  • Adrien A. Eshraghi ,

    Roles Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

    aeshraghi@med.miami.edu

    Affiliations Hearing Research and Communication Disorders Laboratory, Department of Otolaryngology, Neurotology Division, University of Miami Miller School of Medicine, Miami, Florida, United States of America, Department of Pediatrics, University of Miami Miller School of Medicine, Miami, Florida, United States of America, Department of Neurological Surgery, University of Miami Miller School of Medicine, Miami, Florida, United States of America

    ⨯
  • Idil Memis,

    Roles Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

    Affiliation Hearing Research and Communication Disorders Laboratory, Department of Otolaryngology, Neurotology Division, University of Miami Miller School of Medicine, Miami, Florida, United States of America

    ⨯
  • Florence Wang,

    Roles Data curation, Formal analysis, Investigation, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

    Affiliation Hearing Research and Communication Disorders Laboratory, Department of Otolaryngology, Neurotology Division, University of Miami Miller School of Medicine, Miami, Florida, United States of America

    ⨯
  • Isaiah White,

    Roles Data curation, Formal analysis, Investigation, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

    Affiliation Hearing Research and Communication Disorders Laboratory, Department of Otolaryngology, Neurotology Division, University of Miami Miller School of Medicine, Miami, Florida, United States of America

    ⨯
  • Emily Furar,

    Roles Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Resources, Software, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

    Affiliation Hearing Research and Communication Disorders Laboratory, Department of Otolaryngology, Neurotology Division, University of Miami Miller School of Medicine, Miami, Florida, United States of America

    ⨯
  • Jeenu Mittal,

    Roles Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

    Affiliation Hearing Research and Communication Disorders Laboratory, Department of Otolaryngology, Neurotology Division, University of Miami Miller School of Medicine, Miami, Florida, United States of America

    ⨯
  • Moeed Moosa,

    Roles Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

    Affiliation Hearing Research and Communication Disorders Laboratory, Department of Otolaryngology, Neurotology Division, University of Miami Miller School of Medicine, Miami, Florida, United States of America

    ⨯
  • Coleen M. Atkins,

    Roles Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

    Affiliation Department of Neurological Surgery, University of Miami Miller School of Medicine, Miami, Florida, United States of America

    ⨯
  • Rahul Mittal

    Roles Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

    Affiliation Hearing Research and Communication Disorders Laboratory, Department of Otolaryngology, Neurotology Division, University of Miami Miller School of Medicine, Miami, Florida, United States of America

    ⨯

Abstract

Autism spectrum disorder (ASD) is a neurodevelopmental disorder characterized by deficits in communication, and social skills, as well as repetitive and/or restrictive interests and behaviors. The severity of ASD varies from mild to severe, drastically interfering with the quality of life of affected individuals. The current occurrence of ASD in the United States is about 1 in 44 children. The precise pathophysiology of ASD is still unknown, but it is believed that ASD is heterogeneous and can arise due to genetic etiology. Although various genes have been implicated in predisposition to ASD, metabotropic glutamate receptor 5 (mGluR5) is one of the most common downstream targets, which may be involved in autism. mGluR5 signaling has been shown to play a crucial role in neurodevelopment and neural transmission making it a very attractive target for understanding the pathogenesis of ASD. In the present study, we determined the effect of genetic ablation of mGluR5 (Grm5) on an ASD-like phenotype using a rat model to better understand the role of mGluR5 signaling in behavior patterns and clinical manifestations of ASD. We observed that mGluR5 Ko rats exhibited exaggerated self-grooming and increased marble burying, as well as deficits in social novelty. Our results suggest that mGluR5 Ko rats demonstrate an ASD-like phenotype, specifically impaired social interaction as well as repetitive and anxiety-like behavior, which are correlates of behavior symptoms observed in individuals with ASD. The mGluR5 Ko rat model characterized in this study may be explored to understand the molecular mechanisms underlying ASD and for developing effective therapeutic modalities.

Citation: Eshraghi AA, Memis I, Wang F, White I, Furar E, Mittal J, et al. (2022) Genetic ablation of metabotropic glutamate receptor 5 in rats results in an autism-like behavioral phenotype. PLoS ONE 17(11): e0275937. https://doi.org/10.1371/journal.pone.0275937

Editor: S. Hossein Fatemi, University of Minnesota Twin Cities, UNITED STATES

Received: May 10, 2022; Accepted: September 26, 2022; Published: November 16, 2022

Copyright: © 2022 Eshraghi et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the paper. There are no datasets associated with this paper.

Funding: This research work was supported by the University of Miami Scientific Awards Committee Interdisciplinary Team Science (SAC ITS) Pilot Award (UM SIP 2018-1R2) to AAE. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Autism spectrum disorder (ASD) is a neurodevelopmental disorder characterized by deficits in behavior and communication [1–4]. The current occurrence of ASD in the United States is about 1 in 44 children [5]. There are three core symptoms of ASD: impaired social behavior, stereotypic/repetitive behaviors, and sensory/communication deficits [1, 6–8]. The commonly observed behavioral disturbances also include aberrant sensitivity to sensory stimulations, hyperactivity, and possible self-injury [1].

ASD is a complex disorder, and a wide arsenal of factors have been involved in the pathophysiology of this neurodevelopmental disorder. Therefore, a multidisciplinary approach is the key to understand its etiology and for the design of rational interventions. Studies in animal models are aimed at simulating the core phenotypes associated with ASD to identify the mechanisms that underscore the entire spectrum of the disorder [9–15]. Due to the lack of suitable ASD models, the exact mechanisms by which ASD develops are still unknown. Rat models may be more appropriate than mice for understanding ASD pathogenesis, as rats exhibit complex social behavior especially during development [16–21]. Mouse play behavior during development is less conspicuous and comprises few interaction elements. In contrast, normal young rats are playfully aggressive creatures, wrestling, boxing, and pinning their siblings down by the neck unlike mice. This is important since ASD is a developmental disorder and modeling the impaired social behavior during development is critical in clinically relevant animal models of ASD. In addition, as compared to mice, rats use a rich acoustic communication system [22–27]. All these findings suggest that the rat may be a more suitable animal model as compared to mice for understanding the molecular mechanisms underlying ASD etiology.

