Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Functions of block of proliferation 1 during anterior development in Xenopus laevis

  • Corinna Gärtner ,

    Contributed equally to this work with: Corinna Gärtner, Annika Meßmer

    Roles Conceptualization, Data curation, Formal analysis, Investigation, Validation, Visualization, Writing – original draft, Writing – review & editing

    Affiliations Institute of Biochemistry and Molecular Biology, Ulm University, Ulm, Germany, International Graduate School in Molecular Medicine Ulm, Ulm, Germany

  • Annika Meßmer ,

    Contributed equally to this work with: Corinna Gärtner, Annika Meßmer

    Roles Formal analysis, Investigation, Visualization, Writing – review & editing

    Affiliations Institute of Biochemistry and Molecular Biology, Ulm University, Ulm, Germany, International Graduate School in Molecular Medicine Ulm, Ulm, Germany

  • Petra Dietmann,

    Roles Investigation, Supervision

    Affiliation Institute of Biochemistry and Molecular Biology, Ulm University, Ulm, Germany

  • Michael Kühl,

    Roles Conceptualization, Supervision, Validation, Writing – review & editing

    Affiliation Institute of Biochemistry and Molecular Biology, Ulm University, Ulm, Germany

  • Susanne J. Kühl

    Roles Conceptualization, Project administration, Supervision, Validation, Writing – original draft

    susanne.kuehl@uni-ulm.de

    Affiliation Institute of Biochemistry and Molecular Biology, Ulm University, Ulm, Germany

Abstract

Block of proliferation 1 (Bop1) is a nucleolar protein known to be necessary for the assembly of the 60S subunit of ribosomes. Here, we show a specific bop1 expression in the developing anterior tissue of the South African clawed frog Xenopus laevis. Morpholino oligonucleotide-mediated knockdown approaches demonstrated that Bop1 is required for proper development of the cranial cartilage, brain, and the eyes. Furthermore, we show that bop1 knockdown leads to impaired retinal lamination with disorganized cell layers. Expression of neural crest-, brain-, and eye-specific marker genes was disturbed. Apoptotic and proliferative processes, which are known to be affected during ribosomal biogenesis defects, are not hindered upon bop1 knockdown. Because early Xenopus embryos contain a large store of maternal ribosomes, we considered if Bop1 might have a role independent of de novo ribosomal biogenesis. At early embryonic stages, pax6 expression was strongly reduced in bop1 morphants and synergy experiments indicate a common signaling pathway of the two molecules, Bop1 and Pax6. Our studies imply a novel function of Bop1 independent of ribosomal biogenesis.

Introduction

Before cell division, cells need to grow so that daughter cells are similar in size to their parental cells. Cell growth occurs during the G1 phase of the cell cycle and requires a sufficient number of ribosomes. Ribosomes are involved in the cellular protein synthesis machinery that translates the genetic information from intermediate mRNA into a protein and are therefore crucial for cellular function [1]. Ribosomes are generated mainly in the nucleoli, and this process requires the synthesis of ribosomal proteins for the small and large ribosomal subunits and the transcription and processing of the 47S rRNA precursor (45S in Xenopus). The processing of the precursor is a complex step and requires numerous proteins to be organized into different pre-ribosomal multiprotein complexes. Defects in ribosome assembly or function can lead to a group of diseases called ribosomopathies. The best-known ribosomopathies are Diamond Blackfan anemia, Shwachman Diamond syndrome, and Treacher Collins syndrome [2,3].

Block of Proliferation 1 (Bop1) is one of the 200 factors known to be necessary for ribosomal synthesis [46]. Bop1 forms a protein complex with WD repeat domain 12 (WDR12) and Pescadillo homologue 1 (Pes1). This complex is called the PeBoW (Pes1-Bop1-WDR12) complex, and its integrity is required for rRNA processing and thus ribosomal biogenesis, as well as for cell proliferation [7,8]. Bound into the PeBoW complex, Bop1 is involved in the maturation of 28S and 5.8S rRNA and is therefore required for the assembly of the 60S subunit of the eukaryotic 80S ribosome [6]. Consistently, in mouse-derived cell lines dominant-negative mutants of Bop1 lead to cell cycle arrest in the G1 phase, resulting in impaired proliferation [9,10]. bop1 knockdown also leads to drastically decreased protein synthesis in human cell lines [11].

Xenopus laevis oocytes can rely on a large store of 1012 maternal ribosomes, proteins, and mRNAs [12,13]. Therefore, their early development does not require the zygotic synthesis of new ribosomes, as shown in the anucleolate mutant. In homozygous anucleolate mutants, no rRNA precursors can be synthesized because of the lack of the rRNA gene cluster. Nevertheless, these embryos survive until the swimming tadpole stage [14]. During Xenopus embryogenesis, the nucleoli are reformed in the gastrula stage, which is accompanied by rRNA precursor synthesis [15] and ribosomal protein mRNA synthesis, both at low levels [16]. Significant ribosomal protein synthesis subsequently starts at stage 26 [16].

We previously analyzed the function of Pes1, one protein of the PeBoW complex, during early Xenopus laevis development, in particular during neural [17] and pronephric [18] development. We also analyzed the function of Peter Pan (Ppan), a Pes1-interacting protein, during Xenopus development [18,19]. We found a tissue-specific expression of these two genes, in e.g., the anterior neural plate, developing neural crest cells (NCCs), the eye and the pronephros. Loss-of-function studies indicated a crucial role of these proteins during early neural and pronephros development [1719]. In neither neural nor pronephric tissues, the early phenotypes could be mimicked by interfering with 45S rRNA precursor processing, indicating a function of these proteins beyond their role in rRNA processing. In further studies, we were able to show that Ppan defines a tumor protein p53 (Tp53) independent of the nucleolar stress response pathway [20].

The above findings raised the interesting question of whether interfering with Bop1 function would also affect early Xenopus development. First evidence of a tissue-specific expression of bop1 during early development in Xenopus laevis was provided by Neilson and colleagues [21]. To obtain further evidence, we therefore investigated the role of Bop1 during early Xenopus development. A detailed expression analysis of bop1 revealed a specific expression during early anterior development, and loss-of-function studies revealed a function of Bop1 during neural development, in particular during eye and cranial cartilage development. This role of Bop1 involves the transcription factor Pax6 (Paired box 6), at least in part.

Materials and methods

Xenopus laevis

All procedures were approved by the German state administration Baden-Württemberg (Regierungspräsidium Tübingen) and performed according to the German animal use and care law. Embryos of Xenopus laevis were generated and cultured as described in previous protocols [22]. Embryos were cultivated in 0.1 x Modified Barth’s saline with HEPES buffer (MBSH) at 12.5 to 20°C, and staging was done according to Nieuwkoop and Faber [23]. Fixation was performed with MEMFA(T) (0.1 M MOPS (pH 7.4), 2mM EGTA, 1 mM MgSO4, 4% formaldehyde, (0.1% Tween20)).

Synteny analysis and protein alignment

Synteny analysis and protein alignment of Bop1 were performed with the NCBI Gene Bank for Homo sapiens (NP_056016; Gene ID: 23246), Danio rerio (NP_001071203; Gene ID: 777627), and Mus musculus (AAB19223; Gene ID: 12181) and the Xenbase platform (xenbase.org) for Xenopus laevis (NP_001080358; Gene ID: XB-GENE-6254226 (bop1. L); NP_001079852; Gene ID: XB-GENE-6255479 (bop1. S)). For protein alignments, the software CLC Main Workbench 8 (Qiagen bioinformatics, 2017) was used.

Whole mount in situ hybridization

Whole mount in situ hybridization (WMISH) was performed with a digoxygenin-labeled probe generated via in vitro transcription with T7, SP6, or T3 RNA polymerase (Roche) against the mRNA of different antisense probes in accordance with previous protocols [24,25]. We cloned the open reading frame of Xenopus laevis bop1 into the pSC-B vector (Stratagene) with the cloning primers bop1_l 5’ GACAGGGAAAAACGTGTTTCT 3’ and bop1_r 5‘ TTATGTGAATAATCGGATTGTGG 3’. In vitro transcription with T3 RNA polymerases (Roche) resulted in digoxygenin-labelled antisense RNA probes. We used the following RNA anti-sense probes: celf1 (CUGBP Elav-like family member 1) [26], cryba1 (crystallin beta A1) [26], emx1 (empty spiracles homeobox 1) [27], en2 (engrailed homeobox 2) [28], egr2 (early growth response 2) [27], foxd3 (forkhead box D3) [29], otx2 (orthodenticle homeobox 2) [30], pax6 [31,32], pou4f1 (POU class 4 homeobox 1) [33], prox1 (prospero homeobox 1) [34], rax (retina and anterior neural fold homeobox) [35], sox2 (sex determining region Y-box 2) (sequence ID: LC164013.1), sox3 (sex determining region Y-box 3) [36], vsx1 (visual system homeobox 1) [37], and rho (rhodopsin) [38]. For analyzing the expression of genes upon knockdown of bop1 via WMISH, only the described tissues were evaluated.

Morpholino oligonucleotide specificity and effectiveness test

Morpholino oligonucleotides were designed to the sequence of the bop1 S homeologue. To show the specificity of the morpholino oligonucleotide (MO) binding, we cloned the MO binding sites and the binding sites as they appear on the bop1 L homeologue in front of and in frame with the green fluorescent protein (GFP) gene by following an established protocol [17]. The cloning primers were as follows:

bop1_MO_bs_GFP_l, 5’ GATCCACCCGAGCCCTGAGTGAGACATGAAG 3’; bop1_MO_bs_GFP_r, 5’ AATTCTTCATGTCTCACTCAGGGCTCGGGTG 3’; bop1_MO2_bs_GFP_l, 5’ GATCCGAGACAGGGAAAAACGTGTTTCTACG 3’; bop1_MO2_bs_GFP_r, 5’ AATTCGTAGAAACACGTTTTTCCCTGTCTCG 3’; bop1_MO_bs_ChrL_GFP_l, 5’ GATCCCCCGAGTCCTGAGTGAAACATGAAG 3’; bop1_MO_bs_ChrL_GFP_r, 5’ AATTCTTCATGTTTCACTCAGGACTCGGGG 3’; bop1_MO2_bs_ChrL_GFP_l, 5’ GATCCGAGACAGGGAGAAACGTGTTTGTGCG 3’; bop1_MO2_bs_ChrL_GFP_r, 5’ AATTCGCACAAACACGTTTCTCCCTGTCTCG 3’; Δ5’UTRbop1_MO_bs_GFP_l, 5’ GATCCCCACTGTGGAATTCGCCCTTATGAAG 3’; and Δ5’UTRbop1_MO_bs_GFP_r, 5’ AATTCTTCATAAGGGCGAATTCCACAGTGGG 3’.

To test the MO binding specificity, we injected 1 ng of the respective GFP construct bilaterally together with 10 ng of bop1 MO, bop1 MO2, or Control MO into embryos at the two-cell stage and checked for GFP expression with an Olympus MVX10 fluorescence microscope.

