Figures
Abstract
In sex determination of the crustacean Daphnia magna, male-specific expression of DM-domain transcription factor Doublesex1 (Dsx1) orchestrates the male developmental program triggered by environmental stimuli. We previously identified the CELF1 ortholog as a candidate of proteins associated with the 5’ UTR of the Dsx1α isoform. Here we report the CELF1-dependent suppression of Dsx1 expression in D. magna. During embryogenesis, CELF1 expression was not sexually dimorphic. Silencing of CELF1 led to the activation of Dsx1 expression both in female and male embryos. Overexpression of CELF1 in male embryos resulted in a reduction of Dsx1 expression. By these manipulations of CELF1 expression, the Dsx1 transcript level was not significantly changed. To investigate whether the CELF1 controls Dsx1 expression via its 5’ UTR, we injected the GFP reporter mRNA having intact Dsx1α 5’ UTR or mutated one lacking the GU-rich element (GRE) that is known as a binding site of the CELF1 ortholog. We found that deletion of the GRE significantly increased the reporter gene expression. These results indicate that CELF1 suppresses Dsx1 expression both in females and males, possibly at the post-transcriptional level. We speculate that CELF1 may avoid unintended Dsx1 expression and generation of sexual ambiguity by setting a threshold of Dsx1 expression.
Citation: Tirta YK, Adachi S, Perez CAG, Adhitama N, Nong QD, Natsume T, et al. (2022) CELF1 represses Doublesex1 expression via its 5’ UTR in the crustacean Daphnia magna. PLoS ONE 17(10): e0275526. https://doi.org/10.1371/journal.pone.0275526
Editor: Christoph Englert, Leibniz Institute on aging - Fritz Lipmann Institute (FLI), GERMANY
Received: June 29, 2022; Accepted: September 19, 2022; Published: October 14, 2022
Copyright: © 2022 Tirta et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the paper and its Supporting information files.
Funding: This study is supported by the Japan Science Promotion Society (JSPS), Japan (https://www.jsps.go.jp/english/) in the form of grants (grant numbers 22H05598, 20H04923, 19H05423, 18H04884, 17H05602) awarded YK and (grant numbers 18H04619, 17K19236, 17H01880) awarded to HW. Y.K.T would like to acknowledge the Ministry of Education, Culture, Sports, Science and Technology (MEXT) for providing financial support under the Monbukagakusho/MEXT scholarship. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
In favourable conditions, the freshwater crustacean Daphnia magna produces only females by parthenogenesis. In contrast, under a stressed environment such as shortened photoperiod, a lack of food, and/or increased population density, D. magna produces male offspring that are genetically identical to females [1, 2]. The environmental cues for male determination stimulate the neuroendocrine system and secrete sesquiterpenoid, which promotes the production of parthenogenetic eggs that are destined to develop into males [3, 4]. The male developmental program is implemented by the male-specific expression of the DM-domain containing transcription factor named Doublesex1 (Dsx1) [5]. Ectopic expression of Dsx1 in females could lead to sexual ambiguity [5, 6]. Since the intersex of Daphnia is rare in nature, there would be robust regulation of the endogenous Dsx1 expression. The Dsx1 gene produces two isoforms, α and β, which differ only in the 5’ UTR [5]. Previously, we investigated the proteins bound to the 5’ UTR of the Dsx1α isoform and identified CUGBP1 protein as one of the associated protein candidates [7]. However, its role in the Dsx1 regulation remains unknown.
CUGBP1 is an RNA-binding protein harboring three RNA recognition motifs (RRMs) that belongs to the CUGBP family. This protein family is conserved within the animal kingdoms and is composed of six paralogs in mammals, three paralogs known as Bruno or Arrest in Drosophila melanogaster, and two paralogs named as ETR-1 and UNC-75 in Caenorhabditis elegans [8]. Recently, these different nomenclatures among organisms are unified into CUG binding protein, ELAV-like Family member (CELF) [8]. This protein family is primarily divided into two subfamilies, CELF1-2 and CELF3-6, based on the unique linker sequence between RRM2 and RRM3 [9]. CELF family controls gene expression at a post-transcriptional level by binding not only to the CUG repeat element [10] but also to the GU-rich element (GRE) in the target mRNA [11–13]. In humans, CELF1 activates and inhibits the p21 and p27 expression by binding to the 5’ UTRs of those mRNAs, respectively [14, 15]. In invertebrates, there has been no report of CELF ortholog function via the 5’ UTRs of the target mRNAs. In this study, we renamed D. magna CUGBP1 ortholog as CELF1 and analyzed its function in Dsx1 regulation. Our results demonstrate that the CELF1 suppresses the Dsx1 expression via its 5’ UTR.
