Selective optogenetic activation of NaV1.7–expressing afferents in NaV1.7-ChR2 mice induces nocifensive behavior without affecting responses to mechanical and thermal stimuli

Toyoaki Maruta; Kotaro Hidaka; Satoshi Kouroki; Tomohiro Koshida; Mio Kurogi; Yohko Kage; Seiya Mizuno; Tetsuro Shirasaka; Toshihiko Yanagita; Satoru Takahashi; Ryu Takeya; Isao Tsuneyoshi

doi:10.1371/journal.pone.0275751

Abstract

In small and large spinal dorsal root ganglion neurons, subtypes of voltage-gated sodium channels, such as Na_V1.7, Na_V1.8, and Na_V1.9 are expressed with characteristically localized and may play different roles in pain transmission and intractable pain development. Selective stimulation of each specific subtype in vivo may elucidate its role of each subtype in pain. So far, this has been difficult with current technology. However, Optogenetics, a recently developed technique, has enabled selective activation or inhibition of specific neural circulation in vivo. Moreover, optogenetics had even been used to selectively excite Na_V1.8-expressing dorsal root ganglion neurons to induce nocifensive behavior. In recent years, genetic modification technologies such as CRISPR/Cas9 have advanced, and various knock-in mice can be easily generated using such technology. We aimed to investigate the effects of selective optogenetic activation of Na_V1.7-expressing afferents on mouse behavior. We used CRISPR/Cas9-mediated homologous recombination to generate bicistronic Na_V1.7–iCre knock-in mice, which express iCre recombinase under the endogenous Na_V1.7 gene promoter without disrupting Na_V1.7. The Cre-driver mice were crossed with channelrhodopsin-2 (ChR2) Cre-reporter Ai32 mice to obtain Na_V1.7^iCre/+;Ai32/+, Na_V1.7^iCre/iCre;Ai32/+, Na_V1.7^iCre/+;Ai32/Ai32, and Na_V1.7^iCre/iCre;Ai32/Ai32 mice. Compared with wild–type mice behavior, no differences were observed in the behaviors associated with mechanical and thermal stimuli exhibited by mice of the aforementioned genotypes, indicating that the endogenous Na_V1.7 gene was not affected by the targeted insertion of iCre. Blue light irradiation to the hind paw induced paw withdrawal by mice of all genotypes in a light power-dependent manner. The threshold and incidence of paw withdrawal and aversive behavior in a blue-lit room were dependent on ChR2 expression level; the strongest response was observed in Na_V1.7^iCre/iCre;Ai32/Ai32 mice. Thus, we developed a non-invasive pain model in which peripheral nociceptors were optically activated in free-moving transgenic Na_V1.7–ChR2 mice.

Citation: Maruta T, Hidaka K, Kouroki S, Koshida T, Kurogi M, Kage Y, et al. (2022) Selective optogenetic activation of Na_V1.7–expressing afferents in Na_V1.7-ChR2 mice induces nocifensive behavior without affecting responses to mechanical and thermal stimuli. PLoS ONE 17(10): e0275751. https://doi.org/10.1371/journal.pone.0275751

Editor: Tudor C. Badea, Transilvania University of Brasov: Universitatea Transilvania din Brasov, ROMANIA

Received: June 11, 2022; Accepted: September 22, 2022; Published: October 6, 2022

Copyright: © 2022 Maruta et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the paper and its Supporting Information files.

Funding: Toyoaki Maruta was supported by Japan Society for the Promotion of Science (https://www.jsps.go.jp/english/index.html): KAKENHI Grant Numbers JP18K08859, 21K08925, and 16H06276 (Advanced Animal Model Support, http://model.umin.jp/english/index.html). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

The sensation of pain results from the activation of a subset of sensory neurons known as nociceptors. Activation of unmyelinated (C-fiber) and myelinated (Aδ-fiber) nociceptive afferent fibers indicates potential tissue damage, which is reflected in the high thresholds of nociceptors for mechanical, thermal, and chemical stimuli, which induce neurotransmissions via ion channels, neurotransmitters, and intracellular signaling [1, 2]. These conditions change considerably in neuropathic pain states. Understanding the changes that occur in neuropathic pain is vital for identifying new therapeutic targets and developing novel analgesics [2]. However, since mechanical, thermal, and chemical stimuli activate both targeted and off-target neurons, effectively controlling the activation of specific types of neurons is a major challenge.

Optogenetics is a recently developed and popular tool used in several areas of neuroscience research [3]. This technique utilizes light-sensitive ion channels (opsins) to modulate the activity of specific neuron subsets. Several types of opsins are currently used, with new ones being continuously developed and optimized. This technique, which enables selective activation or inhibition of neural circulation in vivo, can be used to provide a better understanding of complex pain pathways [4–7].

Channelrhodopsins are a subfamily of retinylidene proteins (rhodopsins) that function as light–gated ion channels. They are nonspecific cation channels that conduct H⁺, Na⁺, K⁺, and Ca²⁺ ions. Channelrhodopsin-1 (ChR1) and Channelrhodopsin-2 (ChR2) from the model organism Chlamydomonas reinhardtii were the first discovered channelrhodopsins. Recently, various ChR2 transgenic animal models have been generated, which play important roles in revealing the mechanisms of neural activity and mapping neural circuits [8].

Different subtypes of voltage-gated sodium channels, including NaV1.7, NaV1.8, and NaV1.9, exhibit characteristic localization in neurons of the small and large spinal dorsal root ganglion (DRG) and may play different roles in pain transmission and neuropathic pain development [9,10]. If a specific subtype of voltage-gated sodium channels could be selectively stimulated in a living body, it might be possible to evaluate its specific role in pain. However, this has been difficult with current technology. Optogenetics enables selective activation or inhibition of neural circulation in vivo. The first voltage-dependent Na⁺ channel to be targeted in pain studies using ChR2 transgenic animals was Na_V1.8 [11, 12]. However, transgenic mice wherein other Na⁺ channels are targeted have not been produced. Currently, genetic modification technologies such as CRISPR/Cas9 have advanced, and various knock-in mice can be easily generated. The present study aimed to examine mouse nocifensive behavior as a result of selective optogenetic activation of Na_V1.7–expressing afferents. This study helps elucidate the role of Na_V1.7 in pain neurotransmission and might provide valuable insights into the development of neuropathic pain and the design of effective therapeutics in the future.