Morpholino oligonucleotides, cloning, injection mRNAs, and microinjections

We designed two bop1 MOs that bound to the following sequences: bop1 MO, 5’-CCCGAGCCCUGAGUGAGACAUGAA-3’; and bop1 MO2, 5’-GAGACAGGGAAAAACGUGUUUCUAC-3’. pax6 MO and tp53 MO were used as previously described [39,40]. All gene-specific and a standard Control MO were obtained from Gene Tools (Philomath, OR, USA). MOs were diluted in water treated with diethyl pyrocarbonate (DEPC) and injected into one of the two animal-dorsal blastomeres of eight-cell embryos to specifically target the anterior tissue. As an injection control, 0.5 ng of GFP RNA was co-injected, and the fluorescence was assessed with a fluorescence microscope (Olympus MVX10, U-RFL-T, Japan). The uninjected side served as an internal control and Control MO injections, as an injection control. If not indicated differently, the following amounts of MO were injected: 15 ng bop1 MO, 15 ng bop1 MO2, 15 ng Control MO, 15 or 30 ng pax6 MO, and 2.5 or 5 ng tp53 MO. For rescue experiments Xenopus Δ5’UTR-bop1 RNA was cloned into the pCS2+ vector (Rupp and Weintraub) using XhoI and XbaI for restriction and the following primers: Δ5’UTRbop1_l: 5’ ATGAAGAGAGGGAGCCAAGGGGAG 3’ and Δ5’UTRbop1_r: 5’ TTATGTGAATAATCGGATTGTGG 3’. Generation of injection mRNAs was accomplished by in vitro transcription using T3, T7, or SP6 polymerase. Rescue experiments of Bop1 were performed by injecting bop1 MO along with 0.5 ng of Xenopus Δ5’UTR-bop1 RNA, which is not targeted by the bop1 MO and bop1 MO2, into one animal-dorsal blastomere (Δ5’UTR-bop1 RNA is not targeted by the bop1 MO and bop1 MO2 because of the altered sequence as shown in S2B Fig). bop1 RNA for gain of Bop1 function experiments bop1 RNA was cloned into the pCS2+ vector using XhoI and XbaI for restriction and the following primers: bop1_l: 5’ GACAGGGAAAAACGTGTTTCT 3’ and bop1_r: 5’ TTATGTGAATAATCGGATTGTGG 3’. Gain-of-function experiments were implemented with injections of bop1 RNA ranging from 0.5 to 1 ng. For synergy experiments, 5 ng pax6 MO and 5 ng of bop1 MO were injected unilaterally alone or in combination. Co-injections of bop1 MO and foxd3 RNA [29] were carried out with 50, 250, or 750 pg foxd3 RNA. Co-injection of bop1 MO and c-myc (MYC proto-oncogene) RNA [19] were carried out with 0.5 ng c-myc RNA. Co-injections of bop1 MO together with pax6 RNA were performed with 0.2 ng, 0.5 ng, or 1 ng pax6 RNA. GFP RNA was used to adjust RNA levels for all experiments in which RNA was injected and Control MO was used to adjust MO levels for all experiments in which MOs were injected.

Quantitative real-time PCR

Embryos were bilaterally injected with 20 ng Bop1 MO or 20 ng Control MO at two-cell stage. At stage 13, total RNA was isolated from whole embryos using peqGOLD RNAPure Kit (PEQLAB) according to the manufacturers’ protocols. cDNA synthesis was performed using Superscript II reverse transcriptase and random primers (Invitrogen). Primers for qPCR were designed using the online tool NCBI primer blast. The following primers were used:

slc35b1_qPCR_l: 5’ CGCATTTCCAAACAGGCTCC 3’ [41]

slc35b1_qPCR_r: 5’ CAAGAAGTCCCAGAGCTCGC 3’ [41]

odc_qPCR_l: 5’ TGCACATGTCAAGCCAGTTC 3’ [42]

odc_qPCR_r: 5’ GCCCATCACACGTTGGTC 3’ [42]

glyceradehyde-3-phosphate dehydrogenase (gapdh)_qPCR_l: 5’ GCCGTGTATGTGGTGGAATCT 3’ [19]

gapdh_qPCR_r: 5’ AAGTTGTCGTTGATGACCTTTGC 3’ [19]

sox2_qPCR_l: 5’ AACTCTGCGTCCAACAACCA 3’

sox2_qPCR_r: 5’ TGTGCATCTTGGGGTTCTCC 3’

sox3_qPCR_l: 5’ GGATCAGGATCGGGTGAAGC 3’

sox3_qPCR_r: 5’ GCTGATCTCCGAGTTGTGCA 3’

For quantitative real-time PCR, the QuantiTect SYBR Green PCR Kit (Qiagen) and a BioRad CFX Connect Real Time System was used. gapdh, slc35b1, and odc served as housekeeping genes. Each experiment was measured in triplicates and qPCR products were verified via gel electrophoresis. Relative gene expression was calculated using the ΔΔCT method and the three housekeeping genes as previously described [43].

Knockout using the CRISPR/Cas9 system

For gene editing experiments using the clustered regularly interspaced short palindromic repeats (CRISPR)/ CRISPR-associated protein 9 (Cas9) system, bop1 gRNA #1 was designed using CRISPRscan (crisprscan.org) [44] targeting exon 8 of the bop1 S and bop1 L homeologue with the following CRISPR site: 5’ TGTACCTGTGCCCGCGCCAG 3’. The gRNA template was synthesized using the oligo extension reaction [45]. Transcription of gRNA was performed using the MEGAshortscript T7 Transcription kit (Invitrogen) and the miRNAeasy Micro kit (Qiagen) for purification. Cas9 protein (PNA Bio) and gRNA were assembled to the ribonucleoprotein complex by 5 min incubation at 37°C. 1 ng Cas9 protein was injected together with 300 pg gRNA. For phenotype analysis, embryos were injected at two-cell stage. Cas9 protein alone and injection of 0.5 ng GFP RNA into the second blastomere served as injection control. For sequencing experiments, embryos were injected at one-cell stage and lysed (50 mM Tris [pH 8.8], 1 mM EDTA, 0.5% Tween 20, 200 μg/ml proteinase K) at stage 43. DNA was extracted as previously described [45]. DNA pools of 10 control embryos or 10 bop1 gRNA #1 injected embryos were combined. The following primer were used for confirming gene editing via direct sequencing:

bop1 gRNA #1 6L-l: 5’ GTATGTTCCATCTCACTTCCTGC 3’

bop1 gRNA #1 6L-r: 5’ GTACCAGTGCAGGGAAACAAT 3’

bop1 gRNA #1 6S-l: 5’ TCTCTTCCCCTGTTGGCTCCT 3’

bop1 gRNA #1 6S-r: 5’ AAGACATGTAGCGGCAGTGTAA 3’.

Alcian blue staining

Cranial cartilage staining was performed according to Gessert et al. [17]. bop1 MO-injected embryos were fixed at stage 45 in 1x MEMFA for 1 hour and stained overnight at room temperature in a staining solution containing 1% Alcian blue and 0.5% acetic acid diluted in water. To wash the embryos, we used 80% EtOH / 20% acetic acid, changing the solution several times. Bleaching was performed with 30% H2O2. Manual isolation of cartilage was reached with fine tweezers.

Imaging

Xenopus embryos were imaged with an Olympus MVX10 (fluorescence) or Olympus SZX12 microscope and an Olympus UC50 camera. Sections were imaged with an Olympus BX60 microscope and an Olympus DP70 camera. Images were processed with ImageJ64, Affinity Designer 1.10.4, Adobe Photoshop CS6, and Adobe Illustrator CS5.

Quantitative tissue measurements

The head width (distance between midline and the lateral edge of the embryo), the area of the eye, and the coloboma (apex angle in degree) were measured with the software ImageJ64 (Wayne Rasband, NIH). For the analysis of brain size, embryos were fixed at stage 42, the brain was isolated, and pictures were taken. ImageJ was used to measure the brain area. For the analysis of the width of sox3 expression, embryos were fixed at stage 13 and stained with a sox3 antisense probe. After imaging, the width of sox3 expression was measured with ImageJ. To analyze the area of sox3 and pax6 expression, bop1 MO and Control MO-injected embryos were photographed after WMISH. By using ImageJ, the area of expression was selected and measured. The intensity of GFP expression was analyzed using ImageJ. Here, the mean of the grey values was analyzed at indicated areas and normalized to the control group.

Histology sections

A vibrating microtome (Vibratome 1500 Classic, The Vibratome Company) was used to slice 25 μm-thick sections of the Xenopus embryos. Before sectioning, the embryos were embedded in blocks containing gelatin and glutaraldehyde.

Phospho histone 3 staining

For analysis of cell proliferation, phospho histone 3 (pH3) staining was performed in unilaterally injected embryos at stage 23 that were fixed with MEMFAT for 2 hours at room temperature. First, embryos were washed in 1x PBS for 5 x 10 minutes and then blocked for 1 hour in 1x PBS / 10% Horse Serum before being treated with a rabbit-anti-pH3 antibody (1:100; Millipore, Temecula, CA, USA), diluted in 1x PBS / 10% Horse Serum and incubated overnight at 4°C. The next day, embryos were washed in a solution of 1x PBS / 0.1% Tween-20 for 2 hours, whereby the medium was changed 4 times. For blocking, embryos were incubated in 1x PBST / 20% Horse Serum for 1 hour. Incubation with the secondary antibody was performed for 5 to 6 hours with 1x PBST / 20% Horse Serum / anti-rabbit-IgG-AP (1:1000; Sigma-Aldrich, Munich, Germany). Overnight, embryos were kept in 1x PBS / 0.1% Tween at 4°C. On the last day, embryos were transferred into a 24-well plate after several washing steps with 1x PBS / 0.1% Tween and then incubated with AP buffer for 10 minutes. Staining was performed with 500 μl of BM purple, and fixation, with MEMFAT. 30% H2O2 was used to bleach the. Then, pH3-positive cells were counted on both sides of the eye area.

Terminal deoxynucleotidyl transferase dUTP nick end labeling assay

Cell apoptosis was detected via terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining. TUNEL staining was performed at stage 23 according to established protocols [17,27,46]. After fixation, embryos were bleached in 30% H2O2. TUNEL-positive cells were counted on both sides of the embryo.

Statistics

Data were analyzed with the software GraphPad Prism 9 (San Diego, CA, USA). P values were calculated with a one-tailed, non-parametric Mann-Whitney rank sum test. For real-time qPCR analysis a paired t-test was performed upon checking for normal distribution using a Shapiro-Wilk test. Error bars represent standard error of the means (SEM). Statistical significance was indicated as follows: *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001; and ****, p ≤ 0.0001.

Results

Genomic analysis of bop1

To investigate the genomic region of bop1, we performed an in silico synteny analysis in which we compared the genomes of Homo sapiens, Mus musculus, Xenopus laevis (both homeologues), and Danio rerio (S1A Fig). This approach showed that the neighboring genes of bop1 are highly conserved across species, although some deletions and inversions were observed upstream and downstream of bop1. A protein alignment showed that the proteins are similar between the various species, especially at the BOP1 N-terminal (NT) domain and the WD40 repeat (WD 40) domain (S1B–S1D Fig). Taken together, these data suggest a strong conservation of Bop1 across species.

Spatiotemporal expression of bop1 during early Xenopus embryogenesis

To investigate the expression pattern of bop1 in Xenopus laevis embryos, we used WMISH approaches with a bop1-specific antisense RNA probe (Fig 1). bop1 is expressed at the animal pole in very early stages of development (Fig 1A). During gastrulation, bop1 expression was detected in the ectoderm and the invaginating mesoderm surrounding the blastoporus (Fig 1A). At stage 13, bop1 expression was found in the anterior neural plate and in the optic field, where rax and pax6 are expressed as well (Fig 1B and 1H). At stage 17, bop1 expression was located in the neural plate border, where NCCs are induced as shown by comparison with foxd3 expression (Fig 1I). Stage 23 embryos showed bop1 transcripts in the eye anlage and the migrating NCCs (Fig 1B). In later stages, bop1 mRNA was visualized in the developing eye, the brain, the NCCs of the mandibular, hyoid and branchial arches, the blood islands, the otic vesicle, and the tailbud (Fig 1B and 1C). Vibratome sections confirmed these findings (Fig 1D–1G). At stage 30 and 35/36, expression of bop1 was located in the ciliary marginal zone and the lens, as confirmed by expression of rax and prox1, respectively (Fig 1F and 1J).

thumbnail
Fig 1. bop1 expression in Xenopus laevis embryos.