Results
Sequence conservation of D. magna CELF1 ortholog
We previously identified an ortholog of human CUG binding protein 1 (CUGBP1) as a candidate protein that binds to Dsx1α 5’ UTR [7]. In this study, we renamed D. magna CUGBP1 ortholog as CELF1. D. magna CELF1 consists of 593 amino acid residues and harbors three RNA recognition motifs (Fig 1A, S1–S3 Figs). We analyzed the phylogenetic relationship of the D. magna CELF1 ortholog using amino acid sequences of CELF proteins from various animal species (S1 Table). We confirmed that D. magna CELF1 belongs to the CELF1-2 subfamily (Fig 1B). Sequence conservation of D. magna CELF1 suggests that this protein may function as a post-transcriptional regulator.
(A) Three conserved RNA Recognition motifs (RRMs) of CELF1 in various species. A unique sequence of the divergent domain is located between RRM2 and RRM3. (B) Phylogenetic tree of CELF family protein separates species group; Red square: D. magna CELF1. The bootstrap values of 1000 replicates were shown next to the branches. The bar indicates branch length and corresponds to the mean number of the differences (P<0.05) per residue along each branch. Evolutionary distances were computed using the p-distance method.
CELF1 expression is not sexually dimorphic during embryogenesis
The potential association between CELF1 and the Dsx1α 5’ UTR suggests that CELF1 might be involved in regulating Dsx1 expression. Since the sexual regulators often show sex-biased gene expression, we investigated the sexual differences in the temporal expression of D. magna CELF1 at several embryonic developmental stages. The expression level of CELF1 increased following the embryogenesis stages. However, CELF1 expression did not show sexual dimorphism at any time points during embryogenesis (Fig 2), which suggests CELF1 functions both in males and females.
D. magna CELF1 expression level in embryonic developmental stages. Results were shown in relative expression levels normalized with the ribosomal protein L32. hpo, hours post-ovulation. Error bars indicate the standard error of the mean, and the Student’s T-test between both sexes shows no significant difference. N = 3.
CELF1 silencing enhanced the Dsx1 expression in D. magna embryos
To investigate the role of the CELF1 ortholog in D. magna, we silenced CELF1 expression via RNA interference (RNAi) [16]. First, we injected 300 μM of CELF1-specific siRNA (siCELF1) into female eggs from the wild-type of D. magna. Of the ten injected eggs, 90% (9/10) stopped development before 48 hours post-ovulation, a timing when clear sexual dimorphism in Dsx1 expression and organ formation appears. On the other hand, injection of 100 μM siCELF1 decreased the ratio of the non-viable samples down to 25% (9/36). Based on this result, we decided to use 100 μM siCELF1 to investigate the CELF1 function on the sexual development of D. magna. To examine the role of CELF1 in Dsx1 regulation, we used the Dsx1 reporter strain (also named Line-B) [17]. This transgenic line has the mCherry gene inserted at the position of the Dsx1 start codon in one allele resulting in a mCherry expression under the control of endogenous Dsx1 promotor/enhancer. Line-B develops male-specific traits similar to the wild-type because another Dsx1 allele is intact. This transgenic line also harbors the H2B-eGFP gene under the control of the elongation factor 1α-1 (EF1α-1) promotor/enhancer. It allows us to visualize the localization of each cell and map the internal structure of D. magna [18].
In female embryos, CELF1 downregulation led to mCherry fluorescence except for the sexually dimorphic traits (Fig 3A and 3B, female) and did not induce sex reversal. The mCherry fluorescence was most visible in the yolk region of female embryos (Fig 3A-yellow dashed line). To investigate the effects of CELF1 downregulation in male embryos, we collected eggs committed to males by exposing the Line-B mother to fenoxycarb during a critical stage of oocyte development [5, 19]. siCELF1 injection into male eggs increased mCherry fluorescence up to 1.5-fold ubiquitously (Fig 3A and 3B, male). Increased mCherry expression was observed in the whole body, including male-specific tissues (Fig 3A, male), such as the first antennae and the first thoracic appendage [31].
(A) Lateral view of female and male embryos of Dsx1 reporter strain injected with siCELF1 and siControl observed 48 h post-injection. mCherry fluorescence mirroring Dsx1 expression and GFP fluorescence allows internal structure mapping. The merged image helps to visualize mCherry expression localization. An1: first antennae, T1: first thoracic appendage, yellow dashed lines: yolk region. (B) Relative mCherry fluorescence of siControl and siCELF1 injected samples in female (red) and male (blue) embryos. Error bars indicate the standard error of the mean. N = 12 (C-D) Gene transcript level of siCELF1 and siControl injected samples in female (red) and male (blue) 48h post-injection for (C) Dsx1 and (D) CELF1. RT-qPCR results were shown as relative expression levels to control normalized with the expression level of the ribosomal protein L32. Error bars indicate the standard error of the mean. *p<0.05, ***p<0.001, ns: not significant (Student’s T-test). N = 3.