Results

Development of original Na_V1.7–iCre (Na_V1.7^iCre/+) knock-in mice

The founder generation (F0) of bicistronic Na_V1.7–iCre (Na_V1.7^iCre/+) knock-in mice was created using the CRISPR/Cas9 system (Fig 1A), with s assistance from the platform of Advanced Animal Model Support (AdAMS). The sequence 5′-gaaagcaggaaatagagctt-3′ containing the termination codon of Scn9a was selected as the target for the single guide RNA (sgRNA) and inserted into the pX330-mC plasmid, which carried both sgRNA and Cas9-mC expression units [13]. A P2A-iCre-rabbit globin polyadenylation sequence was present between the 5′- and 3′- homology arms of the donor DNA, piCre-Scn9a. P2A is a 2A self-cleaving peptide that helps generate polyproteins by preventing the ribosome from creating a peptide bond (ribosome skipping). The genomic region from 1,656 to 1 bp upstream of the termination codon was isolated in the 5′-homology arm, whereas the genomic region from the termination codon to 2,054 bp downstream of the termination codon was isolated in the 3′-homology arm of Scn9a. These DNA vectors were isolated using the FastGene Plasmid Mini Kit (Nippon Genetics, Tokyo, Japan) and filtered through a Millex-GV® filter (0.22 μm; Merck Millipore, Darmstadt, Germany).

Download:

Fig 1.

Schematic diagram of the Scn9a^iCre knock-in allele (a) and PCR for genotyping founder mice (b). (a)The last exon of Scn9a is illustrated. The P2A-iCre sequence was inserted immediately after the stop codon of Scn9a. (b) The detection of the insert upstream of the 5′- and 3′-homology arm and the random integration of pX330-mC and piCre-Scn9a. Six founder mice were determined to carry the designed knock-in mutation. M, marker; P, positive control; N, negative control.

https://doi.org/10.1371/journal.pone.0275751.g001

Pregnant mare serum gonadotropin (5 IU) and human chorionic gonadotropin (5 IU) were intraperitoneally injected into female C57BL/6J mice at 48-h intervals. Subsequently, they mated with male C57BL/6J mice. Afterwards., we obtained the zygotes from the oviducts of the mated females and microinjected a mixture of pX330-mC (circular, 5 ng/μL, each) and piCre-Scn9a (circular, 10 ng/μL) into the zygotes. Subsequently, the surviving zygotes were transferred into the oviducts of pseudopregnant ICR strain females mice of the ICR strain, and newborns were obtained. To confirm the presence of the knock-in mutation, we purified the genomic DNA isolated from a tail tissue sample was purified using a PI-200 DNA automatic isolation system (Kurabo Industries Ltd., Osaka, Japan) according to the manufacturer’s instructions. Genomic PCR was performed using a KOD Fx kit (TOYOBO, Osaka, Japan). The insert upstream of the 5′ homology arm was detected using the following primers: Scn9a screening 5Fw (5′- TGATGGCCATAAAAATCAAAGGATGGTA-3′) and iCre-5-Rv68 (5′- AGATCCATCTCTCCACCAGCTTGGTAAC -3′). The insert upstream of the 3′-homology arm was detected using the following primers: iCre-3-Fw68 (5′- GAGGATGTGAGGGACTACCTCCTGTACC -3′) and Scn9a screening 3Rv (5′- GGATGTTTTGTGTGGCTCACCATTAAGT-3′). Six founder mice were determined to carry the designed knock-in mutation. Additionally, we performed PCR to detect random integration of pX330-mC and piCre-Scn9a with a primer that detected the ampicillin resistance gene (Amp detection-F: 5′-ttgccgggaagctagagtaa-3′, and Amp detection-R: 5′-tttgccttcctgtttttgct-3′). No founder mice was determined to carry the random integration allele. Fig 1B shows the results of genomic PCR.

Development of Na_V1.7-ChR2 mice genotypes

Fig 2A shows the mating patterns of mice adopted the following four genotypes of Na_V1.7-ChR2 mice: Na_V1.7^iCre/+;Ai32/+, Na_V1.7^iCre/iCre;Ai32/+, Na_V1.7^iCre/+;Ai32/Ai32, and Na_V1.7^iCre/iCre;Ai32/Ai32. We created Na_V1.7^iCre/+;Ai32/+ mice by crossing homozygous Na_V1.7–iCre (Na_V1.7^iCre/iCre) mice with homozygous Ai32 mice carrying the ChR2(H134R)-EYFP gene in their Gt(ROSA)26Sor locus [14]. The gene was separated from its CAG promoter using a loxP-flanked transcriptional STOP cassette, allowing its expression in a Cre-dependent manner. Thereafter, Na_V1.7^iCre/+;Ai32/+, Na_V1.7^iCre/iCre;Ai32/+, Na_V1.7^iCre/+;Ai32/Ai32, and Na_V1.7^iCre/iCre;Ai32/Ai32 mice were created by crossing Na_V1.7^iCre/+;Ai32/+ mice with each other.

Download:

Fig 2.

Establishment of different lines of transgenic mice (a) and distribution of ChR2-EYFP channels in DRG (b). (a) Na_V1.7^iCre/+;Ai32/+ mice were created by crossing homozygous Na_V1.7–iCre mice with heterozygous Ai32 mice. Subsequently, Na_V1.7^iCre/+;Ai32/+, Na_V1.7^iCre/iCre;Ai32/+, Na_V1.7^iCre/+;Ai32/Ai32, and Na_V1.7^iCre/iCre;Ai32/Ai32 mice were created by crossing Na_V1.7^iCre/+;Ai32/+ mice with each other. The four genotypes of mice used in the study are highlighted in yellow. (b) A typical immunohistochemical image showing of ChR2-EYFP in the DRG, the dorsal horn of spinal cord, and glabrous skin of Na_V1.7^iCre/+;Ai32/+ mouse was shown. Green and red fluorescence indicates ChR2-EYFP and Na_V1.7, respectively. ChR2–EYFP were expressed on Na_V1.7-expressing DRG neurons. Green fluorescence (ChR2–EYFP expression) can be observed in the dorsal horn. ChR2–EYFP is localized in free nerve endings in the lower and upper dermis of glabrous skin.

https://doi.org/10.1371/journal.pone.0275751.g002

Fig 2B shows a typical immunohistochemical image showing Na_V1.7 and ChR2-EYFP in the DRG of Na_V1.7^iCre/+;Ai32/+ mouse. EYFP fluorescence was observed in Na_V1.7-expressing DRG neurons. EYFP fluorescence was also observed in the dorsal horn of the spinal cord and was faded in the deep and superficial layers of the glabrous skin bordering the dermal–epidermal junction.

Normal nocifensive behavior associated with mechanical and thermal stimuli was exhibited by the four genotypes

We examined the behavior associated with mechanical and thermal stimuli exhibited by four genotypes of Na_V1.7-ChR2 mice. As shown in Fig 3A and 3B, compared with the behavior of wild-type (WT) mice, no differences were observed in the behavior associated with mechanical and thermal stimuli exhibited by the mice of the four genotypes.

Download:

Fig 3.