Although the exact etiology of ASD remains an enigma, at least 30% of cases have an underlying genetic etiology [28–35]. The most common gene variants involved in ASD include SHANK3, MECP2, NLGN3, NRXN1 and FMR1 [36–50], some of which are regulated by the metabotropic glutamate receptor (mGluR) pathway, especially mGluR5, thus making it a very attractive target for understanding the pathogenesis of ASD [51]. mGluR5 is a seven-transmembrane spanning G-protein coupled receptor (GPCR) located in the postsynaptic membrane of excitatory synapses, neuronal nuclear membranes, glia, and oligodendrocytes [52–56]. mGluR5 is important for neuronal-glial communication and in neuronal homeostasis including the control of glutamate release and uptake by astrocytes [57]. mGluR5 signal transcription events occur either via phospholipase-C (PLC) to act ultimately on the mitogen activated protein kinase (MAPK) and extracellular signal-regulated kinase (ERK), or via phosphoinositide-3-kinase (PI3K) and the mammalian target of rapamycin (mTOR) [58].

mGluR5 has been shown to play an important role in the pathophysiology of ASD by regulating the function of a number of proteins involved in synaptic transmission, including Shank3 [51]. As a proof of this concept, pharmacological enhancement of mGluR5 has been shown to rescue behavioral deficits in SHANK3 knockout (Ko) mice [59]. mGluR5 and Shank3 interact with each other primarily through homer proteins [51]. In addition, the gene expression of mGluR5 was significantly decreased in ASD patients versus control human subjects in a post-mortem brain stereological investigation [60]. The intensity of the staining of mGluR5-positive neurons was also significantly decreased in ASD versus control subjects [60]. The single nucleotide polymorphisms in Grm5, the gene that encodes mGluR5, have been found to be a predictive genetic classifier for ASD [61]. The mGluR5 antagonists administered to wild-type (WT) rats have been shown to impair social interaction, which is a core clinical deficit in ASD [62]. Further, reduced mGluR5 expression has been observed in Mecp2 Ko mice as well as in the motor cortex of autopsy samples from Rett syndrome (RS) patients [63]. RS is a neurodevelopmental disorder that results from de novo mutations in the MECP2 gene and shares many symptomatic, as well as pathological commonalities with ASD [64, 65]. Additionally, treatment of Mecp2-deficient mice with mGluR5 positive allosteric modulator (PAM), VU0462807, improves behavior defects [63]. These basic science and clinical studies employing ASD individuals strongly lay the foundation for the usefulness and relevance of mGluR5 Ko rats as suitable models of ASD. The availability of a preclinical mGluR5 rat model that is a downstream target molecule for some of the genes implicated in ASD will provide a unique tool to understand the underlying molecular mechanisms behind the etiology of ASD. This model will help us to comprehend the neurodevelopmental changes that underlie the behavioral deficits observed in ASD and will open the doors for evaluating the efficacy of future therapeutic interventions.

Methods

Animals

Heterozygous breeders of mGluR5 Ko rats on Sprague Dawley background were obtained from the Envigo company (Indianapolis, IN, USA). The model was generated by a biallelic deletion of the metabotropic glutamate receptor 5 (mGluR5 or Grm5). All experimental animals were obtained from heterozygous crossings. Male and female rats were used in these experiments. In total, 36 rats [19 WT (9 males, 10 females) and 16 Ko (8 males and 8 females) animals] were subjected to a comprehensive battery of ASD-associated behavior tests at 12 weeks of age. Animals were group housed in a room with 12-hr light /12-hr dark Light/Dark cycle. Food and water were provided ad libitum. To control potential litter effect, one animal each of WT and Ko per litter was randomly selected for behavior phenotyping. This experimental design allows the use of standard statistical methods, such as t tests for analysis [66, 67]. The rest of the animals were used in additional different experiments. The animals for this study were derived from 19 pregnant dams as heterozygous breeding scheme was used providing both WT and Ko rats. Genotyping was performed by Transnetyx company (Cordova, TN, USA) using custom designed probes having primer sequence, mGluR5 F CTTCATGAGGGTTGTACCTTCC; mGluR5 R GTGTGCACAGCTGAGACATAAG. Behavioral analyses were conducted by the trained observers that were blinded to the rat genotype. The study protocol was approved by the Animal Care and Use Committee of the University of Miami and was in full compliance with the NIH guidelines for the care and use of laboratory animals.

Open field (OF)

Rats were brought to the testing room at least 30 minutes before the test. Each animal was videotaped for 10 minutes undisturbed after a 20-minute habituation time in their own cage (46 cm length × 23.5 cm wide × 20 cm high). The dimension of the open field (OF) chamber was 85 x 50 x 50 cm. Animals were placed in the middle of the arena at the start of the test. They remained in the arena for 10 minutes and their positions were tracked using Ethovision Version 11.5 (Noldus Information Technology, Netherlands). The center region was defined as an area that covered 42.35% of the total arena (artificial dimension: 60 x 30 cm inside vs. 85 x 50 cm total arena). Time spent in the center (center duration, in sec) and in the periphery of the arena (periphery duration, in sec) as well as the proportion of time spent in the perimeter of the box was used as an index of anxiety [68–70]. We also determined the total distance traveled (in cm) as an index of locomotor activity. In addition, the rearing frequency was used as a measure of exploratory behavior and anxiety [71, 72].

Self-grooming

After a 20-minute habituation period, animals were videotaped undisturbed for 10 minutes. The number of bouts of grooming sessions and the time spent in grooming was determined by two trained observers who were blinded to the experimental conditions. Self-grooming behaviors included wiping the nose, face, head, and ears with forepaws, as well as licking the body, anogenital area and tail [68, 73, 74]. The influence of rat odors was prevented by thoroughly cleaning the cage at the beginning of each trial.

Social interaction test

The social interaction test was performed using a three-chamber compartment comprising of three phases. In the first phase, the test animal was introduced to the middle compartment of the three- chambered apparatus and was allowed 5 minutes to freely explore left and right chambers each containing an empty Plexiglas cage. In the second phase, a non-familiar wild-type rat matched for sex and age (“stranger rat”) was placed in the cage in the right compartment. The test rat was placed in the middle chamber with closed connecting doors. The experiment started when the operator opened the doors, and the rat behavior was recorded over 10 minutes. Sociability was assessed by recording the time spent in the “stranger rat” chamber (in seconds), and in the empty cage chamber (in seconds) [70, 73, 75, 76].