To investigate whether silencing of the CELF1 changed the Dsx1 mRNA level or not, we examined the Dsx1 expression in the siCELF1-injected embryos by the RT-qPCR. siCELF1 injection reduced the target CELF1 mRNA level (Fig 3D). However, in contrast to the mCherry fluorescence (Fig 3B), the Dsx1 transcript levels showed no significant difference between CELF1 RNAi and control embryos (Fig 3C). This result suggests a possibility of Dsx1 post-transcription regulation by CELF1.
Overexpression of CELF1 suppressed Dsx1 expression in D. magna male embryos
To further investigate the suppression activity of CELF1 in Dsx1 expression, we injected in vitro transcribed CELF1 mRNA into Line-B eggs destined to develop into males. The mCherry fluorescence recapitulating Dsx1 expression was reduced significantly in the whole body (Fig 4A). mCherry fluorescence intensity was significantly reduced to 0.6-fold in CELF1 mRNA-injected embryos compared to GFP mRNA-injected embryos at 48 h post-injection (Fig 4B). No visible defect was observed at 48 h after CELF1 mRNA injection. In contrast to the significant change of mCherry fluorescence intensity by CELF1 overexpression, there were no significant differences in Dsx1 transcript levels between CELF1 mRNA and GFP mRNA-injected embryos (Fig 4C).
(A) Female and male embryos of Dsx1 reporter strain variant without H2B-GFP expression injected with any of CELF1 and GFP mRNA, observed at 48 h (lateral view) post-injection. mCherry fluorescence mirroring Dsx1 expression and Bright field images helps understand the localization of mCherry expression. An1: first antennae, T1: first thoracic appendage. (B) Relative mCherry fluorescence of male embryos injected with any of CELF1 mRNA and GFP mRNA at 48 h post-injection. Error bars indicate the standard error of the mean. N = 12 (C) Dsx1 transcript level of male embryos injected with any of CELF1 mRNA and GFP mRNA at 48 h post-injection. RT-qPCR results were shown as relative expression levels to control normalized with the expression of the ribosomal protein L32. Error bars indicate the standard error of the mean. ***p<0.001, ns: not significant (Student’s T-test). N = 3.
CELF1 repressed Dsx1 expression via the GU-rich element of the Dsx1α 5’ UTR in embryos
We investigated if a potential binding site of CELF1 exists in Dsx1α 5’ UTR of D. magna. Four CELF1 binding sites from C. elegans, D. melanogaster, and Gallus gallus were used to search for an over-represented CELF1 binding motif (S2 Table). We found that the (UG)9 motif was over-represented in all four sequences and Dsx1α 5’ UTR (Fig 5A). The previous studies also reported GU-rich Element (GRE) as the preferred binding site of CELF1/2 [11, 12].
(A) GRE consensus sequences and mutated Dsx1α 5’ UTR construct with 18 bp deletion of potential CELF1 binding site. (B) Relative GFP fluorescence increase of GFP reporter mRNA injected samples in female embryos at 24h post-injection. Error bars indicate the standard error of the mean. ***p<0.001 (Student’s T-test). N = 12. (C) Female embryos of wild-type D. magna injected with GFP reporter mRNA with or without mutated Dsx1α 5’ UTR were observed at 24h (ventral view). In addition, the translation efficiency of GFP reporter mRNA was also observed in the presence of D. magna CELF1 overexpression. GFP fluorescence mirroring the ectopic Dsx1 translation.
To examine whether GRE in the Dsx1α 5’ UTR was involved in CELF1-dependent repression of the Dsx1 expression, we injected GFP mRNA harboring Dsx1α 5’ UTR with or without the GRE into wild-type female embryos (Fig 5A, intact GRE reporter and deleted GRE reporter). We found that the deleted GRE reporter led to a higher intensity of GFP signal up to 1.5-fold compared to the intact GRE reporter. When we coinjected the intact GRE reporter mRNA with the CELF1 mRNA, the GFP signal was decreased to 0.5-fold compared to samples without CELF1 overexpression (Fig 5B and 5C). These results suggest that CELF1 possibly controls Dsx1 expression via the GRE.
Discussion
The crustacean D. magna lacks sex chromosomes and utilizes environmental cues for sex determination. D. magna produces only female offspring in favorable conditions. In contrast, environmental cues stimulate male production [1, 2]. Previous studies revealed that environmental cues are converted into sesquiterpenoid signaling and activate the Dsx1 gene [3, 4]. This gene codes for the DM-domain transcription factor and orchestrates the male-developmental program [5]. Manipulation of Dsx1 expression and activity in females leads to the generation of intersex phenotype [5], demonstrating that the Dsx1 gene must be tightly silenced in females throughout development, and it would be upregulated precisely in a spatio-temporal manner for male production. Thus, unraveling the regulatory mechanism of Dsx1 expression is essential for understanding how sex is determined in this species. In this study, we investigated the function of the RNA binding protein CELF1, which was identified as one of the proteins associated with the 5’ UTR of the Dsx1α isoform [7].