Paw withdrawal test (von Frey test) (a) and plantar test (b). (a) The von Frey test was performed with the wild type (WT) and mice of the four genotypes. The hind paw withdrawal data were analyzed using one-way ANOVA. All results are calculated as mean ± SD of 10 or more animals. Individual results for each strain are as follows: WT (B6J), 4.4 ± 0.7 g; Na_V1.7^iCre/+;Ai32/+, 4.8 ± 0.4 g; Na_V1.7^iCre/iCre;Ai32/+, 4.5 ± 0.8 g; Na_V1.7^iCre/+;Ai32/Ai32, 4.0 ± 1.2 g; and Na_V1.7^iCre/iCre;Ai32/Ai32, 4.3 ± 0.7 g. (b) The plantar test was performed with the WT and mice of the four genotypes. The data were analyzed using one-way ANOVA. All results are calculated as mean ± SD of 10 or more animals. Individual results for each strain were as follows: WT (B6J), 5.7 ± 0.8 s; Na_V1.7^iCre/+;Ai32/+, 5.5 ± 1.2 s; Na_V1.7^iCre/iCre;Ai32/+, 6.6 ± 1.7 s; Na_V1.7^iCre/+;Ai32/Ai32, 6.6 ± 2.2 s; and Na_V1.7^iCre/iCre;Ai32/Ai32, 6.3 ± 1.2 s.

https://doi.org/10.1371/journal.pone.0275751.g003

Differences among the four genotypes in behavior associated with optogenetic stimulation

We performed two types of behavioral tests using optogenetics. Fig 4 shows a schematic representation of the blue LED light irradiation hind paw withdrawal test. The mice of the four genotypes showed a light power-dependent increase in withdrawal percentage and sensitivity to blue light in the following order: Na_V1.7^iCre/+;Ai32/+ < Na_V1.7^iCre/iCre;Ai32/+ < Na_V1.7^iCre/+;Ai32/Ai32 < Na_V1.7^iCre/iCre;Ai32/Ai32. To rule out a ChR2-independent effect of strong illumination on the animal behavior, we performed a yellow LED light irradiation hind paw withdrawal test on Na_V1.7^iCre/+;Ai32/+ mice to rule out a ChR2-independent effect of strong illumination on the animal behaviour. Irradiation with yellow light irradiation (5 mW) did not induce hind paw withdrawal behavior.

Download:

Fig 4. Light irradiation hind paw withdrawal test.

(a) Experimental schematic. (b) The blue light irradiation hind paw withdrawal test was performed in wild-type (WT) and mice of the four genotypes. The data were analyzed using one-way ANOVA followed by Bonferroni post-hoc analysis. All results are calculated as mean ± SD of 10 or more animals. *P < 0.001, compared with WT mice. ^†P = 0.03 and ^#P = 0.02, compared with WT mice.

https://doi.org/10.1371/journal.pone.0275751.g004

Fig 5 shows a schematic representation of the optogenetic place aversion (OPA) test. The time spent in the room with the blue LED floor was shorter for mice of all four genotypes than that for WT mice. The duration of stay in the room by mice decreased as follows: Na_V1.7^iCre/+;Ai32/+ = Na_V1.7^iCre/iCre;Ai32/+ > Na_V1.7^iCre/+;Ai32/Ai32 = Na_V1.7^iCre/iCre;Ai32/Ai32.

Download:

Fig 5. OPA test.

(a) Experimental schematic. (b) The OPA test was performed with the wild-type (WT) and mice of the four genotypes. The data were analyzed using one–way ANOVA followed by Bonferroni post-hoc analysis. All results are calculated as mean ± SD of 10 or more animals. *P < 0.001, compared with WT mice.

https://doi.org/10.1371/journal.pone.0275751.g005

Expression of ChR2 in DRG of mice of the four genotypes

Fig 6 shows ChR2 expression in the DRG of mice of the four genotypes as measured using reverse transcription-polymerase chain reaction (RT–PCR). The expression of ChR2 in mice of the four genotypes increased in the following order: Na_V1.7^iCre/+;Ai32/+ ≤ Na_V1.7^iCre/iCre;Ai32/+ < Na_V1.7^iCre/+;Ai32/Ai32 = Na_V1.7^iCre/iCre;Ai32/Ai32. S2 Fig shows the typical immunohistochemical image showing ChR2-EYFP expression in the DRG of mice of the four genotypes. A higher number of EYFP-positive DRG neurons were observed in Na_V1.7^iCre/+;Ai32/Ai32 and Na_V1.7^iCre/iCre;Ai32/Ai32 mice than that in Na_V1.7^iCre/+;Ai32/+ mice.

Download:

Fig 6. RT-PCR for ChR2 expression in DRG.

ChR2 expression in DRG neurons as measured by RT-PCR. β–Actin was used as a positive control to confirm successful protein extraction and equal loading of samples. All data are calculated as mean ± SD of 5 animals. *P < 0.001, compared with Na_V1.7^iCre/+;Ai32/+ mice. ^†P = 0.007 and ^#P = 0.006, compared with Na_V1.7^iCre/iCre;Ai32/+ mice.

https://doi.org/10.1371/journal.pone.0275751.g006

Discussion

We used CRISPR/Cas9-mediated homologous recombination to generate bicistronic Na_V1.7–iCre knock-in mice expressing iCre recombinase under the control of the endogenous Na_V1.7 gene promoter without disrupting endogenous Na_V1.7. Furthermore, using the Cre-loxP system, we crossed homozygous Na_V1.7–iCre (Na_V1.7^iCre/ ^iCre) mice with homozygous Ai32 mice and generated a transgenic Na_V1.7–ChR2 mouse line (Na_V1.7^iCre/ ⁺;Ai32/+) in which ChR2 was selectively targeted in Na_V1.7-expressing sensory neurons. Thus, the Na_V1.7–iCre transgenic mouse line used in our study could have ChR2 channels delivered to peripheral nociceptors, allowing them to take advantage of the strong CAG promoter driving their conditional expression. This study also demonstrated that the genotype with a higher expression of ChR2 in the DRG showed a greater nocifensive response associated with blue light.

The first attempts to apply optogenetics to explore the underlying mechanisms of pain targeted Mas-related G-protein-coupled receptor D (Mrgprd) expressed in nonpeptidergic nociceptive C-fibers and transient receptor potential vanilloid-1 (TRPV1) expressed in peptidergic nociceptive C-fibers [15–18]. Transdermal optogenetic activation of TRPV1-expressing peripheral nociceptors induces nociceptive behaviors, including paw withdrawal and paw licking in mice, as well as conditioned place aversion, whereas the activation of Mrgprd-expressing neurons induces paw withdrawal and paw lifting, but not aversion [18].