A bop1 expression visualized by whole mount in situ hybridization in embryos at the indicated stages. Animal (st. 1), lateral (st. 5), and vegetal (st. 11) views and a sagittal section (st. 11) are shown. At stage 1 and stage 5, bop1 was expressed at the animal pole (orange arrowhead). During gastrulation (st. 11), bop1 expression occurred in the mesoderm surrounding the blastoporus (yellow and blue arrow). B, C Anterior (st. 13 and 23) and lateral (st. 26, st. 30, and st. 35/36) views are shown. At stage 13, bop1 expression was found in the anterior neural plate (red arrowhead). Stage 23 and stage 26 embryos showed expression in the developing eye (black arrowhead), the migrating neural crest cells (NCCs) (black arrow), and the brain (red arrow). At tailbud stages, embryos expressed bop1 in the developing eye (black arrowhead), the brain (red arrow), the branchial (ba) and hyoid arches (ha), the otocyst (white arrow), the blood islands (white arrowhead), and the tail bud. D bop1 expression was shown in the developing eye (transversal section, orientation: Dorsal (upper part) to ventral (lower part)). E, G bop1 expression was shown in the branchial, hyoid, and mandibular arches (ma) (horizontal sections, orientation: Anterior (upper part) to posterior (lower part)). F Embryos expressed bop1 in the brain (b) and in the lens (le) (transversal section, orientation: Dorsal (upper part) to ventral (lower part)). H Expression of bop1 and the two eye-specific marker genes rax and pax6 at stage 13. The black dotted line indicates the level of sagittal sections in h1-h3 (section orientation is dorsal (upper part) to ventral (lower part)). bop1 expression was detected in the optic field (of) (red dotted circle), as was rax and pax6 expression. I Expression of bop1 and the NCC marker gene foxd3 at stage 17. The black dotted line in the left-hand panel represents the level of horizontal sections in i1 and i2 (section orientation is posterior (upper part) to anterior (lower part)). bop1 transcripts were located in the neural plate border positive for foxd3 (nbp) (red dotted line). The grey dotted line in the middle and right-hand panels represents the neural plate (np). J Expression of bop1 and the two eye-specific marker genes rax and prox1 at stage 30. The black dotted line indicates the level of transversal sections shown in j1-j3 (section orientation is dorsal (upper part) to ventral (lower part)). bop1 was expressed in the lens and the ciliary marginal zone (cmz), where retinal progenitor cells are located. Abbreviations: b, brain; ba, branchial arches; cmz, ciliary marginal zone; ev, eye vesicle; ha, hyoid arches; le, lens; ma, mandibular arches; NCC, neural crest cell; np, neural plate; nbp, neural plate border; of, optic field; r, retina; st., stage; WMISH, whole mount in situ hybridization.

https://doi.org/10.1371/journal.pone.0273507.g001

bop1 knockdown leads to defects during NCC development

Since bop1 was shown to be specifically expressed in the early anterior tissue (Fig 1), we analyzed the function of Bop1 in Xenopus embryos by loss-of-function experiments with a potent antisense MO-based approach. Since Session and colleagues have shown by RNA sequencing data that both homeologues (S and L) are expressed in the here addressed tissues [47], two different bop1 MOs against Xenopus bop1 mRNA were used; bop1 MO and bop1 MO2, both of which showed a high binding specificity to their binding sites on both bop1 homeologues S and L (S2A–S2D Fig).

To target anterior (neural) tissue, we injected bop1 MO unilaterally into one animal-dorsal blastomere of Xenopus embryos at eight-cell stage [48]. The uninjected side served as an internal control, and injection of a Control MO, as an injection control. To examine the phenotype upon loss of Bop1 function, embryos were analyzed at stage 42. Head width measurements revealed a significant decrease of the head width in bop1 MO-injected embryos; Control MO-injected embryos showed normally developed heads (Fig 2A and 2B). Injection of bop1 MO2 led to an identical phenotype in Xenopus embryos (S3A and S3B Fig). For rescue experiments, we generated a Xenopus bop1 RNA (Δ5’UTR-bop1 RNA) that is not targeted by bop1 MO and bop1 MO2 (S2B and S2C Fig). For the sake of simplicity, Xenopus Δ5’UTR-bop1 RNA is referred to as bop1 RNA in the figures. Co-injecting 15 ng bop1 MO or 15 ng bop1 MO2 together with 0.5 ng Xenopus Δ5’UTR-bop1 RNA led to a rescue of the NCC-derived phenotype and thus demonstrated the specificity of the bop1 MO-induced phenotype (Figs 2B and S3).

thumbnail
Fig 2. bop1 knockdown leads to a cranial cartilage phenotype.

A The head width on the injected side (red line) of embryos at stage 42 injected with bop1 MO and Control MO was compared with the head width on the uninjected side (blue line). The head was significantly smaller upon bop1 knockdown. B Statistical evaluation of data given in A. The head phenotype was rescued by co-injecting bop1 MO with 0.5 ng of Δ5’UTR-bop1 RNA. C Ventral view of Alcian blue-stained cranial cartilages of stage 45 embryos showed a reduced cartilage upon bop1 knockdown. The middle cartilage depicts a mild phenotype and the right one, a severe phenotype. Branchial arches (ba), Meckel´s cartilage (mc), tectum anterius (ta) were severely affected (black arrows). D sox3 served as pan-neural marker gene at stage 13 and was analyzed upon bop1 and Control MO injection. Anterior view of embryos is given. The width of sox3 expression on the injected side (red line) of bop1 MO- and Control MO-injected embryos at stage 13 was compared with the width on the uninjected side (blue line). E sox3 expression significantly increased in Xenopus embryos upon bop1 MO injection. F Statistical evaluation of data given in D showing an increased width of sox3 expression in bop1 morphants. G sox3 expression was analyzed in stage 13 bop1 morphants and control embryos (anterior view is shown). Expression domain was photographed and area was measured via ImageJ. Black boxes indicate area where sox3 expression (red area) was measured. Injected side was compared to uninjected side. H sox3 expression is significantly increased in bop1 morphants. Control MO injection did not alter sox3 expression. I Relative sox3 gene expression was analyzed using real-time qPCR in bop1 MO and Control MO bilaterally injected embryos at stage 13. sox3 expression was normalized to gapdh, odc, and slc35b1 and was significantly increased upon bop1 knockdown compared to control MO injection. J Anterior view of embryos is given. Expression of sox2 was analyzed upon bop1 MO and Control MO injection at stage 13. Neither bop1 MO nor Control MO injection affected sox2 expression. K Statistical analysis of data shown in J. L Relative sox2 gene expression was analyzed using real-time qPCR in bop1 MO and Control MO bilaterally injected embryos at stage 13. sox2 expression was normalized to gapdh, odc, and slc35b1 and was not affected upon bop1 knockdown. M The marker gene foxd3 in anterior neural crest cells in stage 17 embryos injected with 20 ng of bop1 MO or Control MO (black arrow indicates location of altered gene expression). N Around 40% of bop1 MO-injected embryos showed a reduced expression of foxd3 upon bop1 MO injection, but Control MO injection did not show any effect on foxd3 expression. Abbreviations: ba, branchial arches; bop1 MO, block of proliferation 1 morpholino oligonucleotide; CoMO, Control MO; inj., injected side; mc, Meckel´s cartilage; MO, morpholino oligonucleotide; n, number of independent experiments; N, number of injected and analyzed embryos; n.s., non-significant; ta, tectum anterius; uninj., uninjected side. bop1 is the Δ5’UTR-bop1 RNA used for rescues. Error bars indicate standard error of the means; Whiskers indicate in I and L minimum and maximum. *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001; ****, p ≤ 0.0001.

https://doi.org/10.1371/journal.pone.0273507.g002

We also performed bop1 gain-of-function experiments. Overexpressing bop1 in Xenopus embryos did not result in a smaller head or any other phenotype of the anterior tissue (S4A and S4B Fig).

Since bop1 expression was found in the NCCs (Fig 1) and NCCs migrate into cranial cartilage structures as one derivative [49], we investigated a potential role of Bop1 during NCC development. Hence, we analyzed cranial cartilage development by Alcian blue staining to detect cranial cartilage structures, at stage 45. In line with the finding of smaller head widths, bop1 morphants showed a smaller cranial cartilage upon bop1 knockdown (Fig 2C). Here, especially the Meckel´s cartilage and the tectum anterius were affected.

To analyze the molecular basis of the NCC-derived cranial cartilage phenotype, we first analyzed the expression of the pan-neural marker gene sox3 at stage13. Upon bop1 knockdown, sox3 expression was significantly increased (Fig 2E). The sox3 expression domain was found to be significantly broader upon Bop1 deficiency, as shown by analysis of the width as well as area of sox3 expression (Fig 2D and 2F–2H). An increase in relative sox3 expression was confirmed by real-time qPCR analysis (Fig 2I). Another pan-neural marker gene, sox2, was unaffected upon bop1 knockdown, which was analyzed by WMISH and real-time qPCR approaches (Fig 2J–2L). Next, we examined the expression of the NCC-specific marker gene foxd3 at stage 16, when NCCs are induced in the neural plate border. foxd3 expression was significantly downregulated upon bop1 MO injection. Control MO-injected embryos showed normally expressed foxd3 (Fig 2M and 2N).

To investigate whether the NCC phenotype solely originates from disturbed foxd3 expression, we performed rescue experiments by co-injecting bop1 MO and foxd3 RNA. The cranial cartilage phenotype was not rescued by co-injecting foxd3 RNA (S4C–S4E Fig).

In conclusion, in Xenopus laevis loss of Bop1 function leads to smaller heads and cranial cartilage as well as defects in NCC induction.

bop1 knockdown affects proper brain development

Since bop1 was also found to be specifically expressed in the developing brain, we investigated brain development of Xenopus upon bop1 knockdown (Fig 1). Therefore, we dissected brains of bop1 MO- or Control MO-injected embryos at stage 42 and measured the area of the brain. Indeed, brains were significantly smaller on the bop1 MO-injected side, whereas Control MO injection had no effect on brain development (Fig 3A and 3B).

thumbnail
Fig 3. Bop1 is necessary for brain development in Xenopus laevis.

A Sides of embryo brains injected with bop1 MO and Control MO and uninjected sides were compared (ventral view). B Statistical evaluation showed that bop1 knockdown led to a significantly smaller area of the brain. C Xenopus embryos were injected with either 20 ng bop1 MO or Control MO, and pax6 expression in the anterior neural tube was investigated at stage 13 (black arrow indicates location of reduced gene expression). pax6 expression was decreased upon bop1 knockdown. D Statistical evaluation of data given in C. E Area of pax6 expression was investigated at stage 13 embryos via ImageJ. Expression domain was photographed and injected side was compared to uninjected side. Yellow boxes indicate area in which pax6 expression (red area) was measured. F Statistical analysis confirmed reduction of pax6 expression upon bop1 knockdown. G Brain-specific marker genes were analyzed in stage 23 embryos. Embryos were injected with 20 ng bop1 MO or Control MO. Black arrows indicate location of reduced gene expression. H As shown by statistical evaluation, upon bop1 knockdown expression of otx2, en2, egr2, and pax6 was significantly decreased. Control MO-injected embryos showed normal gene expression. Abbreviations: bop1 MO, block of proliferation 1 morpholino oligonucleotide; CoMO, Control MO; inj., injected side; n, number of independent experiments; N, number of injected and analyzed embryos; n.s., non-significant; uninj., uninjected side. Error bars indicate standard error of the means; *, p ≤ 0.05; ***, p ≤ 0.001; ****, p ≤ 0.0001.

https://doi.org/10.1371/journal.pone.0273507.g003

The molecular basis of the brain phenotype was analyzed by WMISH and the well-known brain-specific marker genes pax6 (forebrain and posterior neural tube), emx1 (forebrain), otx2 (fore- and midbrain), en2 (mid-/hindbrain boundary, isthmus), and egr2 (hindbrain). At stage 13, pax6 expression was reduced in the anterior neural tube upon bop1 knockdown (Fig 3S and 3D). A quantitative analysis confirmed the decrease of pax6 expression (Fig 3E and 3F). At stage 23, the expression of the analyzed marker genes, otx2, en2, egr2, and pax6 was reduced in bop1 MO-injected embryos, whereas Control MO injection did not affect expression of analyzed genes (Fig 3G and 3H).