Immediately following the second phase of the test, a novel wild-type rat matched for sex and age (“novel rat”) was placed in the cage in the left chamber while the “stranger rat” (from the second phase of the test) became familiar (“familiar rat”) to the test animal in this third phase. The search for social novelty was assessed by recording the time spent in the “familiar rat” chamber (in seconds) and in the “novel rat” chamber (in seconds) [70, 73, 75, 76].

Marble-burying test (MBT)

MBT was used to measure repetitive and anxiety-related behaviors [77, 78]. The test rat was left undisturbed for one hour in the testing room in its home-cage for acclimation. In five cm high fresh bedding, 20 marbles (previously washed with 90% alcohol) were placed equally distant in the testing area. After the acclimation period, the test animal was allowed to bury marbles freely for 30 minutes. At the end of the test, the number of marbles buried was counted. Marbles were considered buried if more than two-thirds of their height was covered with the bedding. The marbles were thoroughly cleaned after each experiment followed by replacement of new bedding in the testing chamber. Experiments were also video-recorded, and animal’s cumulative time spent digging was manually scored with a stopwatch by two trained observers who were blinded to the experimental conditions.

Statistical analysis

Statistical analyses were conducted with XLSTAT and GraphPad Prism version 28. Quantitative variables were compared using a Student’s t-test. A Mann-Whitney’s test was performed for nonparametric samples. The threshold of statistical significance was set with a p < 0.05.

Results

Exaggerated self-grooming behavior in mGluR5 Ko rats

Excessive self-grooming has been observed in preclinical animal models of ASD representing repetitive behaviors and as expression of anxiety [79, 80]. We observed that the Ko rats self-groomed significantly more frequently and for longer durations compared to the WT animals (p < 0.01) (Fig 1A and 1B). The mean grooming frequency was 3.31 ± 1.35 for the Ko rats compared to 1.16 ± 0.89 for the WT rats. Average grooming time was 15.25 ± 8.37 seconds and 7.42 ± 2.25 seconds in the Ko and WT rats, respectively. However, there was no statistically significant difference in grooming frequency and grooming time between Ko males and Ko females (p > 0.05).

thumbnail
Download:
Fig 1. mGluR5 Ko rats show exaggerated self-grooming.

The Ko rats groomed significantly more frequently (A) and for longer durations (B) compared to the WT animals. **p < 0.01 Ko versus WT animals.

https://doi.org/10.1371/journal.pone.0275937.g001

Increased rearing frequency in mGluR5 Ko rats

Rearing frequency is the frequency with which the rodent stands on its hind legs in the open field, which might be a direct measure of anxiety [71, 72, 81, 82]. We observed that the frequency of rearing was significantly higher in the Ko group than in the WT rats (Ko: Mean = 36.50, SD = 6.48; WT: Mean = 18.84, SD = 4.18; p < 0.001) (Fig 2). We did not find any statistically significant difference in rearing frequency between Ko males and Ko females (p > 0.05).

thumbnail
Download:
Fig 2. Rearing frequency is increased in mGluR5 Ko rats.

The frequency of rearing was significantly higher in the Ko group than in the WT rats suggesting anxiety-like phenotype. ***p < 0.001 Ko versus WT animals.

https://doi.org/10.1371/journal.pone.0275937.g002

Increased marble-burying behavior and digging time in mGluR5 Ko rats

The MBT allows in assessing anxiety-like, and repetitive behaviors. The effect of genetic ablation of mGluR5 (or Grm5) on MBT in a rat model is still not known. Therefore, we subjected WT and Ko rats to MBT. We determined the number of marbles buried as well as the total digging time in Ko and WT rats. We observed that the Ko rats significantly buried more marbles compared to the WT animals (Ko: Mean = 17.21, SD = 0.52; WT: Mean = 7.91, SD = 0.48; p < 0.001) (Fig 3A). In addition, the total digging time was significantly higher in Ko rats compared to WT animals (Ko: Mean = 169.95, SD = 9.48; WT: Mean = 35.41, SD = 8.33; p < 0.001) (Fig 3B). These results suggest that the Ko rats exhibit repetitive behavior and are more anxious than the WT animals, which are the hallmarks of ASD-like phenotype. However, there was no statistically significant difference between Ko males and Ko females (p > 0.05).

thumbnail
Download:
Fig 3. mGluR5 Ko rats show marble burying phenotype related with ASD-like phenotype.

A. The Ko rats significantly buried more marbles compared to the WT animals. B. The total digging time was significantly higher in the Ko rats compared to the WT animals. ***p < 0.001 Ko versus WT animals.

https://doi.org/10.1371/journal.pone.0275937.g003

Open field test

The open-field test is used to measure locomotor activity and anxious behavior of animal models. We observed that there was no significant difference in the total distance travelled between the Ko and WT rats (Ko: Mean = 44.26, SD = 11.91; WT: Mean = 42.38, SD = 9.19; p = 0.60) (Fig 4). These results suggest that were no significant differences in the locomotor activity of Ko and WT rats. We then determined time spent in the center and periphery by the Ko and WT rats (Fig 5A and 5B). There was no statistical difference between the Ko and WT rats in time spent in periphery and center (p > 0.05).

thumbnail
Download:
Fig 4. mGluR5 Ko rats do not show impaired locomotion.

There was no significant difference in locomotor activity of the Ko rats compared to the WT animals. p > 0.05 Ko versus WT animals. ns: non-significant.

https://doi.org/10.1371/journal.pone.0275937.g004

thumbnail
Download:
Fig 5. Perimeter preference in open-field test.

The mGluR5 Ko rats do not show differences in time spent in center (A), and in perimeter (B) compared to WT animals. p > 0.05 Ko versus WT animals. ns: non-significant.

https://doi.org/10.1371/journal.pone.0275937.g005

mGluR5 Ko rats exhibit deficits in sociability and social novelty

Using the three-chamber test, we assessed the sociability and social novelty behaviors (Figs 6A and 7A). We observed that there was a statistically significant difference in sociability between Ko and WT rats. The WT rats spent significantly more time in the stranger rat chamber compared to the empty chamber (Fig 6B) (p < 0.001). On the contrary, the Ko rats showed no preference for stranger rat and empty (p > 0.05). These findings indicate that Ko rats show deficits in sociability. However, there was no statistically significant difference in sociability between Ko males and Ko females (p > 0.05).

thumbnail
Download:
Fig 6. Three chamber sociability test.