The next target after Mrgprd and TRPV1 was Na_V1.8, a voltage-dependent Na⁺ channel. Using the Cre-loxP strategy, Daou et al. crossed homozygous Na_V1.8–Cre mice with heterozygous Ai32 mice and generated a transgenic mouse line in which ChR2 was selectively targeted in Na_V1.8-expressing sensory neurons. In this line, ChR2 was expressed in the cell bodies as well as the fibers that reach the skin and the superficial layers of the spinal cord. Paw withdrawal was induced by blue light illumination of the hind paw skin of free-moving mice, thus demonstrating that they were the first transgenic mice to sense light as pain [11]. Furthermore, extended exposure of the hind paw to blue light (30 min under anesthesia) induced long-term behavioral sensitization to mechanical and thermal stimuli, and a 10-min exposure induced c-Fos expression in dorsal horn neurons ipsilateral to the stimulated hind paw [11]. Thus, the ability to evoke nocifensive behaviors with light alone provides a novel method of stimulation that is non-invasive, does not require mechanical interruption of the skin, and can be repeated without tissue injury. However, because Na_V1.8 currents are produced by Na_V1.8–Cre heterozygotes but not by Na_V1.8–Cre homozygotes, it is likely that the knock-in of the Cre gene affects the Na_V1.8 gene [19]. Thus, Na_V1.8–Cre homozygotes may have different pain responses to mechanical or thermal stimuli. The Na_V1.7–iCre mice in our study showed no difference in nocifensive response compared with that in WT mice, regardless of them being heterozygotes or homozygotes (S1 Fig). This is an advantage when Na_V1.7–iCre homozygotes are required to be included in experiments, as in this study.

As well as Na_V1.8, Na_V1.7 is also expressed in the peripheral nerve and play important roles in the development of inflammatory and neuropathic pain [9, 10]. Global Na_V1.7-null mutant mice die shortly after birth, whereas the Na_V1.8-null mutation is not lethal [20–22]. In Na_V1.8–Cre mice crossed with floxed Na_V1.7 mice, which are knockout mice specifically lacking the nociceptor Na_V1.7, acute inflammatory pain responses evoked by various stimuli (e.g., carrageenan, Freund’s adjuvant, or formalin) are reduced or abolished [22]. Na_V1.7 is the first voltage-dependent Na⁺ channel to be identified with an altered functional mutation in humans [10]. Gain-of-function mutations in Scn9a, which encodes Na_V1.7, lead to severe neuropathic pain, whereas loss-of-function mutations in this gene lead to an indifference to pain. In the epidermis and spinal cord dorsal horn, Na_V1.7 is thought to enhance subthreshold stimuli, making it easier for neurons to reach the threshold for firing [23]. Thus, Na_V1.7 acts as an amplifier of the receptor potential in nociceptive neurons and plays a critical role in inherited erythromelalgia and paroxysmal extreme pain disorder, as it causes gain-of-function mutations that enable the channel to open with small depolarizations. Conversely, congenital insensitivity to pain is a loss-of-function mutation in Na_V1.7. Na_V1.7-deficient patients have no cognitive or cardiac function impairment; hence, analgesic therapies targeting Na_V1.7 have been investigated using these Scn9a mutations to generate global Scn9a knockout mice or rats [24]. Furthermore, animal studies have shown that Na_V1.7 expression and function are increased in models of diabetic neuropathy, chronic constrictive injury, and chemotherapy-induced peripheral neuropathy [25]. These findings suggest that the pathophysiological mechanisms underlying these pain conditions can be understood by examining the profile of nociceptive behaviors related to Na_V1.7 and further comparing it to those associated with Na_V1.8 and Na_V1.9, which have also been implicated in chronic pain [21, 26]. With the development of genetic recombination technology, it will be easier to create animal models targeting these channels and thus, gain a deeper understanding of the role of these channels in various pain conditions. The present study showed that genotypes with high ChR2 expression (i.e. Na_V1.7^iCre/+;Ai32/Ai32 and Na_V1.7^iCre/iCre;Ai32/Ai32 mice) have a stronger nociceptive response to blue light because ChR2 expression is enhanced even in DRG neurons with low Na_V1.7 expression. However, since Na_V1.7 is widely expressed in various DRG neurons at varying expression levels, the enhanced expression of ChR2 did not seem to reflect such localization of Na_V1.7. Therefore, it is suggested that when comparing Na_V1.7 to Na_V1.8 or Na_V1.9, Cre and Ai32 should be compared in hetero phenotypes (i.e., Na_V1.7^iCre/+;Ai32/+ vs. Na_V1.8^iCre/+;Ai32/+ vs. Na_V1.9^iCre/+;Ai32/+).

In conclusion, we generated bicistronic Na_V1.7–iCre knock-in mice and developed a non-invasive pain model in which peripheral nociceptors were optically activated in free-moving transgenic Na_V1.7–ChR2 mice. An optogenetic approach to investigate the individual role of Na⁺ channel subtypes in pain transduction might provide a better understanding of neuropathic pain development and help in designing effective therapeutics in the future.

Methods

Animals

WT C57BL/6J mice, commonly known as B6J mice, and Ai32 mice (C57BL/6 background) were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). All the mice were individually housed in a temperature and humidity-controlled environment with a 12-h light-dark cycle and were permitted free access to food and water. This study was conducted in strict accordance with the guidelines for the Proper Conduct of Animal Experiments (Science Council of Japan) and approved by the Experimental Animal Care and Use Committee of the University of Miyazaki (Permit Number: 2018–536). Male mice over 2 months of age were used in the experiments. All efforts were made to minimize the number of animals used and their suffering. Mice in each group were randomly selected, and the experimenter was blinded to the mouse genotype.

von Frey test to determine mechanical sensitivity

Mechanical sensitivity was examined by determining the paw withdrawal threshold using an electronic von Frey esthesiometer (IITC Life Science Inc., Woodland Hills, CA, USA) fitted with a polypropylene tip. Each adult mouse was placed in a 10 cm × 10 cm suspended chamber with a metallic mesh floor. After acclimation of mice for 30 min, the polypropylene tip was applied perpendicularly to the plantar surface of the right and left hind paws with sufficient force for 3–4 s. Brisk withdrawal or paw flinching was considered a positive response. The pain threshold was calculated as the mean of three measurements.

Plantar test to determine thermal sensitivity

Thermal sensitivity was examined by measuring paw withdrawal latency in response to noxious thermal stimuli using plantar test (Hargreaves method) units (Ugo Basile SRL, Gemonio VA, Italy). Each mouse was placed on clear glass in an enclosure, and paw withdrawal latency was measured. After a 30-min acclimation period, the heat-emitting projector lamp of the thermal test apparatus was activated, and the beam was directed to the plantar surface of the hind paw. Using a built-in digital timer, the paw withdrawal latency was recorded. The average withdrawal time over five consecutive trials was calculated. A cutoff value of 30 s was used to avoid possible tissue damage.

Light irradiation test to determine paw withdrawal latency

Mice were habituated for 1 h in transparent cubicles (10 cm × 6.5 cm × 6.5 cm) set atop a 5-mm-thick glass floor and separated from each other by opaque dividers. Acute nocifensive behaviors were elicited light from using a pulsing LED light (465 nm blue light and 595 nm yellow light at 10 Hz; Doric Lenses Inc., Quebec, Canada) set at different intensities and aimed at the plantar surface of the hind paw. The light intensity was determined using a light power meter (LPM-100^TM; Bioresearch Center Inc., Aichi, Japan). Since the power meter measures light intensity in units of milliwatts (mW), the light density in units of mW/mm² was calculated by dividing the light intensity by the illuminated area in square millimeters (48 mm²). The mice underwent a total of five trials of 1 s each, with 5-s intervals between the trials. The percentage of trials during which hind paw withdrawal or paw licking occurred was recorded.