CELF1 has been reported to target sex-determining and development genes across many species. First, as an alternative splicing factor, CELF1 works synergistically with Lark protein orthologs to promote male-specific splicing of B. mori Dsx [20]. Second, as an mRNA destabilizing factor, it works antagonistically with Ol-bsf to reduce Medaka fish sex-determining gene dmrt1bY expression and hinder male gonad development [21]. Third, as a translational repressor, CELF1 (Bru) represses the master sex-determining gene Sxl in Drosophila, promoting the male dosage compensation and somatic differentiation cascade [22, 23]. In addition, CELF1 has a critical role in controlling gonadal development in the fruit fly, mice, and nematode [24–27]. During evolution, CELF1 might be repeatedly used in the animal sex-determining pathways.
We found that CELF1 functions as a post-transcriptional repressor of the D. magna Dsx1 gene. Our result showed that CELF1 repressed Dsx1 expression possibly via binding to the GU-rich element (GRE) of the Dsx1α 5’ UTR. GRE is known to be a predominant binding site of CELF1 [11–13]. This protein binds to the 5’ UTR of p21 and C/EBPβ mRNA in human cancer cells, enhancing their translation efficiency [28, 29]. On the contrary, CELF1 functions as a negative translation regulator via binding to the 5’ UTR of p21 mRNA in the mouse lens cell line [14] and p27 mRNA in the breast cancer cell [21]. Since (1) Dsx1 transcript level did not change by CELF1 silencing and overexpression and (2) deletion of GRE from the Dsx1α 5’ UTR increased its GFP reporter expression, it may be possible that CELF1 may suppress Dsx1 translation via its 5’ UTR.
During embryogenesis, CELF expression did not show any sexual dimorphism. In addition, in both sexes, CELF1 silencing de-repressed Dsx1 expression. The Dsx1 expression increase only in male 6 hours after ovulation and is localized in the sexually dimorphic organs such as the first antennae, first thoracic appendage, and gonads [5]. In the knockdown females, Dsx1 expression was observed in the yolk region and was not detected in the sexually dimorphic traits such as the first antennae suggesting CELF1 is important but insufficient. This result may explain the absence of sex reversal in females. Further loss-of-function experiment to observe the sex reversal was not possible due to CELF1 affecting the embryo’s viability. Overexpression of CELF1 in male embryos reduced mCherry fluorescence, and the importance of the GRE element for repression of Dsx1α expression was successfully evaluated in female embryos. Based on these data, CELF1 possibly has the ability to repress Dsx1 expression both in females and males.
The non-sex-specific role of CELF1 on Dsx1 repression could provide insight into the CELF1 function to set the threshold of Dsx1 expression. In females, Dsx1 protein from noisy expression may bind to the potential Dsx1 binding site upstream of the Dsx1α transcription start site [6] and self-activate its expression via a positive feedback loop. CELF1 might avoid unintended Dsx1 translation and subsequently eliminates the generation of sexual ambiguity in females. Since Dsx1 protein is expressed in a tissue and time-specific manner in males [17], it would be possible that CELF1 contributes precise control of Dsx1 activation in males. In this model, we must include the RNA binding protein Shep and long noncoding RNA (lncRNA) named DAPALR [7, 30]. Shep also represses Dsx1 translation by binding to the Dsx1α 5’ UTR, and DAPALR is an endogenous competing RNA that sequestered Shep. Further studies to prove this model are needed in the future, which in turn may allow us to recognize an elegant control of sex determination in D. magna.
Conclusion
Our results demonstrate the molecular function of CELF1 in the repression of the male-determining gene Dsx1 expression in vivo. This function may contribute to avoiding sexual ambiguity in females and achieving spatio-temporal expression in males. We anticipate that this work will be a basis for understanding the regulatory mechanism of Dsx1 expression in D. magna with the environmental sex-determination system.
Materials and methods
Daphnia magna stains and transgenic lines cultures
The wild-type (WT) and the transgenic lines used in this study share the same genetic background (NIES clone). They were cultured in AdaM medium [31] as previously described [5]. The RNAi experiment used a Dsx1-reporter strain with the mCherry ORF introduced upstream of the Dsx1 coding sequence [17]. This line also has eGFP fused to histone H2B gene under the control of the elongation factor 1α-1 promotor/enhancer. Line B minus, a variant of this strain without H2B-eGFP expression [7], was also used for the ectopic expression experiment. Male Daphnia was obtained by exposing female Daphnia (2-3- weeks old) to 1 μg/L of the synthetic juvenile hormone analog, Fenoxycarb (Wako Pure Chemical, Osaka, Japan) [5].