A) Schematic representation of three-chamber sociability test. B) The mGluR5 Ko rats do not exhibit sociability as there was no statistically significant difference between time spent with the stranger rat over the empty cage (p > 0.05). On the other hand, WT rats preferred spending time with the stranger rat compared to the empty cage (***p < 0.001). ns: non-significant.

https://doi.org/10.1371/journal.pone.0275937.g006

thumbnail
Download:
Fig 7. mGluR5 Ko rats exhibit no preference for social novelty.

A) Schematic representation of social-novelty test. B) WT rats showed the preference for social novelty as they spent significantly more time with novel rat compared to the familiar rat (***p < 0.001). On the other hand, the mGluR5 Ko rats showed no preference and there was no statistically significant difference in total time spent with the novel rat over the familiar rat suggesting reluctance to social novelty (p > 0.05). ns: non-significant.

https://doi.org/10.1371/journal.pone.0275937.g007

During the third phase of the three-chambers test assessing the search for social novelty, a novel rat age and sex-matched (“novel rat”) was inserted in the cage of the left chamber while the “familiar rat” remained in the right chamber (Fig 7A). The WT rats spent more time in the novel rat chamber compared to time spent in the familiar rat chamber (p < 0.001). On the other hand, Ko rats showed no preference and there was no statistically significant difference in time spent in familiar and novel rat chambers (p > 0.05) (Fig 7B). These results suggest the reluctance to social novelty of Ko rats as compared to WT animals. However, there was no statistically significant difference in social reluctance between Ko males and Ko females (p > 0.05).

Discussion

Metabotropic glutamate receptor mediated signaling, especially through mGluR5, has been hypothesized to play a crucial role in the pathophysiology of ASD. In support of this concept, the pharmacological enhancement of mGluR5 ameliorates behavioral deficits in preclinical animal models of ASD [59]. As mGluR5 can play an important role in predisposition to ASD, it is worthwhile to examine the effects of genetic deletion of mGluR5 (or Grm5) on ASD-associated behavioral manifestations. In the present study, we subjected mGluR5 Ko rats to a battery of ASD-associated behavior phenotypes such as repetitive behavior, anxiety-like phenotype, social preference, locomotor activity and digging behavior. We observed that Ko rats several behavior deficits congruent with an ASD-like phenotype, suggesting the critical role of mGluR5 signaling in determining increased susceptibility to autism.

Aberrant self-grooming has been associated with ASD-like phenotype in animal models representing stereotyped repetitive behavior [74, 78, 83]. Self-grooming behaviors in rats often include licking the body, paws/legs, genital area, and tail, as well as using their paws to wipe the face, ears, and head [73, 84]. Although self-grooming is a typical animal or rodent behavior performed for seconds to minutes, it is often flagged as abnormal when done more frequently or for an extended amount of time [85]. A number of studies have associated exaggerated self-grooming with ASD-like phenotype. The valproic acid (VPA)-exposed rat offspring have been shown to spend significantly more time self-grooming than control rats, suggesting ASD-related stereotyped behavior [73, 85]. Furthermore, di-(2-ethylhexyl) phthalate (DEHP) exposure has been shown to result in autism-like behavior, illustrated in part by the increased self-grooming time, which is comparable to the elevated duration observed in VPA rats [86]. Our results are in agreement with these studies as we observed that the Ko rats self-groomed significantly more frequently and for longer durations than the WT animals, thus exhibiting ASD-like phenotype.

Marble burying test is commonly used to determine the repetitive and anxiety-like phenotype, which is one of the most important hallmarks of ASD. Both the number of the marbles buried, as well as the amount of time the animal spends exploring the marbles or digging are often studied, similar to the type of analyses performed in our study. We observed that Ko rats buried more marbles and spent more time in digging the marbles compared to WT animals showing repetitive and anxiety-like behavior. On par with these findings, increased marble burying has been observed in various ASD animal models. The loss of Tsc2 in Purkinje cells and deficiency of cyclooxygenase-2 (COX2) have been associated with ASD-like phenotype in rodent models [76, 87, 88]. Similarly, in a VPA induced ASD model, increased marble burying was observed that correlated with repetitive and anxiety-like behavior, mimicking clinical manifestations of ASD in human subjects [89].

An important parameter in the open-field test is the total distance travelled. If there are no differences in total distance traversed between different strains, it facilitates making valid comparisons for various behavior tests, as locomotor activity is no longer a confounding variable in the data analysis. The significant differences in locomotor activity may skew the data by preventing analyses for time spent in certain designated zones of the maze as differences may be due to inactivity instead of due to the genotype effect. In the present study, we observed no statistically significant difference in the locomotor activity of the Ko and WT rats. Therefore, we determined whether there are differences in the time spent in the center and periphery zones between the Ko and WT rats in the open-field test. However, we observed no significant differences in the time spent in the different zones. These results are in agreement with previous findings where no perimeter preference was observed in other animal models of ASD [76]. It is possible that the brain regions involved in this perimeter preference are not affected following the genetic ablation of mGluR5 (Grm5), which needs to be explored in future studies.

Impairments in social behavior is one of the characteristic hallmarks that is observed in individuals with ASD. mGluR5 signaling has been shown to play an important role in social interaction. As a proof of this concept, the mGluR5 positive allosteric modulator (PAM) CDPPB has been demonstrated to ameliorate social interaction deficits in the Shank2, Shank3, and Sarm1 Ko mouse models of ASD [59, 90, 91]. In addition, mGluR5 PAM [3-cyano-N-(1,3-diphenyl-1H-pyrazol-5-yl) benzamide] (CDPPB) attenuated social behavior deficits in Sarm1 knock-out mouse model of ASD and prevented ASD-like alterations in rats exposed to cannabinoid during the prenatal period [91, 92]. These improvements in social behavior were attributed to the enhancement of mGluR5 levels. Our results are in agreement with these studies as mGluR5 Ko rats exhibited sociability deficits as well as impaired social behavior thus emphasizing the importance of mGluR5signaling in normal brain functioning.