OPA test

This test was performed using an OPA system (Bioresearch Center Inc., Nagoya, Japan) [27]. We used a two-chamber system with an entrance connecting each chamber of 20 cm × 24 cm size. The floor of each chamber, one green (530 nm) and the other blue (470 nm), was illuminated with a 20 × 24 array of light-emitting diodes (LEDs). The chambers were uniformly illuminated (10 mW) to prevent the test being affected by the preference mice have for dark environments. After the mice were habituated to the chambers for 10 min with the LEDs turned off, each mouse was allowed to move freely between the two chambers for 10 min with the LEDs turned on. The location of each mouse was recorded using a video camera and analyzed using the BIOBSERVE Viewer 2 software. Next, the lights were switched on, and the position was recorded for 10 min. The percentage of time spent by each mouse in the blue- and green-floored chamber during the 10-min observational period was determined.

RT-PCR

Mice were euthanized using sevoflurane exposure. Next, DRG of each mice genotype were obtained and immediately dissected for further analysis. Briefly, the collected DRG were homogenized, and total cellular RNA was isolated by acid guanidinium thiocyanate-phenol-chloroform extraction using TRIzol™ reagent (Total RNA Isolation Reagent; Invitrogen, Carlsbad, CA, USA). The quality and quantity of the extracted total cellular RNA were assessed by determining the ratio of the optical densities at 260 and 280 nm. The RT reaction was performed using a first-strand cDNA synthesis kit (SuperScript™ II Reverse Transcriptase, Invitrogen) according to the manufacturer’s instructions. We performed PCR amplification using the EmeraldAmp^® MAX PCR Master Mix (TAKARA Bio Inc., Shiga, Japan), 1 μL of cDNA template, and 0.4 μM of both forward and reverse primers in a 20-μL reaction mixture. The target cDNA was amplified according to the PCR protocol consisting of a denaturation step (10 min at 95°C), followed by 27 cycles (10 s at 98°C, 30 s at 55°C, and 60 s at 72°C) for β-actin or 34 cycles (10 s at 98°C, 30 s at 55°C, and 60 s at 72°C) for ChR2, and a final extension step (90 s at 72°C). PCR was performed in a thermal cycler (Veriti™ Thermal Cycler; Thermo Fisher Scientific, Waltham, MA, USA). The PCR products were run on a 2% agarose gel. Subsequently, the bands were visualized using a luminoimage analyzer LAS-4000 (Fujifilm, Tokyo, Japan). We used the following specific primers obtained from Macrogen Global Headquarters (Seoul, Korea); ChR2-Forward: 5′-caatgttactgtgccggatg-3′, ChR2-Reverse: 5′-atttcaatggcgcacacata-3′, β-actin-Forward: 5′-cgtaaagacctctatgccaaca-3′, β-actin-Reverse: 5′-cggactcatcgtactcctgct-3′ [28].

Immunohistochemistry

The mice were anesthetized with sevoflurane. Next, they were intracardially perfused with 50 mL of perfusion buffer, followed by 100 mL of 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS) (pH 7.4) at room temperature for 30 min. DRG were dissected and post-fixed in 4% PFA for 2 h at 4°C, cryoprotected in 30% sucrose in PBS, and incubated overnight at 4°C. Sections of 14-μm thickness were cut from the freeze-fixed DRG with the temperature maintained at –20°C using a cryostat (Leica Biosystems, Nussloch, Germany). For Na_V1.7 staining, sections of DRG were incubated in 0.1% Triton X-100 and 5% goat serum in PBS at room temperature for 4 h, followed by incubation with anti-Na_V1.7 polyclonal antibody (rabbit anti-rat, 1:250; catalog #ASC-008, Alomone Labs, Jerusalem, Israel) at 4°C with overnight agitation. Subsequently, the sections were washed thrice with PBS, following by incubation with goat anti-mouse IgG (H+L) (Alexa Fluor™ 594, 1:500; catalog #ab150120, Abcam, Cambridge, MA, UK) for 1 h at room temperature. S Samples of spinal cord and hindpaw glabrous skin were placed directly on slides and sliced into 30-μm thick sections. These sections were washed, air-dried, and mounted with a coverslip using an antifade mounting medium. The fluorescence of the transgenic ChR2–EYFP on DRG, Spinal cord, and glabrous skin was sufficient to be visualized without immunostaining. The prepared slides were stored at 4°C until further examination. The morphology of the different tissues was analyzed using a BZ-9000 fluorescence microscope (Keyence, Osaka, Japan). Images were processed using ImageJ software (NIH, Bethesda, MD, USA) to optimize brightness and contrast [29].

Statistical analysis

Each behavioral experiment was evaluated n ≥ 10 animals. For the behavioral experiments and RT-PCR, data were analyzed using one-way analysis of variance (ANOVA) followed by Bonferroni post-hoc analysis. The results are presented as mean ± SD. Statistical significance was set at P < 0.05. The statistical software JMP Pro 15 (SAS Institute, Inc., Cary, NC, USA) for Macintosh was used.

Supporting information

S1 Fig. von Frey test and plantar test of Na_V1.7^iCre/iCre and Na_V1.7^iCre/+.

The von Frey test (a) and plantar test (b) were performed with wild-type (WT), Na_V1.7^iCre/iCre, and Na_V1.7^iCre/+ mice. The data were analyzed using one-way ANOVA. All results are calculated as mean ± SD of 10 or more animals. Individual results for each strain are (a) WT (B6J): 4.4 ± 0.7 g, Na_V1.7^iCre/iCre: 4.9 ± 0.8 g, and Na_V1.7^iCre/+: 4.9 ± 0.6 g, (b) WT (B6J): 5.7 ± 0.8 s, Na_V1.7^iCre/iCre: 5.5 ± 1.1 s, and Na_V1.7^iCre/+: 6.0 ± 1.8 s.

https://doi.org/10.1371/journal.pone.0275751.s001

(PPTX)

S2 Fig. Distribution of ChR2-EYFP channels in DRG.

The green fluorescent signal represents the direct fluorescence of ChR2-EYFP. (a) 20× and (b) 40×.

https://doi.org/10.1371/journal.pone.0275751.s002

(PPTX)

S1 Raw images. The original unadjusted and uncropped images of PCR presented in Fig 6A.

https://doi.org/10.1371/journal.pone.0275751.s003

(PDF)

Acknowledgments

This study was conducted in the Department of Anesthesiology, Faculty of Medicine, University of Miyazaki. The authors would like to thank Noriko Hidaka, Kaori Kaji, Ayako Miura, and Hikaru Nakagawa for their technical and secretarial assistance in this study. The authors would like to thank Editage (www.editage.jp) for English language editing.