Taken together, Bop1 function was shown to be required for brain development in Xenopus laevis embryos.

Bop1 is required for proper Xenopus laevis eye development

As shown in Fig 1, bop1 expression was found in the developing eye of Xenopus laevis embryos. Hence, we analyzed the eyes of bop1 morphants at stage 42, and found eyes to be smaller and deformed. The uninjected side and Control MO-injected embryos showed no phenotype (Fig 4A). This phenotype was induced in a MO dose-dependent manner (Fig 4B). Vibratome sections revealed an impaired retinal pigmented epithelium (RPE) upon Bop1 deficiency (Fig 4A). By co-injecting Δ5’UTR-bop1 RNA, the eye defects were rescued (Fig 4A and 4B).

thumbnail
Fig 4. bop1 knockdown impairs proper eye development.

A Sides injected with bop1 MO and Control MO were compared with uninjected sides of embryos. Knockdown of bop1 led to a severe eye phenotype with underdeveloped or malformed eyes (white arrows). A detailed view of the deformed eyes is depicted (black arrows). Vibratome sections showed a deformed retinal pigmented epithelium (RPE) (orange arrows). Control MO-injected embryos showed no eye phenotype. B Statistical evaluation of data given in A. Embryos with Bop1 suppression developed a significantly smaller eye than Control MO-injected embryos. The phenotype increased in a dose-dependent manner and was rescued by co-injecting 0.5 ng of Δ5’UTR-bop1 RNA. C The area of the eye was measured (red dotted circles). Control MO- and bop1 MO-injected sides were compared with uninjected sides. D bop1 knockdown led to significantly smaller eyes. The size of the eye was rescued by co-injecting Δ5’UTR-bop1 RNA. E Measurement of the angle of eye fissures (indicated by red angle). F Statistical analysis of the angle of eye fissures showed that bop1 MO-injected embryos developed colobomas. The coloboma phenotype was rescued by co-injecting bop1 MO with Δ5’UTR-bop1 RNA. G Vibratome sections of bop1 MO-injected embryos showing a severe eye phenotype. Red arrows point to disrupted cell layers of indicated cell types, and black arrows point to disrupted RPE. Specific marker genes for cell layers were used, as described in the main text. Most of the cell types were displaced and disorganized. H Lens-specific cells were unimpaired upon suppression of Bop1. Vibratome sections of embryos showing a severe eye phenotype. The lens-specific marker genes celf1 and cryba1 were used. Some lens fiber cells and stem cells were mildly displaced, but they showed no reduction in expression. Numbers below the columns indicate the number of embryos showing the depicted phenotypes per number of embryos analyzed. Abbreviations: bop1 MO, block of proliferation 1 morpholino oligonucleotide; CoMO, Control MO; GCL, ganglion cell layer; inj., injected side; INL, inner nuclear cell layer; le, lens; n, number of independent experiments; N, number of injected and analyzed embryos; ONL, outer nuclear cell layer; RPE, retinal pigmented epithelium; uninj., uninjected side. bop1 is the Δ5’UTR-bop1 RNA used for rescues. Error bars indicate standard error of the means; Whiskers in B indicate minimum and maximum. *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001; ****, p ≤ 0.0001.

https://doi.org/10.1371/journal.pone.0273507.g004

As a quantitative evaluation, we measured the eye area after bop1 and Control MO injections and detected a significant decrease of the eye area in bop1 MO-injected embryos. The phenotype was rescued by co-injecting 0.5 ng Δ5’UTR-bop1 RNA (Fig 4C and 4D). In addition, we measured the angle of the eye fissure and observed a severe coloboma phenotype after bop1 MO injection but a normal phenotype after Control MO injection. Again, co-injection of Δ5’UTR-bop1 RNA resulted in a rescue of the coloboma phenotype (Fig 4E and 4F). Injection of bop1 MO2 led to identical eye phenotypes in Xenopus embryos, which were also rescued by co-injecting Δ5’UTR-bop1 RNA (S3C–S3H Fig).

Since sections of the eye showed an impaired RPE in bop1 morphants, we performed WMISH experiments with well-known retina cell type-specific marker genes [27]. In detail, we used rho for photoreceptor cells, prox1 for horizontal cells, vsx1 for bipolar cells, pax6 for amacrine and ganglion cells, and pou4f1 for ganglion cells. Vibratome sections revealed a massive disruption of the retinal layering upon bop1 knockdown but normal development in the uninjected retinas. In particular, photoreceptor cells formed rosette-like structures (Fig 4G).

bop1 is specifically expressed in the developing lens, hence we investigated lens development upon bop1 knockdown by WMISH with the specific marker genes celf1 for lens fiber cells and cryba1 for lens stem cells. Neither celf1 nor cryba1 expression was downregulated in Bop1-depleted lenses in comparison with the uninjected lenses (Fig 4H).

In addition to the knockdown using MOs, the CRISPR/Cas9 system was used to induce a knockout of bop1. Therefore, the synthesized bop1 gRNA #1 was pre-assembled with the Cas9 protein to form the ribonucleoprotein complex (Fig 5A). The complex was either injected at one-cell stage for further sequencing analysis or at two-cell stage for phenotypic evaluation (Fig 5A).

thumbnail
Fig 5. bop1 knockout using the CIRSPR/Cas9 system.

A Experimental setup of CRISPR/Cas9 gene editing experiments. Cas9 protein was pre-assembled with bop1 gRNA #1 to build ribonucleoprotein (RNP) complex. Embryos were injected at one-cell stage for sequencing analysis. Embryos were injected at two-cell stage for phenotypic analysis. B Target site of gRNA #1 on bop1 exon 8. Here shown for chromosome 6L –off note, there are no mismatches between target site on homeologue L and S. C DNA pools of 10 wildtype embryos or 10 bop1 CRISPants were sequenced. Target site of bop1 gRNA #1 is highlighted in blue, protospacer adjacent motif (PAM) sequence in grey, and heterogenous sequence in CRISPants DNA pool in red. CRISPR/Cas9 system successfully introduced mutations. D Injection of bop1 gRNA #1 resulted in smaller eyes (indicated with black arrow) and smaller heads on the injected side, whereas injection of Cas9 protein alone did not affect anterior development. E Statistical analysis of data shown in D. F The head width of the injected side (red line) was compared to the width of the uninjected side (blue line). Black line indicates the midline of the embryo. G Knockout of bop1 led to significantly narrower heads on the injected side. H Area of the eye on the injected side was compared to the area of the eye on the uninjected side. Measured area is indicated by red dotted line. I bop1 CRISPants showed a significantly reduced eye area. Cas9 protein alone did not affect the area of the eye. Abbreviations: bop1 gRNA #1, block of proliferation 1 guide RNA #1; Cas9, CRISPR-associated protein 9; CRISPR, clustered regularly interspaced short palindromic repeats; inj., injected side; n, number of independent experiments; N, number of injected and analyzed embryos; PAM, protospacer adjacent motif; PCR, polymerase chain reaction; RNP, ribonucleoprotein; uninj., uninjected side. Error bars indicate standard error of the means; Whiskers in G and H indicate minimum and maximum. ***, p ≤ 0.001; ****, p ≤ 0.0001.

https://doi.org/10.1371/journal.pone.0273507.g005

bop1 gRNA #1 targets exon 8 of the bop1 gene (Fig 5B). The wildtype sequence pool showed the CRISPR target site which is followed by the protospacer adjacent motif (PAM) sequence. The DNA sequence of bop1 CRISPants depicted a heterogeneous sequence starting 4 bases upstream of the PAM sequence indicating a successful gene editing (Fig 5C). bop1 knockout led to smaller eyes and smaller heads on the injected side (Fig 5D and 5E). Measurements of the head width and the eye area confirmed these findings (Fig 5F–5I). In contrast, Cas9 protein alone did not result in eye or head phenotypes (Fig 5D–5I).

Knockdown of bop1 alters the expression of eye marker genes

To analyze the molecular basis of the bop1 MO-induced eye phenotype, WMISH with well-established eye-specific marker genes was performed. First, we used the eye field-specific marker genes rax and pax6 in stage 13 embryos, when the eye field is induced [50,51]. rax expression was not altered upon either bop1 or Control MO injection (Fig 6A and 6B). pax6 expression was significantly decreased in the eye field (Fig 6A and 6B), which was also confirmed by expression area measurements (Fig 6C and 6D). At stage 23, rax, otx2, and pax6 were used to investigate eye cell differentiation [27]. Here, Bop1 suppression led to a decrease of all three marker genes (Fig 6E and 6F). Control MO-injected embryos showed normally expressed marker genes.

thumbnail
Fig 6. Eye-specific marker genes upon Bop1 deficiency.

A Xenopus laevis embryos at stage 13 injected with 20 ng bop1 MO or Control MO and analyzed by whole mount in situ hybridization. rax and pax6 served as eye-specific marker genes (black arrow indicates location of altered gene expression). Anterior view of embryos is given. B Quantitative representation of data given in A. C pax6 expression was analyzed in stage 13 bop1 morphants (anterior view is shown). Expression domain was photographed and area was measured via ImageJ. Injected side was compared to uninjected side. Yellow boxes indicate area where pax6 expression (red colored area) was measured. D pax6 expression is significantly reduced on the injected side of bop1 MO-injected embryos. E Stage 23 embryos injected with 20 ng bop1 MO or Control MO. Anterior view is given. rax, otx2, and pax6 were used as eye-specific marker genes (black arrows indicate the location of the altered gene expression). F The expression of all three marker genes was significantly reduced in bop1 morphants. Abbreviations: bop1 MO, block of proliferation 1 morpholino oligonucleotide; CoMO, Control MO; inj., injected side; n, number of independent experiments; N, number of injected and analyzed embryos; n.s., non-significant; uninj., uninjected side. Error bars indicate standard error of the means; *, p ≤ 0.05; **, p ≤ 0.001.

https://doi.org/10.1371/journal.pone.0273507.g006

In summary, bop1 knockdown led to a severe eye phenotype including microphthalmia, coloboma, and disturbed retinal lamination as well as defects in eye-specific marker gene expression during eye field induction and eye cell differentiation.

Translation, cell proliferation and Tp53 mediated-apoptosis are not affected by bop1 knockdown

Bop1 is a factor necessary for ribosomal biogenesis, therefore we investigated whether bop1 knockdown possibly affects the translational machinery. Therefore, 1 ng of GFP RNA was co-injected with either bop1 MO or Control MO and GFP intensity was analyzed at stage 15. GFP intensity did not differ between bop1 morphants and Control MO-injected embryos (Fig 7A and 7B), indicating that—in early Xenopus embryos—the translational machinery is not in general affected upon bop1 knockdown.

thumbnail
Fig 7. bop1 knockdown affects neither cell proliferation nor apoptosis.