In addition, our findings are in agreement with the data obtained from mGluR5 Ko mice. It has been shown that mGluR5 ko mice show impairments in social interaction and altered marble burying activity compared to WT controls [93]. However, no statistically significant differences were observed in self-grooming pattern and rotarod performance in mGluR5 Ko mice. Interestingly, mGluR5 Ko mice showed altered locomotor activity which may have confounded behavioral measurements. We do not observe such alteration in locomotor activity of Ko rats compared to WT animals thus suggesting this rat model can be used to understand the molecular underpinnings of ASD as well as testing the efficacy of future novel therapeutics for autism.

In summary, our findings suggest that mGluR5 Ko rats display ASD-like phenotype. Our results highlight the crucial role of mGluR5 signaling in ASD-associated behavior deficits. One of the limitations of our study is the constitutive deletion of mGluR5 expression. Future studies using conditional Ko rats with deletion of mGluR5 only in the brain or specific areas of the brain can shed further light on the role of mGluR5 signaling in the pathophysiology of ASD.

Acknowledgments

We are grateful to Dr. Valerie Gramling for critical reading of manuscript.

References

  1. 1. Lord C, Elsabbagh M, Baird G, Veenstra-Vanderweele J. Autism spectrum disorder. Lancet. 2018; 392(10146):508–520. pmid:30078460
  2. 2. Bottema-Beutel K. Glimpses into the blind spot: Social interaction and autism. Journal of communication disorders. 2017; 68:24–34. pmid:28644991
  3. 3. Bonnet-Brilhault F. Autism: An early neurodevelopmental disorder. Archives of Pediatrics. 2017; 24(4):384–390.
  4. 4. Lai MC, Lombardo MV, Baron-Cohen S. Autism. Lancet. 2014; 383 (9920): 896–910. https://doi.org/10.1016/s0140-6736(13)61539-1.
  5. 5. Maenner MJ, Shaw KA, Bakian AV, Bilder DA, Durkin MS, Esler A, et al. Prevalence and Characteristics of Autism Spectrum Disorder Among Children Aged 8 Years—Autism and Developmental Disabilities Monitoring Network, 11 Sites, United States, 2018. Morbidity and mortality weekly report. Surveillance summaries. 2021;70(11):1–16. pmid:34855725
  6. 6. Purpura G, Costanzo V, Chericoni N, Puopolo M, Scattoni ML, Muratori F, et al. Bilateral patterns of repetitive movements in 6- to 12-month-old infants with autism spectrum disorders. Frontiers in psychology. 2017; 8:1168. pmid:28744250
  7. 7. Wang Q, Hu Y, Shi D, Zhang Y, Zou X, Li S, et al. Children with autism spectrum disorder prefer looking at repetitive movements in a preferential looking paradigm Journal of autism and developmental disorders. 2018; 48(8):2821–2831.
  8. 8. Muskens JB, Velders FP, Staal WG. Medical comorbidities in children and adolescents with autism spectrum disorders and attention deficit hyperactivity disorders: a systematic review. European child & adolescent psychiatry. 2017; 26(9):1093–1103. pmid:28674760
  9. 9. Crawley JN. Translational animal models of autism and neurodevelopmental disorders. Dialogues in clinical neuroscience. 2012; 14(3):293–305 pmid:23226954
  10. 10. Haratizadeh S, Parvan M, Mohammadi S, Shabani M, Nozari M. An overview of modeling and behavioral assessment of autism in the rodent. International journal of developmental neuroscience: the official journal of the International Society for Developmental Neuroscience. 2021;81(3):221–228. pmid:33570815
  11. 11. Strekalova T, Svirin E, Veniaminova E, Kopeikina E, Veremeyko T, Yung AWY, et al. ASD-like behaviors, a dysregulated inflammatory response and decreased expression of PLP1 characterize mice deficient for sialyltransferase ST3GAL5. Brain, behavior, & immunity—health. 2021;16:100306.
  12. 12. Kazdoba TM, Leach PT, Crawley JN. Behavioral phenotypes of genetic mouse models of autism. Genes, brain, and behavior. 2016; 15(1):7–26. pmid:26403076
  13. 13. Sungur AÖ, Schwarting RKW, Wöhr M. Behavioral phenotypes and neurobiological mechanisms in the Shank1 mouse model for autism spectrum disorder: A translational perspective. Behavioural brain research. 2018; 352:46–61. pmid:28963042
  14. 14. Kazdoba TM, Leach PT, Yang M, Silverman JL, Solomon M, Crawley JN. Translational Mouse Models of Autism: Advancing Toward Pharmacological Therapeutics. Current Topics in Behavioral Neurosciences. 2016; 28:1–52. pmid:27305922
  15. 15. Dhamne SC, Silverman JL, Super CE, Lammers SHT, Hameed MQ, Modi ME, et al. Replicable in vivo physiological and behavioral phenotypes of the Shank3B null mutant mouse model of autism. Molecular Autism. 2017; 8:26. pmid:28638591
  16. 16. Vanderschuren LJ, Achterberg EJ, Trezza V. The neurobiology of social play and its rewarding value in rats. Neuroscience and biobehavioral reviews. 2016; 70:86–105 pmid:27587003
  17. 17. Leite IS, Castelhano AS, Cysneiros RM. Effect of diazepam on sociability of rats submitted to neonatal seizures. Data Brief. 2016; 7:686–91. pmid:27054178
  18. 18. Vanderschuren LJ, Niesink RJ, Van Ree JM. The neurobiology of social play behavior in rats. Neurosci Biobehav Rev. 1997; 21(3):309–26. pmid:9168267
  19. 19. Pellis SM, Pellis VC. Play fighting of rats in comparative perspective: A schema for neurobehavioral analyses. Neurosci Biobehav Rev. 1998; 23:87–101. pmid:9861614
  20. 20. Carnevali L, Montano N, Statello R, Coudé G, Vacondio F, Rivara S, et al. Social stress contagion in rats: Behavioural, autonomic and neuroendocrine correlates. Psychoneuroendocrinology. 2017; 82:155–163. pmid:28550792