References

1. Steeds CE. The anatomy and physiology of pain. Surgery (Oxford). 2016;34: 55–59.
- View Article
- Google Scholar
2. Baron R, Binder A, Wasner G. Neuropathic pain: diagnosis, pathophysiological mechanisms, and treatment. Lancet Neurol. 2010;9: 807–819. Pubmed:20650402. pmid:20650402
- View Article
- PubMed/NCBI
- Google Scholar
3. Deisseroth K. Optogenetics. Nat Methods. 2011;8: 26–29. Pubmed:21191368. pmid:21191368
- View Article
- PubMed/NCBI
- Google Scholar
4. Jarrin S, Finn DP. Optogenetics and its application in pain and anxiety research. Neurosci Biobehav Rev. 2019;105: 200–211. Pubmed:31421140. pmid:31421140
- View Article
- PubMed/NCBI
- Google Scholar
5. Tsuda M. New approach for investigating neuropathic allodynia by optogenetics. Pain. 2019;160;Suppl 1: S53-S58. Pubmed:31008850. pmid:31008850
- View Article
- PubMed/NCBI
- Google Scholar
6. Carr FB, Zachariou V. Nociception and pain: lessons from optogenetics. Front Behav Neurosci. 2014;8: 69. Pubmed:24723861. pmid:24723861
- View Article
- PubMed/NCBI
- Google Scholar
7. St John Smith E. Advances in understanding nociception and neuropathic pain. J Neurol. 2018;265: 231–238. Pubmed:29032407. pmid:29032407
- View Article
- PubMed/NCBI
- Google Scholar
8. Ji ZG, Wang H ChR. 2 Transgenic animals in peripheral sensory system: sensing light as various sensations. Life Sci. 2016;150: 95–102.
- View Article
- Google Scholar
9. Tamura R, Nemoto T, Maruta T, Onizuka S, Yanagita T, Wada A, et al. Up-regulation of NaV1.7 sodium channels expression by tumor necrosis factor-α in cultured bovine adrenal chromaffin cells and rat dorsal root ganglion neurons. Anesth Analg. 2014;118: 318–324. Pubmed:24445633. pmid:24445633
- View Article
- PubMed/NCBI
- Google Scholar
10. Wada A. Roles of voltage-dependent sodium channels in neuronal development, pain, and neurodegeneration. J Pharmacol Sci. 2006;102: 253–268. Pubmed:17072104. pmid:17072104
- View Article
- PubMed/NCBI
- Google Scholar
11. Daou I, Tuttle AH, Longo G, Wieskopf JS, Bonin RP, Ase AR, et al. Remote optogenetic activation and sensitization of pain pathways in freely moving mice. J Neurosci. 2013;33: 18631–18640. Pubmed:24259584. pmid:24259584
- View Article
- PubMed/NCBI
- Google Scholar
12. Daou I, Beaudry H, Ase AR, Wieskopf JS, Ribeiro-da-Silva A, Mogil JS, et al. Optogenetic silencing of NaV1.8-positive afferents alleviates inflammatory and neuropathic pain. eNeuro. 2016;3: e0140–15. Pubmed:27022626. pmid:27022626
- View Article
- PubMed/NCBI
- Google Scholar
13. Mizuno-Iijima S, Ayabe S, Kato K, Matoba S, Ikeda Y, Dinh TTH, et al. Efficient production of large deletion and gene fragment knock-in mice mediated by genome editing with Cas9-mouse Cdt1 in mouse zygotes. Methods. 2021;191: 23–31. Pubmed:32334080. pmid:32334080
- View Article
- PubMed/NCBI
- Google Scholar
14. Madisen L, Mao T, Koch H, Zhuo JM, Berenyi A, Fujisawa S, et al. A toolbox of Cre-dependent optogenetic transgenic mice for light-induced activation and silencing. Nat Neurosci. 2012;15: 793–802. Pubmed:22446880. pmid:22446880
- View Article
- PubMed/NCBI
- Google Scholar
15. Wang H, Zylka MJ. Mrgprd-expressing polymodal nociceptive neurons innervate most known classes of substantia gelatinosa neurons. J Neurosci. 2009;29: 13202–13209. Pubmed:19846708. pmid:19846708
- View Article
- PubMed/NCBI
- Google Scholar
16. Li B, Yang XY, Qian FP, Tang M, Ma C, Chiang LY. A novel analgesic approach to optogenetically and specifically inhibit pain transmission using TRPV1 promoter. Brain Res. 2015;1609: 12–20. Pubmed:25797803. pmid:25797803
- View Article
- PubMed/NCBI
- Google Scholar
17. Samineni VK, Yoon J, Crawford KE, Jeong YR, McKenzie KC, Shin G, et al. Fully implantable, battery-free wireless optoelectronic devices for spinal optogenetics. Pain. 2017;158: 2108–2116. Pubmed:28700536. pmid:28700536
- View Article
- PubMed/NCBI
- Google Scholar
18. Beaudry H, Daou I, Ase AR, Ribeiro-da-Silva A, Séguéla P. Distinct behavioral responses evoked by selective optogenetic stimulation of the major TRPV1⁺ and MrgD⁺ subsets of C-fibers. Pain. 2017;158: 2329–2339. Pubmed:28708765. pmid:28708765
- View Article
- PubMed/NCBI
- Google Scholar
19. Stirling LC, Forlani G, Baker MD, Wood JN, Matthews EA, Dickenson AH, et al. Nociceptor-specific gene deletion using heterozygous Na_V1.8-Cre recombinase mice. Pain. 2005;113: 27–36. Pubmed:15621361. pmid:15621361
- View Article
- PubMed/NCBI
- Google Scholar
20. Hillsley K, Lin JH, Stanisz A, Grundy D, Aerssens J, Peeters PJ, et al. Dissecting the role of sodium currents in visceral sensory neurons in a model of chronic hyperexcitability using Na_V1.8 and Na_V1.9 null mice. J Physiol. 2006;576: 257–267. Pubmed:16857712. pmid:16857712
- View Article
- PubMed/NCBI
- Google Scholar
21. Leo S, D’Hooge R, Meert T. Exploring the role of nociceptor-specific sodium channels in pain transmission using Na_V1.8 and Na_V1.9 knockout mice. Behav Brain Res. 2010;208: 149–157. Pubmed:19931571. pmid:19931571
- View Article
- PubMed/NCBI
- Google Scholar
22. Nassar MA, Stirling LC, Forlani G, Baker MD, Matthews EA, Dickenson AH, et al. Nociceptor-specific gene deletion reveals a major role for NaV1.7 (PN1) in acute and inflammatory pain. Proc Natl Acad Sci U S A. 2004;101: 12706–12711. Pubmed:15314237. pmid:15314237
- View Article
- PubMed/NCBI
- Google Scholar
23. Cummins TR, Howe JR, Waxman SG. Slow closed-state inactivation: a novel mechanism underlying ramp currents in cells expressing the hNE/PN1 sodium channel. J Neurosci. 1998;18: 9607–9619. Pubmed:9822722. pmid:9822722
- View Article
- PubMed/NCBI
- Google Scholar
24. Dib-Hajj SD, Yang Y, Black JA, Waxman SG. The NaV1.7 sodium channel: from molecule to man. Nat Rev Neurosci. 2013;14: 49–62. Pubmed:23232607. pmid:23232607
- View Article
- PubMed/NCBI
- Google Scholar
25. Liu C, Cao J, Ren X, Zang W. Na_V1.7 protein and mRNA expression in the dorsal root ganglia of rats with chronic neuropathic pain. Neural Regen Res. 2012;7: 1540–1544. Pubmed:25657691. pmid:25657691
- View Article
- PubMed/NCBI
- Google Scholar
26. Xue Y, Chidiac C, Herault Y, Gaveriaux-Ruff C. Pain behavior in SCN9A (NaV1.7) and SCN10A (NaV1.8) mutant rodent models. Neurosci Lett. 2021;753: 135844. pmid:33775738
- View Article
- PubMed/NCBI
- Google Scholar
27. Iyer SM, Montgomery KL, Towne C, Lee SY, Ramakrishnan C, Deisseroth K, et al. Virally mediated optogenetic excitation and inhibition of pain in freely moving nontransgenic mice. Nat Biotechnol. 2014;32: 274–278. Pubmed:24531797. pmid:24531797
- View Article
- PubMed/NCBI
- Google Scholar
28. Maimon BE, Diaz M, Revol ECM, Schneider AM, Leaker B, Varela CE, et al. Optogenetic peripheral nerve immunogenicity. Sci. Rep. Sci Rep. Sci Rep. 2018;8: 14076. Pubmed:30232391. pmid:30232391
- View Article
- PubMed/NCBI
- Google Scholar
29. Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods. 2012;9: 671–675. Pubmed:22930834. pmid:22930834
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Steeds CE. The anatomy and physiology of pain. Surgery (Oxford). 2016;34: 55–59.
View Article
Google Scholar