A Embryos were injected with Control or bop1 MO together with 1 ng GFP RNA. At stage 15, embryos were photographed using a fluorescence microscope (8-bit greyscale). Intensity of GFP was analyzed by measuring the mean grey value in the indicated areas (white boxes). Mean intensities were normalized to the control group. Anterior view of embryos is given. B GFP intensity did not differ between Control MO and bop1 MO-injected embryos. C Anterior view of embryos is shown. Phospho histone 3 (pH3) staining of stage 23 embryos showed no difference upon injection of Control MO or bop1 MO. D Statistical analysis of data given in C. E Anterior view of embryos is shown. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining of stage 23 embryos revealed no difference between Control MO- and bop1 MO-injected embryos. F Statistical evaluation of data given in E. G Embryos were injected with Control MO, bop1 MO, or bop1 MO + 0.5 ng c-myc RNA. At stage 42, embryos were analyzed regarding a phenotype of the anterior tissue. Injected side was compared to uninjected side. White arrows indicate smaller eyes. H Statistical analysis of data shown in G reveals that a rescue of the bop1 MO-induced phenotype is not possible by co-injection of 0.5 ng c-myc RNA. I Embryos were injected with Control MO, bop1 MO, or bop1 MO + tp53 MO and analyzed at stage 42 regarding a phenotype of the anterior tissue. Co-suppression of Bop1 and Tp53 did not rescue the bop1 knockdown-associated phenotype. J Statistical analysis of data given in I. Abbreviations: bop1 MO, block of proliferation 1 morpholino oligonucleotide; c-myc, MYC proto-oncogene; CoMO, Control MO; GFP, green fluorescent protein; inj., injected side; MO, morpholino oligonucleotide; n, number of independent experiments; N, number of injected embryos and analyzed; n.s., non-significant; pH3, phospho histone 3; tp53, tumor protein p53; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labeling; uninj., uninjected side. Error bars indicate standard error of the means; *, p ≤ 0.05; ****, p ≤ 0.0001.

https://doi.org/10.1371/journal.pone.0273507.g007

Previous studies showed that upon knockdown of ribosomal proteins or factors, proliferative and apoptotic pathways are impaired [17,19,52,53]. Therefore, we investigated the number of proliferative cells via pH3 staining and apoptotic cells using TUNEL staining at stage 23. Neither bop1 MO nor Control MO injection affected proliferation (Fig 7C and 7D) or apoptosis (Fig 7E and 7F).

In a previous study investigating the ribosomal protein L5 (Rpl5), we have shown that the expression of c-myc, which is an important player during ribosomal biogenesis as it enhances the performance of all three polymerases I-III, is reduced in embryos upon rpl5 knockdown. Furthermore, the co-injection of c-myc RNA partially rescued the eye phenotype which occurred upon rpl5 MO injection [53]. Additionally, Bellmeyer and colleagues showed that c-myc knockdown results in a deformed and smaller cranial cartilage similar to the here observed phenotype [54]. Hence, we investigated whether the co-injection of bop1 MO together with c-myc RNA can rescue the bop1 MO-induced phenotype. The phenotype was not rescued (Fig 7G and 7H).

In defective ribosomal biogenesis, the number of free ribosomal proteins increases. These free proteins bind to MDM2 (Mouse double minute 2 homolog), a crucial regulator of Tp53, thereby stabilizing Tp53 which results in an activation of apoptotic pathways [55]. Furthermore, several studies showed that craniofacial defects can be rescued upon co-knockdown of Tp53 in mice, frog, and zebrafish [52,5658]. Therefore, we attempted to rescue the bop1 MO-induced phenotype at stage 42 by co-injecting tp53 MO, what failed (Fig 7I and 7J). This finding is in line with the above mentioned TUNEL experiments and indicates that the Bop1 deficiency phenotype is not a result of Tp53 pathway activation.

Conclusively, upon bop1 knockdown, pathways crucial during defective ribosomal biogenesis, e.g., proliferative and apoptotic pathways, are not impaired. This leads to the hypothesis of Bop1 –additionally to its role in ribosomal biogenesis–implementing a function independent of ribosomal biogenesis during early Xenopus development.

Bop1 functions together with Pax6

We further investigated Pax 6 since 1) Pax6 is a master control gene for eye development [59] and 2) pax6 expression was strongly reduced upon loss of Bop1 function at the early stage 13 (Figs 3 and 6) when Xenopus laevis embryos are independent of de novo ribosomal biogenesis due to a maternal supply of ribosomes, proteins, and mRNAs.

Previous studies have shown that Pax6 loss of function leads to a severe eye phenotype in Xenopus [40] which we confirmed. 15 ng and 30 ng pax6 MO injected into one animal-dorsal blastomere of eight-cell stage embryos led to smaller eyes and heads in more than 50% of the embryos similar to the bop1 knockdown phenotype. 30 ng Control MO injection did not reduce eye or head size (Fig 8A and 8B).

thumbnail
Fig 8. Pax6 and Bop1 act in the same signaling pathway.

A Xenopus laevis embryos were injected with 30 ng Control MO and 15 ng or 30 ng pax6 MO at eight-cell stage into one animal-dorsal blastomere. At stage 42, embryos were analyzed regarding a phenotype of the anterior tissue. pax6 MO injection resulted in smaller heads and eyes (white arrows). B Statistical evaluation of data given in A. C Embryos were injected at eight-cell stage with bop1 MO alone or in combination with pax6 RNA. Embryos were fixed at stage 42 and analyzed phenotypically. Smaller eyes are indicated with white arrow. D Injection of bop1 MO alone or in combination with pax6 RNA resulted in severe eye phenotypes. E Injection of 5 ng bop1 MO or 5 ng pax6 MO led to a mild eye phenotype in 15% and 27% of the embryos, respectively. The co-injection of both 5 ng bop1 MO and 5 ng pax6 MO resulted in a severe eye phenotype in a more than additive manner (73%). F Statistical analysis of data given in E. Black dotted line indicates sum of embryos showing an eye or head phenotype injected with 5 ng bop1 MO and 5 ng pax6 MO. Abbreviations: bop1 MO, block of proliferation 1 morpholino oligonucleotide; CoMO, Control MO; inj., injected side; MO, morpholino oligonucleotide; n, number of independent experiments; N, number of injected and analyzed embryos; n.s., non-significant; pax6 MO, paired box 6 morpholino oligonucleotide; uninj., uninjected side. Error bars indicate standard error of the means; *, p ≤ 0.05; **, p ≤ 0.01.

https://doi.org/10.1371/journal.pone.0273507.g008

To analyze a possible rescue mechanism, bop1 MO was injected alone and in combination with different amounts of pax6 RNA. A rescue via pax6 RNA co-injection was not possible (Fig 8C and 8D). Nevertheless, to characterize a possible common pathway of Bop1 and Pax6, 5 ng bop1 MO and 5 ng pax6 MO were injected alone or in combination into one animal-dorsal blastomere of eight-cell stage embryos. The injection of bop1 MO and pax6 MO alone led to a mild phenotype in 15% and 26% of the embryos, respectively. The combined injection of both low doses led to a more than additive eye phenotype in 75% of the embryos (Fig 8E and 8F) suggesting a common signaling pathway of the two molecules.

Discussion

Bop1 is required for processing the large rRNA precursor during ribosome biogenesis. Although Xenopus embryos possess a large maternal store of ribosomes, we found a tissue-specific expression of bop1 during early Xenopus embryogenesis. In loss-of-function experiments, proliferation as well as apoptosis were not impaired. However, we found a novel role of this protein during anterior development in that it affects tissue-specific gene expression, especially pax6, in a ribosomal independent way.

In our in-depth expression analysis, we provide the first detailed expression pattern of bop1. We showed that bop1 is expressed in neural tissue such as the NCCs, the brain, and the eyes. Of note, bop1 expression overlaps with the expression of rax and pax6 in the early eye anlage and with foxd3 at the neural plate border where the NCCs are induced. The here described detailed expression pattern in Xenopus is in accordance with earlier findings from Neilson et al. describing bop1 expression at stage 15 and 28 in Xenopus tropicalis [21]. In developing mice, bop1 expression was also found in the central nervous system, whole brain, and liver [60]. In human fetal tissue, BOP1 is highly expressed in the brain [6163]. In conclusion, the conserved expression of bop1 suggests a role of bop1 in early neural development.

Here, we showed that knockdown of bop1 in the anterior tissue of developing Xenopus laevis embryos leads to a smaller head width and cranial cartilage structures, a diminished brain size, and malformed and underdeveloped eyes. Our study also found changes in gene expression upon loss of Bop1 and thus provides first clues about the underlying molecular mechanisms. We detected bop1 expression in Xenopus anterior NCCs, and bop1 knockdown resulted in a broader expression domain for the pan-neural marker gene sox3, which was also confirmed using real-time qPCR. Rogers and colleagues already showed that overexpression of sox3 leads to a severe phenotype in cranial cartilage structures and disturbed formation and migration of NCCs in Xenopus laevis embryos [64]. In contrast, expression of sox2 was not affected upon bop1 knockdown, showing a specific affect for sox3. In our experiments, bop1 knockdown also resulted in a reduced foxd3 expression during induction of the neural plate border. Foxd3 has been shown to be required for the epithelial-mesenchymal transition (EMT) of NCCs [65]. Interestingly, BOP1 has been shown to be upregulated in patients with hepatocellular carcinoma as well as gastric cancer and that BOP1 induces EMT, which leads to higher invasiveness and metastasis potential [66,67]. In summary, these data suggest that proper function of Bop1 is required for EMT in general.

The expression of the brain marker genes otx2, en2, and egr2 is reduced upon bop1 knockdown. Besides its role in eye development, Otx2 is also essential for craniofacial development, and mutations in this gene have been associated with brain defects [68,69]. En2 plays an important role in the development of the brain, especially the cerebellum [70], and was found to be associated with infantile autism [71,72]. En2 knockout mice show dysregulation in monoamine systems and defects in forebrain structures [73]. Expression of Egr2 is associated with myelination of the peripheral nervous system and the hindbrain region [74], and mutations in the human EGR2 lead to hereditary myelinopathies [75]. Taken together, the reduction found in marker gene expression in Xenopus are in line with the observed NCC and brain phenotypes upon loss of Bop1 function.

Upon bop1 knockdown, retinal lamination is disturbed and different cell layers are disorganized. In a previous study, we showed that retinal lamination defects can result from inhibited cell adhesion [76], which might also be a possible reason for this phenotype in bop1 MO-injected embryos. Furthermore, we observed a downregulation of rax and otx2 during eye cell differentiation. Earlier studies by others indicated that mutations in rax lead to the problems in eye formation in Xenopus and mice [77]. Additionally, previous studies showed that mutations in human OTX2 and RAX lead to anophthalmia, microphthalmia, and coloboma [7781], findings that are in line with the eye phenotype upon bop1 knockdown in our study.

Upon bop1 knockdown using the CRISPR/Cas9 system, Xenopus laevis embryos showed eye phenotypes (microphthalmia) and head phenotypes. This is in accordance with our previous results using the antisense-based MO approach.

Our findings are also in line with defects observed upon changes in Bop1 interaction partners. In the developing zebrafish, mutations in Pes1, as part of the PeBoW complex, lead to a smaller brain, eye, gut, and liver and a failed expansion of the pancreas [82,83]. In Xenopus laevis, the knockdown of both pes1 and ppan (interaction partner of Pes1), also interferes with craniofacial cartilage and eye development [17,19]. The knockdown of the ribosomal biogenesis factor nucleolar protein 11 leads to a late craniofacial cartilage malformation [52]. Recently, we also have shown that loss of Rpl5 leads to craniofacial cartilage as well as eye defects [53]. In summary, suppression of these investigated ribosomal biogenesis factors (as shown in earlier studies) results in comparable phenotypes as shown for Bop1 in this study, i.e., a disrupted development of the cartilaginous head structures, the brain, and the eye. Interestingly, although the characteristics of these phenotypes differ somewhat from those found in ribosomopathies, they have a few features in common, including eye abnormalities and craniofacial dysmorphology [3,8490].

Knockdown of bop1 affects marker gene expression in very early stages of development, i.e., even before exhaustion of the maternal ribosome pool. Xenopus embryos possess a pool of around 1012 maternal ribosomes, as well as mRNAs and proteins, which together are sufficient for development until approximately stage 26 [16,19]. Therefore, in their first days of development Xenopus embryos are not dependent on zygotic ribosome biosynthesis. In line with this finding, we showed in previous work that interfering with the processing of the 45S rRNA precursor does not affect early development of Xenopus, in particular during neural and pronephric development [19].