  21. 21. Castro GP, Medeiros DC, Guarnieri LO, Mourão FAG, Pinto HPP, Pereira GS, et al. Wistar audiogenic rats display abnormal behavioral traits associated with artificial selection for seizure susceptibility. Epilepsy Behav. 2017; 71(Pt B):243–249. pmid:26440280
  22. 22. Branchi I, Santucci D, Alleva E. Ultrasonic vocalisation emitted by infant rodents: a tool for assessment of neurobehavioural development. Behavioural Brain Research 2001; 125:49–56. pmid:11682093
  23. 23. Brudzynski SM. Ethotransmission: communication of emotional states through ultrasonic vocalization in rats. Current Opinion in Neurobiology 2013; 23:310–7. pmid:23375168
  24. 24. Ehret G. Infant rodent ultrasounds—a gate to the understanding of sound communication. Behavior Genetics 2005; 35:19–22. pmid:15674530
  25. 25. Hofer MA, Shair HN. Ultrasonic vocalization, laryngeal braking, and thermogenesis in rat pups: a reappraisal. Behavioral Neuroscience 1993; 107:354–62. pmid:8484900
  26. 26. Knutson B, Burgdorf J, Panksepp J. Ultrasonic vocalizations as indices of affective states in rats. Psychological Bulletin 2002; 128:961–77. pmid:12405139
  27. 27. Knutson B, Burgdorf J, Panksepp J. Anticipation of play elicits high-frequency ultrasonic vocalizations in young rats. Journal of Comparative Psychology 1998; 112:65–73. pmid:9528115
  28. 28. De Rubeis S, Buxbaum JD. Genetics and genomics of autism spectrum disorder: embracing complexity. Human Molecular Genetics. 2015; 24(R1):R24–31. pmid:26188008
  29. 29. Wu N, Wang Y, Jia JY, Pan YH, Yuan XB. Association of CDH11 with Autism Spectrum Disorder Revealed by Matched-gene Co-expression Analysis and Mouse Behavioral Studies. Neuroscience Bulletin. 2022;38(1):29–46. pmid:34523068
  30. 30. Viggiano M, D’Andrea T, Cameli C, Posar A, Visconti P, Scaduto MC, et al. Contribution of CACNA1H Variants in Autism Spectrum Disorder Susceptibility. Frontiers in Psychiatry. 2022;13:858238. pmid:35350424
  31. 31. Gaugler T, Klei L, Sanders SJ, Bodea CA, Goldberg AP, Lee AB, et al. Most genetic risk for autism resides with common variation. Nature Genetics. 2014; 46(8):881–5. pmid:25038753
  32. 32. Klei L, Sanders SJ, Murtha MT, Hus V, Lowe JK, Willsey AJ, et al. Common genetic variants, acting additively, are a major source of risk for autism. Molecular Autism. 2012; 3(1):9. pmid:23067556
  33. 33. Fanjul-Fernández M, Brown NJ, Hickey P, Diakumis P, Rafehi H, Bozaoglu K, et al. A family study implicates GBE1 in the etiology of autism spectrum disorder. Hum Mutation. 2022;43(1):16–29. pmid:34633740
  34. 34. Carducci F, Ardiccioni C, Fiorini R, Vignini A, Di Paolo A, Alia S, et al. The ALA5/ALA6/ALA7 repeat polymorphisms of the glutathione peroxidase-1 (GPx1) gene and autism spectrum disorder. Autism research: official journal of the International Society for Autism Research. 2022;15(2):215–221 pmid:34997988
  35. 35. Marques AR, Santos JX, Martiniano H, Vilela J, Rasga C, Romão L, et al. Gene Variants Involved in Nonsense-Mediated mRNA Decay Suggest a Role in Autism Spectrum Disorder. Biomedicines. 2022;10(3):665. pmid:35327467
  36. 36. Tzanoulinou S, Musardo S, Contestabile A, Bariselli S, Casarotto G, Magrinelli E, et al. Inhibition of Trpv4 rescues circuit and social deficits unmasked by acute inflammatory response in a Shank3 mouse model of Autism. Molecular psychiatry. 2022 (in press).
  37. 37. Monteiro P, Feng G. SHANK proteins: roles at the synapse and in autism spectrum disorder. Nature reviews. Neuroscience. 2017; 18(3):147–157.
  38. 38. Kanani F, Study D, Balasubramanian M. SHANK3 variant as a cause of nonsyndromal autism in an 11-year-old boy and a review of published literature. Clinical dysmorphology. 2018; 27(4):113–115. pmid:29939863
  39. 39. Leblond CS, Nava C, Polge A, Gauthier J, Huguet G, Lumbroso S, et al. Meta-analysis of SHANK Mutations in Autism Spectrum Disorders: a gradient of severity in cognitive impairments. PLoS Genetics. 2014; 10(9):e1004580. pmid:25188300
  40. 40. Uchino S, Waga C. SHANK3 as an autism spectrum disorder-associated gene. Brain & development. 2013; 35(2):106–10. pmid:22749736
  41. 41. Ito H, Morishita R, Nagata KI. Autism spectrum disorder-associated genes and the development of dentate granule cells. Medical molecular morphology. 2017; 50(3):123–129. pmid:28534217
  42. 42. Gonzales ML, LaSalle JM. The role of MeCP2 in brain development and neurodevelopmental disorders. Current psychiatry reports. 2010; 12(2):127–34. pmid:20425298
  43. 43. Liu Z, Li X, Zhang JT, Cai YJ, Cheng TL, Cheng C, et al. Autism-like behaviours and germline transmission in transgenic monkeys overexpressing MeCP2. Nature. 2016; 530(7588):98–102. pmid:26808898
  44. 44. Jamain S, Quach H, Betancur C, Råstam M, Colineaux C, Gillberg IC, et al. Mutations of the X-linked genes encoding neuroligins NLGN3 and NLGN4 are associated with autism. Nature Genetics. 2003; 34(1):27–9. pmid:12669065
  45. 45. Xu X, Xiong Z, Zhang L, Liu Y, Lu L, Peng Y, et al. Variations analysis of NLGN3 and NLGN4X gene in Chinese autism patients. Molecular biology reports. 2014; 41(6):4133–40. pmid:24570023
  46. 46. Kasem E, Kurihara T, Tabuchi K. Neurexins and neuropsychiatric disorders. Neuroscience Research. 2018; 127:53–60. pmid:29221905