[2] View Article

[3] Google Scholar

[ref2] 2. Baron R, Binder A, Wasner G. Neuropathic pain: diagnosis, pathophysiological mechanisms, and treatment. Lancet Neurol. 2010;9: 807–819. Pubmed:20650402. pmid:20650402
View Article
PubMed/NCBI
Google Scholar

[5] View Article

[6] PubMed/NCBI

[7] Google Scholar

[ref3] 3. Deisseroth K. Optogenetics. Nat Methods. 2011;8: 26–29. Pubmed:21191368. pmid:21191368
View Article
PubMed/NCBI
Google Scholar

[9] View Article

[10] PubMed/NCBI

[11] Google Scholar

[ref4] 4. Jarrin S, Finn DP. Optogenetics and its application in pain and anxiety research. Neurosci Biobehav Rev. 2019;105: 200–211. Pubmed:31421140. pmid:31421140
View Article
PubMed/NCBI
Google Scholar

[13] View Article

[14] PubMed/NCBI

[15] Google Scholar

[ref5] 5. Tsuda M. New approach for investigating neuropathic allodynia by optogenetics. Pain. 2019;160;Suppl 1: S53-S58. Pubmed:31008850. pmid:31008850
View Article
PubMed/NCBI
Google Scholar

[17] View Article

[18] PubMed/NCBI

[19] Google Scholar

[ref6] 6. Carr FB, Zachariou V. Nociception and pain: lessons from optogenetics. Front Behav Neurosci. 2014;8: 69. Pubmed:24723861. pmid:24723861
View Article
PubMed/NCBI
Google Scholar

[21] View Article

[22] PubMed/NCBI

[23] Google Scholar

[ref7] 7. St John Smith E. Advances in understanding nociception and neuropathic pain. J Neurol. 2018;265: 231–238. Pubmed:29032407. pmid:29032407
View Article
PubMed/NCBI
Google Scholar

[25] View Article

[26] PubMed/NCBI

[27] Google Scholar

[ref8] 8. Ji ZG, Wang H ChR. 2 Transgenic animals in peripheral sensory system: sensing light as various sensations. Life Sci. 2016;150: 95–102.
View Article
Google Scholar

[29] View Article

[30] Google Scholar

[ref9] 9. Tamura R, Nemoto T, Maruta T, Onizuka S, Yanagita T, Wada A, et al. Up-regulation of NaV1.7 sodium channels expression by tumor necrosis factor-α in cultured bovine adrenal chromaffin cells and rat dorsal root ganglion neurons. Anesth Analg. 2014;118: 318–324. Pubmed:24445633. pmid:24445633
View Article
PubMed/NCBI
Google Scholar

[32] View Article

[33] PubMed/NCBI

[34] Google Scholar

[ref10] 10. Wada A. Roles of voltage-dependent sodium channels in neuronal development, pain, and neurodegeneration. J Pharmacol Sci. 2006;102: 253–268. Pubmed:17072104. pmid:17072104
View Article
PubMed/NCBI
Google Scholar

[36] View Article

[37] PubMed/NCBI

[38] Google Scholar

[ref11] 11. Daou I, Tuttle AH, Longo G, Wieskopf JS, Bonin RP, Ase AR, et al. Remote optogenetic activation and sensitization of pain pathways in freely moving mice. J Neurosci. 2013;33: 18631–18640. Pubmed:24259584. pmid:24259584
View Article
PubMed/NCBI
Google Scholar

[40] View Article

[41] PubMed/NCBI

[42] Google Scholar

[ref12] 12. Daou I, Beaudry H, Ase AR, Wieskopf JS, Ribeiro-da-Silva A, Mogil JS, et al. Optogenetic silencing of NaV1.8-positive afferents alleviates inflammatory and neuropathic pain. eNeuro. 2016;3: e0140–15. Pubmed:27022626. pmid:27022626
View Article
PubMed/NCBI
Google Scholar

[44] View Article

[45] PubMed/NCBI

[46] Google Scholar

[ref13] 13. Mizuno-Iijima S, Ayabe S, Kato K, Matoba S, Ikeda Y, Dinh TTH, et al. Efficient production of large deletion and gene fragment knock-in mice mediated by genome editing with Cas9-mouse Cdt1 in mouse zygotes. Methods. 2021;191: 23–31. Pubmed:32334080. pmid:32334080
View Article
PubMed/NCBI
Google Scholar

[48] View Article

[49] PubMed/NCBI

[50] Google Scholar

[ref14] 14. Madisen L, Mao T, Koch H, Zhuo JM, Berenyi A, Fujisawa S, et al. A toolbox of Cre-dependent optogenetic transgenic mice for light-induced activation and silencing. Nat Neurosci. 2012;15: 793–802. Pubmed:22446880. pmid:22446880
View Article
PubMed/NCBI
Google Scholar

[52] View Article

[53] PubMed/NCBI

[54] Google Scholar

[ref15] 15. Wang H, Zylka MJ. Mrgprd-expressing polymodal nociceptive neurons innervate most known classes of substantia gelatinosa neurons. J Neurosci. 2009;29: 13202–13209. Pubmed:19846708. pmid:19846708
View Article
PubMed/NCBI
Google Scholar