At stage 15, we found GFP expression not to be affected in bop1 morphants, indicating that the translational machinery is not disturbed in general. This strengthens the hypothesis that Bop1 might have an additional, ribosomal independent function as the knockdown of this ribosomal factor does not affect the translational machinery and de novo ribosomal biogenesis is less important during early development due to the maternal store which is sufficient until swimming tadpole stage [12].

Analyzing proliferative and apoptotic processes via pH3 and TUNEL staining, we found that bop1 knockdown did neither affect proliferation nor apoptosis. This is not in line with the fact that ribosomes are crucial for cell proliferation. In a previous study, we were able to partially rescue an eye phenotype, which occurred upon knockdown of a ribosomal protein, with c-myc RNA [53]. Hence, we analyzed whether c-myc RNA, as transcriptional enhancer important for proliferation, can rescue the bop1 MO-induced phenotype. The phenotype was not rescued, again hinting towards a ribosomal independent function of Bop1.

In previous studies, Tp53 was found to be activated during pathological processes of ribosomal biogenesis, e.g., during Diamond-Blackfan anemia [9193]. Wu and colleagues demonstrated that lower BOP1 levels lead to decreased ribosome biogenesis, which results in Tp53-dependent proliferative inhibition, oxidative stress, and apoptosis in a human cell line [94]. This finding is in contrast with our findings because we found that the tp53 knockdown did not rescue the bop1 knockdown-associated phenotype. The divergent results can be explained by the theory that, as explained above, Xenopus embryos rely on maternal ribosomes during early development and that zygotic ribosome biogenesis does not start at a relevant rate until the mid-20 stages at the earliest [16]. Accordingly, as mentioned in the introduction, for the ribosomal factor Ppan we were able to show a Tp53-independent nucleolar stress response pathway [20]. In conclusion, we propose that the early defects observed in Xenopus in our study can probably not be explained by defective ribosomal biogenesis. Therefore, understanding the phenotype upon bop1 knockdown in Xenopus might provide novel insights into the pathogenesis of ribosomopathies.

Our findings of altered gene expression provide an indication of the underlying mechanism. We found that the expression of pax6 was reduced upon bop1 knockdown. Previous studies demonstrated that downregulation of Pax6 leads to smaller or absent eyes in Xenopus and mice [40,95,96], which is in line with our result that pax6 knockdown in anterior tissue leads to a similar phenotype as bop1 knockdown. A rescue using pax6 RNA was not possible. This might be due to the reason that other molecules and pathways, e.g., sox3- or foxd3-related pathways are affected upon bop1 knockdown as well. Nevertheless, by co-injecting bop1 MO and pax6 MO, we showed a synergistic relationship between Bop1 and Pax6. These results strengthen the hypothesis that Bop1 and Pax6 act in the same signaling pathway. Previous studies found that in mice and Xenopus, the overexpression of pax6 leads to several eye defects, including microphthalmia, ectopic eyes, and anophthalmia [97,98]. Also, mutations in human PAX6 lead to numerous eye defects, including aniridia, corneal opacification, and cataract [99]. In conclusion, our results alongside with previous studies by others, indicate that Pax6 expression needs to be finely balanced to ensure proper eye development and that the knockdown of bop1 and the resulting changes in pax6 expression might contribute to the bop1 MO-induced phenotype.

Conclusion and outlook

Taken together, we showed that Bop1 is crucial for Xenopus anterior development. The results demonstrated that loss of Bop1 phenotypes closely resembles the clinical manifestations of ribosomopathies. However, the early effect on embryonic development suggests an extra-ribosomal function of Bop1 via a Pax6-mediated mechanism.

Because Bop1 is a member of the PeBoW complex and the stability of each protein is interdependent, it would be of high interest to analyze the expression and behavior of the two complex partners Pes1 and WDR12 upon bop1 knockdown. How Bop1 regulates gene expression on a molecular level awaits further elucidation.

Supporting information

S1 Fig. Synteny analysis and comparison of block of proliferation 1 protein domains between different species.

A Synteny analysis of bop1 in Homo sapiens, Mus musculus, Xenopus laevis L, Xenopus laevis S, and Danio rerio. The genomic region next to bop1 is conserved across the different species. B, C Protein domains of block of proliferation 1 (Bop1). The BOP1 N-terminal (NT) domain is depicted in orange and the WD 40 repeat (WD 40) domain, in beige. D The protein length (number of amino acids), the overall homology (%), the Bop1 NT domain homology (%) and the WD40 domain homology (%) of Homo sapiens, Mus musculus, Xenopus laevis L, Xenopus laevis S, and Danio rerio were compared. Bop1 is highly conserved across species. Abbreviations: aa, amino acid; Bop1, block of proliferation 1.

https://doi.org/10.1371/journal.pone.0273507.s001

(TIFF)

S2 Fig. MO specificity and effectiveness test.

A Binding sites of bop1 MO (blue) and bop1 MO2 (turquoise) are highlighted in the Xenopus bop1 gene (L and S- form). The start codon is indicated in orange. B Binding sites of bop1 MO (on both homeologues), bop1 MO2 (on both homeologues), and the Δ5’UTR-bop1 construct on Xenopus bop1. Start codon is indicated in orange. Blue letters indicate differences between binding sites of chromosome S and chromosome L. Red letters indicate differences between binding sites of bop1 MO and Δ5’UTR-bop1. C Binding specificity test of bop1 MO. Injection of 10 ng Control MO along with 1 ng bop1 MO bs-GFP or 1 ng bop1 MO bs chr. L-GFP led to GFP translation. Co-injection of 10 ng bop1 MO along with 1 ng bop1 MO bs-GFP or with 1 ng bop1 MO bs chr. L-GFP efficiently blocked GFP expression. However, co-injection of Δ5’UTR-bop1 MO bs-GFP with bop1 MO led to GFP translation. D Binding specificity test of bop1 MO2. Injection of 10 ng Control MO together with 1 ng bop1 MO2 bs-GFP or with 1 ng bop1 MO2 bs chr. L-GFP resulted in GFP translation. In contrast, injection of bop1 MO2 together with either 1 ng bop1 MO2 bs-GFP or 1 ng bop1 MO2 bs chr. L-GFP blocked GFP translation. Numbers below fluorescence photos describe number of fluorescent embryos. Abbreviations: bop1 MO, block of proliferation 1 morpholino oligonucleotide; bs, binding site; CoMO, Control morpholino oligonucleotide; GFP, green fluorescent protein; UTR, untranslated region.

https://doi.org/10.1371/journal.pone.0273507.s002

(TIFF)

S3 Fig. Eye and head phenotype upon bop1 MO2 injection.

A Comparison of the head width of injected (red line) to un-injected (blue line) sides after bop1 MO2, Control MO, or bop1 MO2 together with 0.5 ng of Δ5’UTR-bop1 RNA injection at stage 42. B Statistical evaluation of data in A. The head size of the bop1 MO2-injected side was significantly reduced compared to the Control MO-injected and un-injected side. Co-injection of 0.5 ng of Δ5’UTR-bop1 RNA rescued the head phenotype. C Knockdown of bop1 by bop1 MO2 led to a severe eye phenotype, with underdeveloped or malformed eyes (black arrows) in stage 42 embryos. This eye phenotype was rescued upon co-injection of 0.5 ng Δ5’UTR-bop1 RNA. D Statistical evaluation of data in C. bop1 MO2, bop1 MO2 + Δ5’UTR-bop1 RNA and Control MO-injected side was compared to un-injected side of embryos. E The area of the eye was measured (red dotted circle). F Statistical analysis showed significantly smaller eyes in embryos injected with bop1 MO2. The phenotype was rescued in embryos injected with bop1 MO2 together with 0.5 ng Δ5’UTR-bop1 RNA. G The angle of eye fissure (red angle) was measured and bop1 MO2, bop1 MO2 + Δ5’UTR-bop1 RNA and Control MO-injected embryos were compared to the uninjected side. H Embryos developed colobomas upon bop1 MO2 injection, whereas co-injection of 0.5 ng Δ5’UTR-bop1 RNA rescued this coloboma phenotype. Abbreviations: bop1 MO2, block of proliferation 1 morpholino oligonucleotide 2; CoMO, Control MO; inj., injected side; MO, morpholino oligonucleotide; n, number of independent experiments; N, number of injected and analyzed embryos; uninj., un-injected side. bop1 is the Δ5’UTR-bop1 RNA used for rescues. Error bars indicate standard error of the means; Whiskers in D indicate minimum and maximum. **, p <0.01; ***, p < 0.001; ****, p < 0.0001.

https://doi.org/10.1371/journal.pone.0273507.s003

(TIFF)

S4 Fig. Overexpressing bop1 does not affect anterior development in Xenopus laevis. bop1 knockdown-associated phenotype is not rescued by co-injecting foxd3 RNA.

A Overexpression of bop1 did not result in a phenotype of anterior neural tissue in stage 42 embryos. bop1 RNA and GFP RNA-injected side was compared to un-injected side of embryos. B Statistical evaluation of data given in A. C Co-injection of bop1 MO and foxd3 RNA did not rescue the cranial cartilage phenotype. bop1 MO, Control MO, and bop1 MO + foxd3 RNA-injected side was compared to un-injected side of stage 45 embryos. Black arrows indicate a smaller cranial cartilage. D Statistical evaluation of data in C. E Alcian blue stained cranial cartilages of stage 45 embryos showed a reduced cartilage upon bop1 MO and bop1 MO + foxd3 RNA injection. Branchial arches (ba), Meckel´s cartilage (mc), tectum anterius (ta) were mostly affected (black arrows). Abbreviations: ba, branchial arches; bop1 MO, block of proliferation 1 morpholino oligonucleotide; CoMO, Control MO; GFP, green fluorescent protein; inj., injected side; mc, Meckel´s cartilage; MO, morpholino oligonucleotide; n, number of independent experiments; N, number of injected and analyzed embryos; n.s., non-significant; ta, tectum anterius; uninj., un-injected side. Error bars indicate standard error of the means; ****, p<0.0001.

https://doi.org/10.1371/journal.pone.0273507.s004

(TIFF)

Acknowledgments

We thank Anja Werberger, Tamara Moser, and Melissa Lock for technical assistance and Thomas Pieler for providing plasmids. Furthermore, we thank Jacquie Klesing, Board-certified Editor in the Life Sciences (ELS), for editing assistance with the manuscript.

Ethical approval

All applicable international, national and institutional guidelines for the care and use of animals were followed.