  47. 47. Onay H, Kacamak D, Kavasoglu AN, Akgun B, Yalcinli M, Kose S, et al. Mutation analysis of the NRXN1 gene in autism spectrum disorders. Balkan journal of medical genetics: BJMG. 2017; 19(2):17–22. pmid:28289584
  48. 48. Pugin A, Faundes V, Santa María L, Curotto B, Aliaga S, et al. Clinical, molecular, and pharmacological aspects of FMR1 related disorders. Neurologia. 2017; 32(4):241–252.
  49. 49. Liu Y, Hu Z, Xun G, Peng Y, Lu L, et al. Mutation analysis of the NRXN1 gene in a Chinese autism cohort. Journal of psychiatric research. 2012; 46(5):630–4. pmid:22405623
  50. 50. Jung KM, Sepers M, Henstridge CM, et al. Uncoupling of the endocannabinoid signalling complex in a mouse model of fragile X syndrome. Nat Commun. 2012;3:1080. pmid:23011134
  51. 51. Zantomio D, Chana G, Laskaris L, Testa R, Everall I, Pantelis C, et al. Convergent evidence for mGluR5 in synaptic and neuroinflammatory pathways implicated in ASD. Neuroscience and biobehavioral reviews. 2015; 52:172–7. pmid:25704074
  52. 52. Mao LM, Bodepudi A, Chu XP, Wang JQ. Group I Metabotropic Glutamate Receptors and Interacting Partners: An Update International journal of molecular sciences. 2022;23(2):840.
  53. 53. Acher FC, Cabayé A, Eshak F, Goupil-Lamy A, Pin JP. Metabotropic glutamate receptor orthosteric ligands and their binding sites. Neuropharmacology. 2022;204:108886. pmid:34813860
  54. 54. Awad H, Hubert GW, Smith Y, Levey AI, Conn PJ. Activation of metabotropic glutamate receptor 5 has direct excitatory effects and potentiates NMDA receptor currents in neurons of the subthalamic nucleus. The Journal of neuroscience: the official journal of the Society for Neuroscience. 2000; 20: 7871–9. pmid:11050106
  55. 55. Jong YJ, Kumar V, O’Malley KL. Intracellular metabotropic glutamate receptor 5 (mGluR5) activates signaling cascades distinct from cell surface coun-terparts. The Journal of biological chemistry. 2009; 284: 35827–38. pmid:19840937
  56. 56. Abushik PA, Niittykoski M, Giniatullina R, Shakirzyanova A, Bart G, Fayuk D, et al. The role of NMDA and mGluR5 receptors in calcium mobilization and neurotoxicity of homocysteine in trigem-inal and cortical neurons and glial cells. Journal of neurochemistry. 2014; 129: 264–74. pmid:24266734
  57. 57. Panatier A, Robitaille R. Astrocytic mGluR5 and the tripartite synapse. Neuroscience. 2016; 323:29–34. pmid:25847307
  58. 58. Potter WB, Basu T, O’Riordan KJ, Kirchner A, Rutecki P, Burger C, et al. Reduced juvenile long-term depression in tuberous sclerosis complex is mitigated in adults by compensatory recruitment of mGluR5 and Erk signaling. PLoS Biology. 2013; 11: e1001627. pmid:23966835
  59. 59. Vicidomini C, Ponzoni L, Lim D, Schmeisser MJ, Reim D, Morello N, et al. Pharmacological enhancement of mGlu5 receptors rescues behavioral deficits in SHANK3 knock-out mice. Molecular Psychiatry. 2017; 22(5):784. pmid:27113996
  60. 60. Chana G, Laskaris L, Pantelis C, Gillett P, Testa R, Zantomio D, et al. Decreased expression of mGluR5 within the dorsolateral prefrontal cortex in autism and increased microglial number in mGluR5 knockout mice: Pathophysiological and neurobehavioral implications. Brain, behavior, and immunity. 2015; 49:197–205. pmid:26052099
  61. 61. Skafidas E, Testa R, Zantomio D, Chana G, Everall IP, Pantelis C. Predicting the diagnosis of autism spectrum disorder using gene pathway analysis. Molecular Psychiatry. 2014; 19(4):504–10. pmid:22965006
  62. 62. Koros E, Rosenbrock H, Birk G, Weiss C, Sams-Dodd F. The selective mGlu5 receptor antagonist MTEP, similar to NMDA receptor antagonists, induces social isolation in rats. Neuropsychopharmacology. 2007; 32(3):562–76. pmid:16794564
  63. 63. Gogliotti RG, Senter RK, Rook JM, Ghoshal A, Zamorano R, Malosh C, et al. mGlu5 positive allosteric modulation normalizes synaptic plasticity defects and motor phenotypes in a mouse model of Rett syndrome. Human molecular genetics. 2016; 25(10):1990–2004. pmid:26936821
  64. 64. Jin XR, Chen XS, Xiao L. MeCP2 Deficiency in Neuroglia: New Progress in the Pathogenesis of Rett Syndrome. Frontiers in Molecular Neuroscience. 2017; 10:316. pmid:29046627
  65. 65. Moretti P, Levenson JM, Battaglia F, Atkinson R, Teague R, Antalffy B, et al. Learning and memory and synaptic plasticity are impaired in a mouse model of Rett syndrome. The Journal of neuroscience: the official journal of the Society for Neuroscience. 2006; 26(1):319–27.
  66. 66. Jiménez JA, Zylka MJ. Controlling litter effects to enhance rigor and reproducibility with rodent models of neurodevelopmental disorders. J Neurodevelop Disord. 2021; 13: 2. pmid:33397279
  67. 67. Lazic SE, Essioux L. Improving basic and translational science by accounting for litter-to-litter variation in animal models. BMC Neurosci. 2013; 14: 37. pmid:23522086
  68. 68. Pan T, Jiang C, Cheng J, Xie J, Liu X, Xu W, et al. Autism-Like Behavior in the Offspring of CYP11A1-Overexpressing Pregnant Rats. Frontiers in Neuroscience. 2021;15:774439. pmid:35002603
  69. 69. Sethi S, Keil Stietz KP, Valenzuela AE, Klocke CR, Silverman JL, et al. Developmental Exposure to a Human-Relevant Polychlorinated Biphenyl Mixture Causes Behavioral Phenotypes That Vary by Sex and Genotype in Juvenile Mice Expressing Human Mutations That Modulate Neuronal Calcium. Frontiers in Neuroscience. 2021;15:766826. pmid:34938155