Phylogenetic analysis of the D. magna CELF1 gene
Amino acid sequences of CELF family proteins were obtained from the NCBI database (http://www.ncbi.nlm.nih.gov/) as shown in S1 Table. Each protein’s whole amino acid or RRMs sequences were subjected to multiple sequence alignment and used to construct the phylogenetic tree. Based on the amino acid sequences, multiple sequence alignments were constructed using the Clustal W in MEGA version 10.0.5 [32]. The following settings were used for the analysis: pairwise alignment parameters: gap opening penalty = 10.00, gap extension penalty = 0.1, and identity protein weight; matrix multiple alignment parameters: gap opening penalty = 10.00, gap extension penalty = 0.20, and delay divergent cut-off = 30%. The phylogenetic reconstruction was performed using the p-distance algorithm and the neighbor-joining method implemented in MEGA.
Microinjection
Foreign material injection into Daphnia eggs was performed using an established protocol [16]. Freshly ovulated eggs from 2–3 weeks old Daphnia mothers were obtained using microdissection and transferred into an ice-chilled M4 medium [33] containing 80 mM sucrose (M4-sucrose). For the injection solution, 2 mM Lucifer Yellow (Invitrogen, Carlsbad CA, USA) was mixed as an injection marker for each experiment. Following 1 hour after microinjection, survived eggs were transferred into each well of 96-well plates with 100 μL of M4-sucrose medium and were kept in an incubator at 23°C.
CELF1 RNAi in embryos
Small interference RNAs were designed using the website Block-iT RNAi Designer at https://rnaidesigner.thermofisher.com/rnaiexpress/. The sequence of this siRNA is as follows: siCELF1 (5’- GCAATGAGCGTAAACTCTT -3’). As a negative control, siRNA targeting a random sequence that does not affect the Daphnia development was used: siControl (5’- GGUUAAGCCGCCUCACAUTT-3’) [34]. The siRNA oligonucleotides were dissolved in DNase/RNase-free water (Life Technologies Inc.; Grand Island, NY, USA). Two nucleotides dTdT were added to each 3′ end of the siRNAs. The siRNAs were diluted with the injection marker 2 mM Lucifer Yellow dye (Invitrogen, Carlsbad CA, USA) to have the final concentration of 100 μM or 300 μM. The injection cocktails were injected into female or male eggs of the Dsx1-reporter strain Daphnia. Samples were then observed at 24 h after injection and collected at 48 h for RNA extraction and cDNA synthesis as previously described [30].
CELF1 overexpression in embryos
To create chimeric CELF1 mRNA, CELF1 CDS was amplified by PCR using synthesized cDNA derived from NIES strain RNA extraction. Then, CELF1 CDS was subcloned into a pCS2 vector harboring the T7 polymerase promoter, EF1α1 5′ UTR, and 3’ UTR derived from the chimeric DsRed2 mRNA expression plasmid construct [35] using GeneArt Seamless Cloning and Assembly Enzyme Mix (Invitrogen, Carlsbad CA, USA). The plasmid construct was named pEF1α1-CELF1. For control mRNA preparation, the CELF1 CDS of pEF1α1-CELF1was then replaced with the CDS of GFP using seamless cloning. The GFP region was amplified from the 4xEcRE-H2B-GFP plasmid [36].
To prepare the GFP reporter mRNA harboring Dsx1α 5′ UTR, pEX-Dsx1 5′ UTR::GFP [7] was used as a template for mRNA synthesis. This plasmid was used as a template to delete the potential CELF1 binding site using the primer set as follows: Forward (5’- TCCCCTTCGTTTTCGTTGACGTTTTCATTTCCA-3’) and Reverse (5’- AAATGAAAACGTCAACGAAAACGAAGGGGAAAT-3’) resulting in the generation of pEX-Dsx1 5′ UTR GRE mutant::GFP. For internal control, the CELF1 CDS of pEF1α1-CELF1 was then replaced with the CDS of mCherry using seamless cloning to produce pRCS21-EF1α-1-mCherry, which was used to synthesize EF1α-1-mCherry mRNA as a template. The mCherry region was amplified from the bicistronic reporter plasmid in the previous study [37].
In vitro transcription and poly(A) tail addition were performed with mMESSAGE mMACHINE T7 RNA Polymerase and Poly(A) Tailing kits, respectively (both Ambion, Foster City, CA, USA). The synthesized RNA size and the attached poly(A) tail length were analyzed by denaturing formaldehyde gel electrophoresis.