[56] View Article

[57] PubMed/NCBI

[58] Google Scholar

[ref16] 16. Li B, Yang XY, Qian FP, Tang M, Ma C, Chiang LY. A novel analgesic approach to optogenetically and specifically inhibit pain transmission using TRPV1 promoter. Brain Res. 2015;1609: 12–20. Pubmed:25797803. pmid:25797803
View Article
PubMed/NCBI
Google Scholar

[60] View Article

[61] PubMed/NCBI

[62] Google Scholar

[ref17] 17. Samineni VK, Yoon J, Crawford KE, Jeong YR, McKenzie KC, Shin G, et al. Fully implantable, battery-free wireless optoelectronic devices for spinal optogenetics. Pain. 2017;158: 2108–2116. Pubmed:28700536. pmid:28700536
View Article
PubMed/NCBI
Google Scholar

[64] View Article

[65] PubMed/NCBI

[66] Google Scholar

[ref18] 18. Beaudry H, Daou I, Ase AR, Ribeiro-da-Silva A, Séguéla P. Distinct behavioral responses evoked by selective optogenetic stimulation of the major TRPV1⁺ and MrgD⁺ subsets of C-fibers. Pain. 2017;158: 2329–2339. Pubmed:28708765. pmid:28708765
View Article
PubMed/NCBI
Google Scholar

[68] View Article

[69] PubMed/NCBI

[70] Google Scholar

[ref19] 19. Stirling LC, Forlani G, Baker MD, Wood JN, Matthews EA, Dickenson AH, et al. Nociceptor-specific gene deletion using heterozygous Na_V1.8-Cre recombinase mice. Pain. 2005;113: 27–36. Pubmed:15621361. pmid:15621361
View Article
PubMed/NCBI
Google Scholar

[72] View Article

[73] PubMed/NCBI

[74] Google Scholar

[ref20] 20. Hillsley K, Lin JH, Stanisz A, Grundy D, Aerssens J, Peeters PJ, et al. Dissecting the role of sodium currents in visceral sensory neurons in a model of chronic hyperexcitability using Na_V1.8 and Na_V1.9 null mice. J Physiol. 2006;576: 257–267. Pubmed:16857712. pmid:16857712
View Article
PubMed/NCBI
Google Scholar

[76] View Article

[77] PubMed/NCBI

[78] Google Scholar

[ref21] 21. Leo S, D’Hooge R, Meert T. Exploring the role of nociceptor-specific sodium channels in pain transmission using Na_V1.8 and Na_V1.9 knockout mice. Behav Brain Res. 2010;208: 149–157. Pubmed:19931571. pmid:19931571
View Article
PubMed/NCBI
Google Scholar

[80] View Article

[81] PubMed/NCBI

[82] Google Scholar

[ref22] 22. Nassar MA, Stirling LC, Forlani G, Baker MD, Matthews EA, Dickenson AH, et al. Nociceptor-specific gene deletion reveals a major role for NaV1.7 (PN1) in acute and inflammatory pain. Proc Natl Acad Sci U S A. 2004;101: 12706–12711. Pubmed:15314237. pmid:15314237
View Article
PubMed/NCBI
Google Scholar

[84] View Article

[85] PubMed/NCBI

[86] Google Scholar

[ref23] 23. Cummins TR, Howe JR, Waxman SG. Slow closed-state inactivation: a novel mechanism underlying ramp currents in cells expressing the hNE/PN1 sodium channel. J Neurosci. 1998;18: 9607–9619. Pubmed:9822722. pmid:9822722
View Article
PubMed/NCBI
Google Scholar

[88] View Article

[89] PubMed/NCBI

[90] Google Scholar

[ref24] 24. Dib-Hajj SD, Yang Y, Black JA, Waxman SG. The NaV1.7 sodium channel: from molecule to man. Nat Rev Neurosci. 2013;14: 49–62. Pubmed:23232607. pmid:23232607
View Article
PubMed/NCBI
Google Scholar

[92] View Article

[93] PubMed/NCBI

[94] Google Scholar

[ref25] 25. Liu C, Cao J, Ren X, Zang W. Na_V1.7 protein and mRNA expression in the dorsal root ganglia of rats with chronic neuropathic pain. Neural Regen Res. 2012;7: 1540–1544. Pubmed:25657691. pmid:25657691
View Article
PubMed/NCBI
Google Scholar

[96] View Article

[97] PubMed/NCBI

[98] Google Scholar

[ref26] 26. Xue Y, Chidiac C, Herault Y, Gaveriaux-Ruff C. Pain behavior in SCN9A (NaV1.7) and SCN10A (NaV1.8) mutant rodent models. Neurosci Lett. 2021;753: 135844. pmid:33775738
View Article
PubMed/NCBI
Google Scholar

[100] View Article

[101] PubMed/NCBI

[102] Google Scholar

[ref27] 27. Iyer SM, Montgomery KL, Towne C, Lee SY, Ramakrishnan C, Deisseroth K, et al. Virally mediated optogenetic excitation and inhibition of pain in freely moving nontransgenic mice. Nat Biotechnol. 2014;32: 274–278. Pubmed:24531797. pmid:24531797
View Article
PubMed/NCBI
Google Scholar

[104] View Article

[105] PubMed/NCBI

[106] Google Scholar

[ref28] 28. Maimon BE, Diaz M, Revol ECM, Schneider AM, Leaker B, Varela CE, et al. Optogenetic peripheral nerve immunogenicity. Sci. Rep. Sci Rep. Sci Rep. 2018;8: 14076. Pubmed:30232391. pmid:30232391
View Article
PubMed/NCBI
Google Scholar

[108] View Article

[109] PubMed/NCBI

[110] Google Scholar

[ref29] 29. Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods. 2012;9: 671–675. Pubmed:22930834. pmid:22930834
View Article
PubMed/NCBI
Google Scholar

[112] View Article

[113] PubMed/NCBI

[114] Google Scholar

Figures

Abstract

Introduction

Results

Development of original NaV1.7–iCre (NaV1.7iCre/+) knock-in mice

Development of NaV1.7-ChR2 mice genotypes

Normal nocifensive behavior associated with mechanical and thermal stimuli was exhibited by the four genotypes

Differences among the four genotypes in behavior associated with optogenetic stimulation

Expression of ChR2 in DRG of mice of the four genotypes

Discussion

Methods

Animals

von Frey test to determine mechanical sensitivity

Plantar test to determine thermal sensitivity

Light irradiation test to determine paw withdrawal latency

OPA test

RT-PCR

Immunohistochemistry

Statistical analysis

Supporting information

S1 Fig. von Frey test and plantar test of NaV1.7iCre/iCre and NaV1.7iCre/+.

S2 Fig. Distribution of ChR2-EYFP channels in DRG.

S1 Raw images. The original unadjusted and uncropped images of PCR presented in Fig 6A.

Acknowledgments

References

Development of original Na_V1.7–iCre (Na_V1.7^iCre/+) knock-in mice

Development of Na_V1.7-ChR2 mice genotypes

S1 Fig. von Frey test and plantar test of Na_V1.7^iCre/iCre and Na_V1.7^iCre/+.