References

  1. 1. Melnikov S, Ben-Shem A, Garreau de Loubresse N, Jenner L, Yusupova G, Yusupov M. One core, two shells: bacterial and eukaryotic ribosomes. Nat Struct Mol Biol. 2012;19: 560–567. pmid:22664983
  2. 2. Farley-Barnes KI, Ogawa LM, Baserga SJ. Ribosomopathies: Old Concepts, New Controversies. Trends Genet. 2019;35: 754–767. pmid:31376929
  3. 3. Narla A, Ebert BL. Ribosomopathies: human disorders of ribosome dysfunction. Blood. 2010;115: 3196–3205. pmid:20194897
  4. 4. Jenner L, Melnikov S, de Loubresse NG, Ben-Shem A, Iskakova M, Urzhumtsev A, et al. Crystal structure of the 80S yeast ribosome. Curr Opin Struct Biol. 2012;22: 759–767. pmid:22884264
  5. 5. Kressler D, Hurt E, Baßler J. A Puzzle of Life: Crafting Ribosomal Subunits. Trends Biochem Sci. 2017;42: 640–654. pmid:28579196
  6. 6. Strezoska Ž, Pestov DG, Lau LF. Bop1 Is a Mouse WD40 Repeat Nucleolar Protein Involved in 28S and 5.8S rRNA Processing and 60S Ribosome Biogenesis. Mol Cell Biol. 2000;20: 5516–5528. pmid:10891491
  7. 7. Hölzel M, Rohrmoser M, Schlee M, Grimm T, Harasim T, Malamoussi A, et al. Mammalian WDR12 is a novel member of the Pes1–Bop1 complex and is required for ribosome biogenesis and cell proliferation. J Cell Biol. 2005;170: 367–378. pmid:16043514
  8. 8. Rohrmoser M, Hölzel M, Grimm T, Malamoussi A, Harasim T, Orban M, et al. Interdependence of Pes1, Bop1, and WDR12 Controls Nucleolar Localization and Assembly of the PeBoW Complex Required for Maturation of the 60S Ribosomal Subunit. Mol Cell Biol. 2007;27: 3682–3694. pmid:17353269
  9. 9. Pestov DG, Strezoska Ž, Lau LF. Evidence of p53-Dependent Cross-Talk between Ribosome Biogenesis and the Cell Cycle: Effects of Nucleolar Protein Bop1 on G1/S Transition. Mol Cell Biol. 2001;21: 4246–4255. pmid:11390653
  10. 10. Strezoska Ž, Pestov DG, Lau LF. Functional Inactivation of the Mouse Nucleolar Protein Bop1 Inhibits Multiple Steps in Pre-rRNA Processing and Blocks Cell Cycle Progression. J Biol Chem. 2002;277: 29617–29625. pmid:12048210
  11. 11. Liu R, Iadevaia V, Averous J, Taylor PM, Zhang Z, Proud CG. Impairing the production of ribosomal RNA activates mammalian target of rapamycin complex 1 signalling and downstream translation factors. Nucleic Acids Res. 2014;42: 5083–5096. pmid:24526220
  12. 12. Brown DD, Gurdon JB. ABSENCE OF RIBOSOMAL RNA SYNTHESIS IN THE ANUCLEOLATE MUTANT OF XENOPUS LAEVIS. Proc Natl Acad Sci. 1964;51: 139–146. pmid:14106673
  13. 13. Wallace H. The development of anucleolate embryos of Xenopus laevis. J Embryol Exp Morphol. 1960;8: 405–413. pmid:13782791
  14. 14. Brown DD. RNA SYNTHESIS DURING AMPHIBIAN DEVELOPMENT. J Exp Zool. 1964;157: 101–117. pmid:14220207
  15. 15. Busby SJ, Reeder RH. Fate of amplified nucleoli in Xenopus laevis embryos. Dev Biol. 1982;91: 458–467. pmid:7201429
  16. 16. Pierandrei-Amaldi P, Amaldi F. Aspects of regulation of ribosomal protein synthesis inXenopus laevis: Review. Genetica. 1994;94: 181–193. pmid:7896138
  17. 17. Gessert S, Maurus D, Rössner A, Kühl M. Pescadillo is required for Xenopus laevis eye development and neural crest migration. Dev Biol. 2007;310: 99–112. pmid:17727835
  18. 18. Tecza A, Bugner V, Kühl M, Kühl SJ. Pescadillo homologue 1 and Peter Pan function during Xenopus laevis pronephros development. Biol Cell. 2011;103: 483–498. pmid:21770895
  19. 19. Bugner V, Tecza A, Gessert S, Kuhl M. Peter Pan functions independently of its role in ribosome biogenesis during early eye and craniofacial cartilage development in Xenopus laevis. Development. 2011;138: 2369–2378. pmid:21558383
  20. 20. Pfister AS, Keil M, Kühl M. The Wnt Target Protein Peter Pan Defines a Novel p53-independent Nucleolar Stress-Response Pathway. J Biol Chem. 2015;290: 10905–10918. pmid:25759387
  21. 21. Neilson KM, Pignoni F, Yan B, Moody SA. Developmental expression patterns of candidate cofactors for vertebrate six family transcription factors. Dev Dyn. 2010;239: 3446–3466. pmid:21089078
  22. 22. Sive HL, Graininger RM, Harland RM. Early development of Xenopus laevis: a laboratory manual. New York: Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press; 2000.
  23. 23. Nieuwkoop PD, Faber J, editors. Normal table of Xenopus laevis (Daudin): a systematical and chronological survey of the development from the fertilized egg till the end of metamorphosis. North-Hollund Pub. Co.; 1954.
  24. 24. Hemmati-Brivanlou A, Frank D, Bolce ME, Brown BD, Sive HL, Harland RM. Localization of specific mRNAs in Xenopus embryos by whole-mount in situ hybridization. Dev Camb Engl. 1990;110: 325–330. pmid:1723941
  25. 25. Lufkin T. In Situ Hybridization of Whole-Mount Mouse Embryos with RNA Probes: Hybridization, Washes, and Histochemistry. Cold Spring Harb Protoc. 2007;2007: pdb.prot4823. pmid:21356976
  26. 26. Day RC, Beck CW. Transdifferentiation from cornea to lens in Xenopus laevis depends on BMP signalling and involves upregulation of Wnt signalling. BMC Dev Biol. 2011;11: 54. pmid:21896182
  27. 27. Cizelsky W, Hempel A, Metzig M, Tao S, Hollemann T, Kühl M, et al. sox4 And sox11 Function during Xenopus laevis Eye Development. Kumar J, editor. PLoS ONE. 2013;8: e69372. pmid:23874955
  28. 28. Hemmati-Brivanlou A, de la Torre JR, Holt C, Harland RM. Cephalic expression and molecular characterization of Xenopus En-2. Dev Camb Engl. 1991;111: 715–724. pmid:1679005
  29. 29. Pohl BS, Knöchel W. Overexpression of the transcriptional repressor FoxD3 prevents neural crest formation in Xenopus embryos. Mech Dev. 2001;103: 93–106. pmid:11335115
  30. 30. Lamb TM, Knecht AK, Smith WC, Stachel SE, Economides AN, Stahl N, et al. Neural induction by the secreted polypeptide noggin. Science. 1993;262: 713–718. pmid:8235591
  31. 31. Hitchcock PF, Macdonald RE, VanDeRyt JT, Wilson SW. Antibodies against Pax6 immunostain amacrine and ganglion cells and neuronal progenitors, but not rod precursors, in the normal and regenerating retina of the goldfish. J Neurobiol. 1996;29: 399–413. pmid:8907167
  32. 32. Hollemann T, Bellefroid E, Pieler T. The Xenopus homologue of the Drosophila gene tailless has a function in early eye development. Dev Camb Engl. 1998;125: 2425–2432.
  33. 33. Liu W, Khare SL, Liang X, Peters MA, Liu X, Cepko CL, et al. All Brn3 genes can promote retinal ganglion cell differentiation in the chick. Dev Camb Engl. 2000;127: 3237–3247. pmid:10887080
  34. 34. Dyer MA, Livesey FJ, Cepko CL, Oliver G. Prox1 function controls progenitor cell proliferation and horizontal cell genesis in the mammalian retina. Nat Genet. 2003;34: 53–58. pmid:12692551
  35. 35. Furukawa T, Kozak CA, Cepko CL. rax, a novel paired-type homeobox gene, shows expression in the anterior neural fold and developing retina. Proc Natl Acad Sci U S A. 1997;94: 3088–3093. pmid:9096350
  36. 36. Maurus D, Héligon C, Bürger-Schwärzler A, Brändli AW, Kühl M. Noncanonical Wnt-4 signaling and EAF2 are required for eye development in Xenopus laevis. EMBO J. 2005;24: 1181–1191. pmid:15775981
  37. 37. Hayashi T, Huang J, Deeb SS. RINX(VSX1), a Novel Homeobox Gene Expressed in the Inner Nuclear Layer of the Adult Retina. Genomics. 2000;67: 128–139. pmid:10903837
  38. 38. Chang WS, Harris WA. Sequential genesis and determination of cone and rod photoreceptors in Xenopus. J Neurobiol. 1998;35: 227–244. pmid:9622007
  39. 39. Cordenonsi M, Dupont S, Maretto S, Insinga A, Imbriano C, Piccolo S. Links between tumor suppressors: p53 is required for TGF-beta gene responses by cooperating with Smads. Cell. 2003;113: 301–314. pmid:12732139
  40. 40. Rungger-Brändle E, Ripperger JA, Steiner K, Conti A, Stieger A, Soltanieh S, et al. Retinal patterning by Pax6-dependent cell adhesion molecules. Dev Neurobiol. 2010;70: 764–780. pmid:20556827
  41. 41. Mughal BB, Leemans M, Spirhanzlova P, Demeneix B, Fini J-B. Reference gene identification and validation for quantitative real-time PCR studies in developing Xenopus laevis. Sci Rep. 2018;8: 496. pmid:29323148
  42. 42. Kietzmann A, Wang Y, Weber D, Steinbeisser H. Xenopus paraxial protocadherin inhibits Wnt/β-catenin signalling via casein kinase 2β. EMBO Rep. 2012;13: 129–134. pmid:22193776
  43. 43. Riedel G, Rüdrich U, Fekete-Drimusz N, Manns MP, Vondran FWR, Bock M. An extended ΔCT-method facilitating normalisation with multiple reference genes suited for quantitative RT-PCR analyses of human hepatocyte-like cells. PloS One. 2014;9: e93031. pmid:24658132
  44. 44. Moreno-Mateos MA, Vejnar CE, Beaudoin J-D, Fernandez JP, Mis EK, Khokha MK, et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nat Methods. 2015;12: 982–988. pmid:26322839
  45. 45. Nakayama T, Blitz IL, Fish MB, Odeleye AO, Manohar S, Cho KWY, et al. Cas9-based genome editing in Xenopus tropicalis. Methods Enzymol. 2014;546: 355–375. pmid:25398349
  46. 46. Gessert S, Maurus D, Brade T, Walther P, Pandur P, Kühl M. DM-GRASP/ALCAM/CD166 is required for cardiac morphogenesis and maintenance of cardiac identity in first heart field derived cells. Dev Biol. 2008;321: 150–161. pmid:18598690
  47. 47. Session AM, Uno Y, Kwon T, Chapman JA, Toyoda A, Takahashi S, et al. Genome evolution in the allotetraploid frog Xenopus laevis. Nature. 2016;538: 336–343. pmid:27762356
  48. 48. Moody SA, Kline MJ. Segregation of fate during cleavage of frog (Xenopus laevis) blastomeres. Anat Embryol (Berl). 1990;182: 347–362. pmid:2252221
  49. 49. Jacobson M. Developmental Neurobiology. Boston, MA: Springer US; 1991. https://doi.org/10.1007/978-1-4757-4954-0
  50. 50. Bylund M, Andersson E, Novitch BG, Muhr J. Vertebrate neurogenesis is counteracted by Sox1–3 activity. Nat Neurosci. 2003;6: 1162–1168. pmid:14517545
  51. 51. Zuber ME. Specification of the vertebrate eye by a network of eye field transcription factors. Development. 2003;130: 5155–5167. pmid:12944429
  52. 52. Griffin JN, Sondalle SB, del Viso F, Baserga SJ, Khokha MK. The Ribosome Biogenesis Factor Nol11 Is Required for Optimal rDNA Transcription and Craniofacial Development in Xenopus. Trainor PA, editor. PLOS Genet. 2015;11: e1005018. pmid:25756904