CELF1 ectopic expression was performed by injecting 3200 ng/ul CELF1 mRNA mixed with 2 mM Luciferase Yellow dye into Line-B variant eggs without endogenous GFP fluorescence called Line-B minus [7]. These eggs were induced to be male before injection, as mentioned above. The sample was observed under a fluorescent microscope to measure the mCherry fluorescence and collected for total RNA extraction at 48 h. For GFP reporter assay, 40 ng/ul Dsx1 5′ UTR::GFP reporter mRNA with or without GRE was coinjected with 40 ng/ul mCherry mRNA into wild-type female eggs. The sample was observed under a fluorescent microscope to measure GFP fluorescence at 24 h.
Total RNA extraction and cDNA synthesis
Total RNA was extracted using Sepasol-RNAI solution (Nacalai Tesque; Kyoto, Japan) according to the manufacturer’s protocol and followed by phenol/chloroform purification. The purified total RNA was subjected to cDNA synthesis using random primers (Invitrogen; Carlsbad, CA, USA) and the SuperScriptIII Reverse Transcriptase (Invitrogen) according to the manufacturer’s recommended protocol.
Quantitation of the fluorescence
Injected sample photos were taken using Leica DC500 CCD Digital Camera mounted on a Leica M165FC fluorescence microscope (Leica Microsystem, Mannheim, Germany). Fluorescence photography was done using GFP2 and mCherry filters under the following conditions: 1.0 s exposure time, 3.0x gain, 1.0 saturation, and 1.0 gamma for GFP and 2.0 s exposure time, 8.0x gain, 1.0 saturation, and 1.6 gammas for mCherry. The fluorescence intensities were calculated using ImageJ software, following the calculation protocol from a previous study [35]. The measurement of background fluorescence normalized the total embryo fluorescence of each sample. Relative Fluorescence Intensity (RFI) was calculated following the protocol of a previous study [7].
Quantitative RT-PCR
The temporal changes in CELF1 expression level during embryogenesis were analyzed using previously synthesized cDNA [6] from male and female Daphnia at different time points (0, 6, 12, 18, 24, 30, 48, and 72 h after ovulation). Each cDNA was subjected to RT-qPCR using CELF1 specific primer set as follows: Forward (5’- CGGCATCCAGCAATTCACTAC-3’) and Reverse (5’- CGTCACACTTCCACCACCAC-3’). To check the expression level changes of the genes of interest (CELF1 and Dsx1) between the siControl- and siCELF1-injected samples or GFP mRNA- and CELF1 mRNA-injected samples, cDNA from 48-hour embryos were subjected to RT-qPCR. The expression level of CELF1 and Dsx1 in RNAi or overexpression experiments were prepared as three replicates for RT-qPCR. mRNA transcripts were measured using StepOnePlus™ Real-Time PCR System (Agilent Technologies), Power SYBR Green qPCR Mastermix (Invitrogen, Carlsbad CA, USA), and a specific primer designed to amplify <150 bp PCR products under the following conditions: 95°C for 10 min, 40 cycles of 95°C for 15 sec and 60°C for 1 min, and last amplification round of 95°C for 1 min, 55°C for 30 sec, and 95°C for 30 sec. Dsx1 specific primer set sequence were designed as follow: Forward (5’- AAGTTTGGTGTAGGGGAGGATGAG -3’) and Reverse (5’- CCATTCATCATTACCAAATCCCTTC -3’). Expressions based on the Ct value during amplification were calculated and normalized by quantitating the expression level of ribosomal protein gene L32 [38]. Finally, dissociation curve analysis and gel electrophoresis were performed to confirm the correct amplicon size and the absence of non-specific bands.
Supporting information
S1 Fig. Multiple sequence alignments of CELF1 RRM1 orthologs.
Conserved amino residues with identical or similar characteristics were colored by the ClustalX color scheme. Dashes indicate gaps in the alignment. Numbers represent amino acid positions.
https://doi.org/10.1371/journal.pone.0275526.s001
(TIF)
S2 Fig. Multiple sequence alignments of CELF1 RRM2 orthologs.
Conserved amino residues with identical or similar characteristics were colored by the ClustalX color scheme. Dashes indicate gaps in the alignment. Numbers represent amino acid positions.
https://doi.org/10.1371/journal.pone.0275526.s002
(TIF)
S3 Fig. Multiple sequence alignments of CELF1 RRM3 orthologs.
Conserved amino residues with identical or similar characteristics were colored by the ClustalX color scheme. Dashes indicate gaps in the alignment. Numbers represent amino acid positions.
https://doi.org/10.1371/journal.pone.0275526.s003
(TIF)
S1 Table. Nomenclature and CELF family orthologs.
https://doi.org/10.1371/journal.pone.0275526.s004
(DOCX)
S2 Table. Target sequences of CELF1 orthologs.
https://doi.org/10.1371/journal.pone.0275526.s005
(DOCX)
References
- 1. Hebert PDN. The Population Biology of Daphnia (Crustacea, Daphnidae). Biol Rev. 1978 Aug;53(3): 387–426.