  70. 70. Berg EL, Pedersen LR, Pride MC, et al. Developmental exposure to near roadway pollution produces behavioral phenotypes relevant to neurodevelopmental disorders in juvenile rats. Transl Psychiatry. 2020;10(1):289. pmid:32807767
  71. 71. Oroszi T, Geerts E, de Boer SF, Schoemaker RG, van der Zee EA, Nyakas C. Whole Body Vibration Improves Spatial Memory, Anxiety-Like Behavior, and Motor Performance in Aged Male and Female Rats. Frontiers in aging neuroscience. 2022;13:801828. pmid:35126091
  72. 72. Leal PEPT, da Silva AA, Rocha-Gomes A, Riul TR, Cunha RA, Reichetzeder C, et al. High-Salt Diet in the Pre- and Postweaning Periods Leads to Amygdala Oxidative Stress and Changes in Locomotion and Anxiety-Like Behaviors of Male Wistar Rats. Frontiers in behavioral neuroscience. 2022;15:779080. pmid:35058757
  73. 73. Gu Y, Han Y, Ren S, Zhang B, Zhao Y, Wang X, et al. Correlation among gut microbiota, fecal metabolites and autism-like behavior in an adolescent valproic acid-induced rat autism model. Behavioural brain research. 2022;417:113580. pmid:34555431
  74. 74. Kalueff AV, Stewart AM, Song C, Berridge KC, Graybiel AM, Fentress JC. Neurobiology of rodent self-grooming and its value for translational neuroscience. Nature reviews. Neuroscience 2016;17(1):45–59.
  75. 75. Hamilton SM, Green JR, Veeraragavan S, Yuva L, McCoy A, Wu Y, et al. Fmr1 and Nlgn3 knockout rats: novel tools for investigating autism spectrum disorders. Behavioral Neuroscience. 2014;128(2):103–9. pmid:24773431
  76. 76. Scott KE, Kazazian K, Mann RS, Möhrle D, Schormans AL, Schmid S, et al. Loss of Cntnap2 in the Rat Causes Autism-Related Alterations in Social Interactions, Stereotypic Behavior, and Sensory Processing. Autism Research. 2020;13(10):1698–1717. pmid:32918359
  77. 77. Deng W, Ke H, Wang S, Li Z, Li S, Lv P, et al. Metformin Alleviates Autistic-Like Behaviors Elicited by High-Fat Diet Consumption and Modulates the Crosstalk Between Serotonin and Gut Microbiota in Mice. Behavioural neurology. 2022;2022:6711160. pmid:35222739
  78. 78. Angoa-Pérez M, Kane MJ, Briggs DI, Francescutti DM, Kuhn DM. Marble burying and nestlet shredding as tests of repetitive, compulsive-like behaviors in mice. Journal of Visualized Experiments: JoVE. 2013 Dec 24;(82):50978. pmid:24429507
  79. 79. Kim H, Lim CS, Kaang BK. Neuronal mechanisms and circuits underlying repetitive behaviors in mouse models of autism spectrum disorder. Behavioral and brain functions: BBF. 2016;12(1):3. pmid:26790724
  80. 80. Silverman JL, Yang M, Lord C, Crawley JN. Behavioural phenotyping assays for mouse models of autism. Nature Reviews Neuroscience. 2010;11(7):490–502. pmid:20559336
  81. 81. Sturman O., Germain P.-L., & Bohacek J. (2018). Exploratory rearing: A context- and stress-sensitive behavior recorded in the open-field test. Stress (Amsterdam, Netherlands), 21(5), 443–452. pmid:29451062
  82. 82. Thirtamara Rajamani K, Doherty-Lyons S, Bolden C, et al. Prenatal and early-life exposure to high-level diesel exhaust particles leads to increased locomotor activity and repetitive behaviors in mice. Autism Res. 2013;6(4):248–257. pmid:23495194
  83. 83. Ku KM, Weir RK, Silverman JL, Berman RF, Bauman MD. Behavioral phenotyping of juvenile Long-Evans and Sprague-Dawley rats: Implications for preclinical models of autism spectrum disorders. PLoS One. 2016; 11(6):e0158150. pmid:27351457
  84. 84. Kirsten TB, Bernardi MM. Prenatal lipopolysaccharide induces hypothalamic dopaminergic hypoactivity and autistic-like behaviors: Repetitive self-grooming and stereotypies. Behav Brain Res. 2017;331:25–29. pmid:28526515
  85. 85. Du L, Zhao G, Duan Z, Li F. Behavioral improvements in a valproic acid rat model of autism following vitamin D supplementation. Psychiatry Res. 2017;253:28–32. pmid:28324861
  86. 86. Li Y, Zhao Y, Lu Y, et al. Autism spectrum disorder-like behavior induced in rat offspring by perinatal exposure to di-(2-ethylhexyl) phthalate [published online ahead of print, 2022 Mar 7]. Environ Sci Pollut Res Int. 2022; pmid:35254616
  87. 87. Wong CT, Bestard-Lorigados I, Crawford DA. Autism-related behaviors in the cyclooxygenase-2-deficient mouse model. Genes Brain Behav. 2019;18(1):e12506. pmid:30027581
  88. 88. Reith RM, McKenna J, Wu H, et al. Loss of Tsc2 in Purkinje cells is associated with autistic-like behavior in a mouse model of tuberous sclerosis complex. Neurobiol Dis. 2013;51:93–103. pmid:23123587
  89. 89. Choi CS, Gonzales EL, Kim KC, et al. The transgenerational inheritance of autism-like phenotypes in mice exposed to valproic acid during pregnancy. Sci Rep. 2016;6:36250. pmid:27819277
  90. 90. Won H, Lee HR, Gee HY, Mah W, Kim JI, Lee J, et al. Autistic-like social behaviour in Shank2-mutant mice improved by restoring NMDA receptor function. Nature. 2012;486(7402):261–5. pmid:22699620
  91. 91. Lin CW, Chen CY, Cheng SJ, Hu HT, Hsueh YP. Sarm1 deficiency impairs synaptic function and leads to behavioral deficits, which can be ameliorated by an mGluR allosteric modulator. Frontiers in cellular neuroscience. 2014;8:87. pmid:24744698
  92. 92. Bara A, Manduca A, Bernabeu A, Borsoi M, Serviado M, Lassalle O, et al. Sex-dependent effects of in utero cannabinoid exposure on cortical function. Elife. 2018;7:e36234. pmid:30201092
  93. 93. Xu J, Marshall JJ, Kraniotis S, Nomura T, Zhu Y, Contractor A. Genetic disruption of Grm5 causes complex alterations in motor activity, anxiety and social behaviors. Behav Brain Res. 2021;411:113378. pmid:34029630