  53. 53. Schreiner C, Kernl B, Dietmann P, Riegger RJ, Kühl M, Kühl SJ. The Ribosomal Protein L5 Functions During Xenopus Anterior Development Through Apoptotic Pathways. Front Cell Dev Biol. 2022;10: 777121. pmid:35281111
  54. 54. Bellmeyer A, Krase J, Lindgren J, LaBonne C. The protooncogene c-myc is an essential regulator of neural crest formation in xenopus. Dev Cell. 2003;4: 827–839. pmid:12791268
  55. 55. Dai M-S, Lu H. Inhibition of MDM2-mediated p53 ubiquitination and degradation by ribosomal protein L5. J Biol Chem. 2004;279: 44475–44482. pmid:15308643
  56. 56. Calo E, Gu B, Bowen ME, Aryan F, Zalc A, Liang J, et al. Tissue-selective effects of nucleolar stress and rDNA damage in developmental disorders. Nature. 2018;554: 112–117. pmid:29364875
  57. 57. Jones NC, Lynn ML, Gaudenz K, Sakai D, Aoto K, Rey J-P, et al. Prevention of the neurocristopathy Treacher Collins syndrome through inhibition of p53 function. Nat Med. 2008;14: 125–133. pmid:18246078
  58. 58. Zhao C, Andreeva V, Gibert Y, LaBonty M, Lattanzi V, Prabhudesai S, et al. Tissue Specific Roles for the Ribosome Biogenesis Factor Wdr43 in Zebrafish Development. DeKoeyer Crump G, editor. PLoS Genet. 2014;10: e1004074. pmid:24497835
  59. 59. Shaham O, Menuchin Y, Farhy C, Ashery-Padan R. Pax6: a multi-level regulator of ocular development. Prog Retin Eye Res. 2012;31: 351–376. pmid:22561546
  60. 60. Yue F, Cheng Y, Breschi A, Vierstra J, Wu W, Tyrone Ryba, et al. A comparative encyclopedia of DNA elements in the mouse genome. Nature. 2014;515: 355–364. pmid:25409824
  61. 61. Duff MO, Olson S, Wei X, Garrett SC, Osman A, Bolisetty M, et al. Genome-wide identification of zero nucleotide recursive splicing in Drosophila. Nature. 2015;521: 376–379. pmid:25970244
  62. 62. Fagerberg L, Hallström BM, Oksvold P, Kampf C, Djureinovic D, Odeberg J, et al. Analysis of the Human Tissue-specific Expression by Genome-wide Integration of Transcriptomics and Antibody-based Proteomics. Mol Cell Proteomics. 2014;13: 397–406. pmid:24309898
  63. 63. The Human Protein Atlas, BOP1 available from v21.0.proteinatlas.org. 2022. Available: https://www.proteinatlas.org/ENSG00000261236-BOP1/tissue.
  64. 64. Rogers CD, Harafuji N, Archer T, Cunningham DD, Casey ES. Xenopus Sox3 activates sox2 and geminin and indirectly represses Xvent2 expression to induce neural progenitor formation at the expense of non-neural ectodermal derivatives. Mech Dev. 2009;126: 42–55. pmid:18992330
  65. 65. Fairchild CL, Conway JP, Schiffmacher AT, Taneyhill LA, Gammill LS. FoxD3 regulates cranial neural crest EMT via downregulation of tetraspanin18 independent of its functions during neural crest formation. Mech Dev. 2014;132: 1–12. pmid:24582980
  66. 66. Chung K-Y, Cheng IK-C, Ching AK-K, Chu J-H, Lai PB-S, Wong N. Block of proliferation 1 (BOP1) plays an oncogenic role in hepatocellular carcinoma by promoting epithelial-to-mesenchymal transition. Hepatology. 2011;54: 307–318. pmid:21520196
  67. 67. He J, Chen Z, Xue Q, Shi W. Block of Proliferation 1 Promotes Proliferation, Invasion and Epithelial Mesenchymal Transformation in Gastric Cancer. Oxid Med Cell Longev. 2022;2022: 2946989. pmid:35222794
  68. 68. Boon K, Eberhart CG, Riggins GJ. Genomic amplification of orthodenticle homologue 2 in medulloblastomas. Cancer Res. 2005;65: 703–707. pmid:15705863
  69. 69. de Haas T, Oussoren E, Grajkowska W, Perek-Polnik M, Popovic M, Zadravec-Zaletel L, et al. OTX1 and OTX2 Expression Correlates With the Clinicopathologic Classification of Medulloblastomas: J Neuropathol Exp Neurol. 2006;65: 176–186. pmid:16462208
  70. 70. Orvis GD, Hartzell AL, Smith JB, Barraza LH, Wilson SL, Szulc KU, et al. The engrailed homeobox genes are required in multiple cell lineages to coordinate sequential formation of fissures and growth of the cerebellum. Dev Biol. 2012;367: 25–39. pmid:22564796
  71. 71. Benayed R, Gharani N, Rossman I, Mancuso V, Lazar G, Kamdar S, et al. Support for the Homeobox Transcription Factor Gene ENGRAILED 2 as an Autism Spectrum Disorder Susceptibility Locus. Am J Hum Genet. 2005;77: 851–868. pmid:16252243
  72. 72. Petit E, Herault J, Martineau J, Perrot A, Barthelemy C, Hameury L, et al. Association study with two markers of a human homeogene in infantile autism. J Med Genet. 1995;32: 269–274. pmid:7643354
  73. 73. Genestine M, Lin L, Durens M, Yan Y, Jiang Y, Prem S, et al. Engrailed-2 (En2) deletion produces multiple neurodevelopmental defects in monoamine systems, forebrain structures and neurogenesis and behavior. Hum Mol Genet. 2015;24: 5805–5827. pmid:26220976
  74. 74. Zorick TS, Syroid DE, Arroyo E, Scherer SS, Lemke G. The Transcription Factors SCIP and Krox-20 Mark Distinct Stages and Cell Fates in Schwann Cell Differentiation. Mol Cell Neurosci. 1996;8: 129–145.
  75. 75. Warner LE, Mancias P, Butler IJ, McDonald CM, Keppen L, Koob KG, et al. Mutations in the early growth response 2 (EGR2) gene are associated with hereditary myelinopathies. Nat Genet. 1998;18: 382–384. pmid:9537424
  76. 76. Seigfried FA, Cizelsky W, Pfister AS, Dietmann P, Walther P, Kühl M, et al. Frizzled 3 acts upstream of Alcam during embryonic eye development. Dev Biol. 2017;426: 69–83. pmid:28427856
  77. 77. Bailey TJ, El-Hodiri H, Zhang L, Shah R, Mathers EH, Jamrich M. Regulation of vertebrate eye development by Rx genes. Int J Dev Biol. 2004;48: 761–770. pmid:15558469
  78. 78. Deml B, Reis LM, Lemyre E, Clark RD, Kariminejad A, Semina EV. Novel mutations in PAX6, OTX2 and NDP in anophthalmia, microphthalmia and coloboma. Eur J Hum Genet. 2016;24: 535–541. pmid:26130484
  79. 79. Lequeux L, Rio M, Vigouroux A, Titeux M, Etchevers H, Malecaze F, et al. Confirmation of RAX gene involvement in human anophthalmia. Clin Genet. 2008;74: 392–395. pmid:18783408
  80. 80. London NJS, Kessler P, Williams B, Pauer GJ, Hagstrom SA, Traboulsi EI. Sequence alterations in RX in patients with microphthalmia, anophthalmia, and coloboma. Mol Vis. 2009;15: 162–167. pmid:19158959
  81. 81. Ragge NK, Brown AG, Poloschek CM, Lorenz B, Henderson RA, Clarke MP, et al. Heterozygous Mutations of OTX2 Cause Severe Ocular Malformations. Am J Hum Genet. 2005;76: 1008–1022. pmid:15846561
  82. 82. Allende ML, Amsterdam A, Becker T, Kawakami K, Gaiano N, Hopkins N. Insertional mutagenesis in zebrafish identifies two novel genes, pescadillo and dead eye, essential for embryonic development. Genes Dev. 1996;10: 3141–3155. pmid:8985183
  83. 83. Lerch-Gaggl A, Haque J, Li J, Ning G, Traktman P, Duncan SA. Pescadillo Is Essential for Nucleolar Assembly, Ribosome Biogenesis, and Mammalian Cell Proliferation. J Biol Chem. 2002;277: 45347–45355. pmid:12237316
  84. 84. Brooks SS, Wall AL, Golzio C, Reid DW, Kondyles A, Willer JR, et al. A novel ribosomopathy caused by dysfunction of RPL10 disrupts neurodevelopment and causes X-linked microcephaly in humans. Genetics. 2014;198: 723–733. pmid:25316788
  85. 85. Jenkinson EM, Rodero MP, Kasher PR, Uggenti C, Oojageer A, Goosey LC, et al. Mutations in SNORD118 cause the cerebral microangiopathy leukoencephalopathy with calcifications and cysts. Nat Genet. 2016;48: 1185–1192. pmid:27571260
  86. 86. Kostjukovits S, Klemetti P, Valta H, Martelius T, Notarangelo LD, Seppänen M, et al. Analysis of clinical and immunologic phenotype in a large cohort of children and adults with cartilage-hair hypoplasia. J Allergy Clin Immunol. 2017;140: 612–614.e5. pmid:28284971
  87. 87. Myers KC, Bolyard AA, Otto B, Wong TE, Jones AT, Harris RE, et al. Variable Clinical Presentation of Shwachman–Diamond Syndrome: Update from the North American Shwachman–Diamond Syndrome Registry. J Pediatr. 2014;164: 866–870. pmid:24388329
  88. 88. Ross AP, Zarbalis KS. The emerging roles of ribosome biogenesis in craniofacial development. Front Physiol. 2014;5. pmid:24550838
  89. 89. Shwachman H, Diamond LK, Oski FA, Khaw KT. THE SYNDROME OF PANCREATIC INSUFFICIENCY AND BONE MARROW DYSFUNCTION. J Pediatr. 1964;65: 645–663. pmid:14221166
  90. 90. Vlachos A, Osorio DS, Atsidaftos E, Kang J, Lababidi ML, Seiden HS, et al. Increased Prevalence of Congenital Heart Disease in Children With Diamond Blackfan Anemia Suggests Unrecognized Diamond Blackfan Anemia as a Cause of Congenital Heart Disease in the General Population: A Report of the Diamond Blackfan Anemia Registry. Circ Genomic Precis Med. 2018;11. pmid:29748317
  91. 91. Gazda HT, Sheen MR, Vlachos A, Choesmel V, O’Donohue M-F, Schneider H, et al. Ribosomal protein L5 and L11 mutations are associated with cleft palate and abnormal thumbs in Diamond-Blackfan anemia patients. Am J Hum Genet. 2008;83: 769–780. pmid:19061985
  92. 92. Molavi G, Samadi N, Hosseingholi EZ. The roles of moonlight ribosomal proteins in the development of human cancers. J Cell Physiol. 2019;234: 8327–8341. pmid:30417503
  93. 93. Zhou X, Liao W-J, Liao J-M, Liao P, Lu H. Ribosomal proteins: functions beyond the ribosome. J Mol Cell Biol. 2015;7: 92–104. pmid:25735597
  94. 94. Wu Q, Hong J, Wang Z, Hu J, Chen R, Hu Z, et al. Abnormal Ribosome Biogenesis Partly Induced p53-Dependent Aortic Medial Smooth Muscle Cell Apoptosis and Oxidative Stress. Oxid Med Cell Longev. 2019;2019: 1–19. pmid:31210846
  95. 95. Georgala PA, Carr CB, Price DJ. The role of Pax6 in forebrain development. Dev Neurobiol. 2011;71: 690–709. pmid:21538923
  96. 96. Hill RE, Favor J, Hogan BLM, Ton CCT, Saunders GF, Hanson IM, et al. Mouse Small eye results from mutations in a paired-like homeobox-containing gene. Nature. 1991;354: 522–525. pmid:1684639
  97. 97. Schedl A, Ross A, Lee M, Engelkamp D, Rashbass P, van Heyningen V, et al. Influence of PAX6 Gene Dosage on Development: Overexpression Causes Severe Eye Abnormalities. Cell. 1996;86: 71–82. pmid:8689689
  98. 98. Chow RL, Altmann CR, Lang RA, Hemmati-Brivanlou A. Pax6 induces ectopic eyes in a vertebrate. Dev Camb Engl. 1999;126: 4213–4222.
  99. 99. Cvekl A, Callaerts P. PAX6: 25th anniversary and more to learn. Exp Eye Res. 2017;156: 10–21. pmid:27126352