- 2. Lubbock J. An account of the two methods of reproduction in Daphnia, and of the structure of the ephippium. Philos Trans R Soc Lond 1857;147: 79–100.
- 3. LeBlanc GA, Medlock EK. Males on demand: the environmental-neuro-endocrine control of male sex determination in daphnids. FEBS J. 2015;282(21): 4080–93. pmid:26237283
- 4. Toyota K, Miyakawa H, Hiruta C, Sato T, Katayama H, Ohira T, et al. Sex determination and differentiation in decapod and cladoceran crustaceans: An overview of endocrine regulation. Genes (Basel). 2021;12(2): 305. pmid:33669984
- 5. Kato Y, Kobayashi K, Watanabe H, Iguchi T. Environmental sex determination in the branchiopod crustacean Daphnia magna: Deep conservation of a Doublesex gene in the sex-determining pathway. Kopp A, editor. PLoS Genet. 2011;7(3): e1001345.
- 6. Mohamad Ishak NS, Nong QD, Matsuura T, Kato Y, Watanabe H. Co-option of the bZIP transcription factor Vrille as the activator of Doublesex1 in environmental sex determination of the crustacean Daphnia magna. PLoS Genet. 2017;13(11): e1006953.
- 7. Perez CAG, Adachi S, Nong QD, Adhitama N, Matsuura T, Natsume T, et al. Sense-overlapping lncRNA as a decoy of translational repressor protein for dimorphic gene expression. PLoS Genet. 2021;17(7): e1009683. pmid:34319983
- 8. Dasgupta T, Ladd AN. The importance of CELF control: Molecular and biological roles of the CUG-BP, Elav-like family of RNA-binding proteins. Wiley Interdiscip Rev RNA. 2012;3(1): 104–21. pmid:22180311
- 9. Ladd AN, Charlet-B N, Cooper TA. The CELF family of RNA binding proteins is implicated in cell-specific and developmentally regulated alternative splicing. Mol Cell Biol. 2001;21(4): 1285–96. pmid:11158314
- 10. Webster PJ, Liang L, Berg CA, Lasko P, Macdonald PM. Translational repressor bruno plays multiple roles in development and is widely conserved. Genes Dev. 1997;11(19): 2510–21. pmid:9334316
- 11. Takahashi N, Sasagawa N, Suzuki K, Ishiura S. The CUG-binding protein binds specifically to UG dinucleotide repeats in a yeast three-hybrid system. Biochem Biophys Res Commun. 2000;277(2): 518–23. pmid:11032753
- 12. Faustino NA, Cooper TA. Identification of putative new splicing targets for ETR-3 using sequences identified by systematic evolution of ligands by exponential enrichment. Mol Cell Biol. 2005;25(3): 879–87. pmid:15657417
- 13. Xia H, Chen D, Wu Q, Wu G, Zhou Y, Zhang Y, et al. CELF1 preferentially binds to exon-intron boundary and regulates alternative splicing in HeLa cells. Biochim Biophys Acta—Gene Regul Mech. 2017;1860(9): 911–21. pmid:28733224
- 14. Gareau C, Fournier MJ, Filion C, Coudert L, Martel D, Labelle Y, et al. P21waf1/cip1 upregulation through the stress granule-associated protein CUGBP1 confers resistance to bortezomib-mediated apoptosis. PLoS One. 2011;6(5): e20254 pmid:21637851
- 15. Siddam AD, Gautier-Courteille C, Perez-Campos L, Anand D, Kakrana A, Dang CA, et al. The RNA-binding protein Celf1 post-transcriptionally regulates p27Kip1 and Dnase2b to control fiber cell nuclear degradation in lens development. Morris AC, editor. PLOS Genet. 2018 Mar 22;14(3): e1007278. pmid:29565969
- 16. Kato Y, Shiga Y, Kobayashi K, Tokishita SI, Yamagata H, Iguchi T, et al. Development of an RNA interference method in the cladoceran crustacean Daphnia magna. Dev Genes Evol. 2011;220(11–12): 337–45.
- 17. Nong QD, Mohamad Ishak NS, Matsuura T, Kato Y, Watanabe H. Mapping the expression of the sex determining factor Doublesex1 in Daphnia magna using a knock-in reporter. Sci Rep. 2017;7(1): 13521.
- 18. Kato Y, Matsuura T, Watanabe H. Genomic integration and germline transmission of plasmid injected into crustacean Daphnia magna eggs. PLoS One. 2012;7(9): e45318.
- 19. Tatarazako N, Oda S, Watanabe H, Morita M, Iguchi T. Juvenile hormone agonists affect the occurrence of male Daphnia. Chemosphere. 2003;53(8): 827–33.
- 20. Zheng ZZ, Sun X, Zhang B, Pu J, Jiang ZY, Li M, et al. Alternative splicing regulation of doublesex gene by RNA-binding proteins in the silkworm Bombyx mori. RNA Biol. 2019;16(6): 809–20.
- 21. Herpin A, Schmidt C, Kneitz S, Gobé C, Regensburger M, Le Cam A, et al. A novel evolutionary conserved mechanism of RNA stability regulates synexpression of primordial germ cell-specific genes prior to the sex-determination stage in medaka. PLoS Biol. 2019;17(4): e3000185. pmid:30947255
- 22. Wang Z, Lin H. Sex-lethal is a target of Bruno-mediated translational repression in promoting the differentiation of stem cell progeny during Drosophila oogenesis. Dev Biol. 2007 Feb;302(1): 160–8.
- 23. Salz HK, Erickson JW. Sex determination in Drosophila: The view from the top. Fly (Austin). 2010;4(1): 60–70.
- 24. Flora P, Wong-Deyrup SW, Martin ET, Palumbo RJ, Nasrallah M, Oligney A, et al. Sequential regulation of maternal mRNAs through a conserved cis-acting element in their 3′ UTRs. Cell Rep. 2018;25(13): 3828–3843.e9.
- 25. Kress C, Gautier-Courteille C, Osborne HB, Babinet C, Paillard L. Inactivation of CUG-BP1/CELF1 causes growth, viability, and spermatogenesis defects in mice. Mol Cell Biol. 2007;27(3): 1146–57. pmid:17130239
- 26. Boulanger G, Cibois M, Viet J, Fostier A, Deschamps S, Pastezeur S, et al. Hypogonadism associated with Cyp19a1 (Aromatase) Post-transcriptional Upregulation in Celf1 Knockout Mice. Mol Cell Biol. 2015;35(18): 3244–53.
- 27. Boateng R, Nguyen KCQ, Hall DH, Golden A, Allen AK. Novel functions for the RNA-binding protein ETR-1 in Caenorhabditis elegans reproduction and engulfment of germline apoptotic cell corpses. Dev Biol. 2017;429(1): 306–20.
- 28. Timchenko NA, Iakova P, Cai Z-J, Smith JR, Timchenko LT. Molecular basis for impaired muscle differentiation in myotonic dystrophy. Mol Cell Biol. 2001;21(20): 6927–38. pmid:11564876
- 29. Timchenko NA, Cai ZJ, Welm AL, Reddy S, Ashizawa T, Timchenko LT. RNA CUG repeats sequester CUGBP1 and alter protein levels and activity of CUGBP1. J Biol Chem. 2001;276(11): 7820–6. pmid:11124939
- 30. Kato Y, Perez CAG, Mohamad Ishak NS, Nong QD, Sudo Y, Matsuura T, et al. A 5′ UTR-overlapping lncrna activates the male-determining gene doublesex1 in the crustacean Daphnia magna. Curr Biol. 2018;28(11): 1811–1817.e4.
- 31. Klttitgen B, Dulmer U, Engels M, Ratre HT. ADaM, an artificial freshwater for the culture of zooplankton. Water Res. 1994;28(3): 743–6.
- 32. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35(6): 1547–9. pmid:29722887
- 33. Elendt BP, Bias WR. Trace nutrient deficiency in Daphnia magna cultured in standard medium for toxicity testing. Effects of the optimization of culture conditions on life history parameters of D. magna. Water Res. 1990;24(9): 1157–67.
- 34. Asada M, Kato Y, Matsuura T, Watanabe H. Early embryonic expression of a putative ecdysteroid-phosphate phosphatase in the water flea, Daphnia magna (Cladocera: Daphniidae). J Insect Sci. 2014;14: 181.
- 35. Törner K, Nakanishi T, Matsuura T, Kato Y, Watanabe H. Optimization of mRNA design for protein expression in the crustacean Daphnia magna. Mol Genet Genomics. 2014;289(4): 707–15.
- 36. Asada M, Kato Y, Matsuura T, Watanabe H. Visualization of ecdysteroid activity using a reporter gene in the crustacean, Daphnia. Mar Environ Res. 2014;93: 118–22.
- 37. Kumagai H, Matsuura T, Kato Y, Watanabe H. Development of a bicistronic expression system in the branchiopod crustacean Daphnia magna. Genesis. 2017;55(12): e23083.
- 38. Kato Y, Kobayashi K, Oda S, Colbourn JK, Tatarazako N, Watanabe H, et al. Molecular cloning and sexually dimorphic expression of DM-domain genes in Daphnia magna. Genomics. 2008;91(1): 94–101.