Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

In silico analyses of leptin and leptin receptor of spotted snakehead Channa punctata

  • Amrita Bakshi,

    Roles Data curation, Formal analysis, Investigation, Methodology, Validation, Visualization, Writing – original draft

    Affiliation Department of Zoology, University of Delhi, Delhi, India

  • Umesh Rai

    Roles Conceptualization, Funding acquisition, Project administration, Resources, Software, Supervision, Writing – review & editing

    rai_u@rediffmail.com

    Affiliation Department of Zoology, University of Delhi, Delhi, India

Abstract

The present study, in addition to molecular characterization of leptin (lepa) and its receptor (lepr) of spotted snakehead Channa punctata, is focussed on physicochemical, structural, evolutionary and selection pressure analyses which are poorly elucidated in teleosts in spite of that existence of these genes is well reported in several fish species. The putative full-length Lep and Lepr of C. punctata showed conserved structural and functional domains, especially the residues responsible for structural integrity and signal transduction. Conversely, residues predicted essential for Lep-Lepr interaction displayed divergence between teleosts and tetrapods. Impact of substitutions/deletions predicted using protein variation effect analyser tool highlighted species specificity in ligand-receptor interaction. Physicochemical properties of ligand and receptor predicted for the first time in vertebrates revealed high aliphatic and instability indices for both Lepa and Lepr, indicating thermostability of proteins but their instability under ex vivo conditions. Positive grand average of hydropathy score of Lepa suggests its hydrophobic nature conjecturing existence of leptin binding proteins in C. punctata. In addition to disulphide bonding, a novel posttranslational modification (S-126 phosphorylation) was predicted in Lepa of C. punctata. In Lepr, disulphide bond formation and N-linked glycosylation near WSXWS motif in ECD, and phosphorylation at tyrosine residues in ICD were predicted. Leptin and its receptor sequence of C. punctata cladded with its homolog from C. striata and C. argus of order Anabantiformes. Leptin system of Anabantiformes was phylogenetically closer to that of Pleuronectiformes, Scombriformes and Perciformes. Selection pressure analysis showed higher incidence of negative selection in teleostean leptin genes indicating limited adaptation in their structure and function. However, evidence of pervasive and episodic diversifying selection laid a foundation of co-evolution of Lepa and Lepr in teleosts.

Introduction

The snakeheads also known as murrels are highly priced due to nutritional and medicinal importance. To encourage their cultivation, Indian Council of Agricultural Research has started producing their hatchlings [1]. Nonetheless, slow growth rate, poor fecundity and cannibalism discourage farmers from extensive culturing of murrels. Henceforth, the current study is focussed on leptin system which plays critical role in regulating feeding behaviour, reproduction and energy homeostasis in vertebrates [2]. In teleosts, existence of leptin (lep) has been first demonstrated in pufferfish Takifugu rubripes [3] and leptin receptor (lepr) in medaka Oryzias melastigma [4]. Thereafter, several studies have reported the presence of lep and lepr in a number of fishes belonging to family Salmonidae, Cyprinidae, Moronidae, Scophthalmidae, Syngnathidae and Scombridae [5, 6]. In case of Channidae, a single study is available on lep [7] while no report exists with regard to lepr. Thereby, molecular characterization and computational analysis of leptin and leptin receptor was carried in spotted snakehead Channa punctata. The Channa punctata (Bloch, 1793) is a member of family Channidae (Fowler, 1934) which is classified under suborder Channoidei (Berg, 1940). The suborders Anabantidae (Berg, 1940) and Channoidei are recognized under the order of freshwater ray-finned fishes, Anabantiformes. This order, consisting of at least 207 fish species, belongs to a monophyletic clade which is a sister clade of orders Synbranchiformes, Pleuronectiformes, Carangiformes and Istiophoriformes [8, 9].

The notion of evolution of leptin and leptin receptor emerges from the fact that leptin system is present across the vertebrates. Leptin genes are highly divergent in teleosts due to genome duplication, a key event responsible for increase in gene repertoire [10]. A number of fishes belonging to order Cichliformes, Perciformes and Beloniformes possess two paralogs of leptin (lepa, lepb) [1113] while four paralogs of lep (lepa1, lepa2, lepb1, lepb2) exist in Cypriniformes and Salmoniformes fishes [1416]. Among Anabantiformes, two leptin paralogs, lepa and lepb, have been reported in Northern snakehead Channa argus (7; nucleotide percentage identity between lepa and lepb = 44.76%, Clustal Omega) though only lepa has been demonstrated so far in the available transcriptome data of stripped snakehead Channa striata [17]. One of the paralogs is believed to be lost during the course of evolution as a single lep gene is demonstrated in the genome of Tetraodontiformes [3, 11]. Interestingly, low amino acid similarity (18% to 30%) is reported between lepa and lepb of a same species [2]. The paralogs of lepr are reported only in European eel Anguilla anguilla [18] and Asian arowana Scleropages formosus (Accession No. XP018609810 and KPP63040) and its isoforms have been demonstrated in Atlantic salmon Salmo salar [16], crucian carp Carassius carassius [19] and rainbow trout Oncorhynchus mykiss [20]. Regarding factors implicated in driving evolution of leptin, several reports are available in mammals [2124] while least attention has been paid to non-mammalian vertebrates [6]. In teleosts, a single study exists in which negative selection pressure is implicated in evolution of leptin gene [25]. Surprisingly, study on factors directing molecular evolution of leptin receptor gene is meagre in mammals [23, 26] while completely missing in fishes. Henceforth, the current study was undertaken to examine the conservation of residues/domains in leptin and its receptor for developing better understanding of functional and evolutionary aspects of leptin system in fishes. Also, selection pressure analysis was carried out to denote the sites or branches undergoing diversifying/purifying selection that would have shaped the evolution of teleostean leptin system.

Material and methods

Sequence retrieval, transcript identification and sequence validation

Testicular transcriptome data of C. punctata (NCBI bioproject accession number PRJNA304088) [27] annotated using protein sequence database of rat Rattus norvegicus and fishes Takifugu rubripes and Oreochromis niloticus was used to retrieve the longest nucleotide sequences of lep and lepr. Also, the transcriptome data of C. punctata was annotated using nucleotide (NCBI accession No. MK559418.1; 7) and protein (NCBI accession No. ASW18438.1; 7) sequences of lepb of C. argus. The selected transcript of lep showed highest percentage identity with sequence of lepa from T. rubripes while lepr with that of R. norvegicus. Thereafter, open reading frame (ORF) finder [28] was applied to find coding sequence (cds) of lepa and lepr. Nucleotide BLAST (BLASTn) analysis revealed that the transcript of lepr encoded partial sequence at 5’ end while of lepa encoded a putative full-length sequence.

Cloning of leptin receptor (full-length lepr)

For rapid amplification of cDNA to obtain full-length sequence of lepr of C. punctata, 5’ RACE primer [5’ CGCTCTCATCCTCTACCCACAAGTC 3’; annealing temperature = 68.3 οC; product length = 644 base pairs (bp)] was designed using Gene Runner, Hastings software Inc. [29]. To make cDNA, SMARTerTM RACE cDNA amplification kit [# 684924, Clontech, Takara Biotechnology (Dalian) Co., Ltd.] was used following manufacturer’s instructions. Briefly, 2 μl first strand buffer (5X), 1 μl dithiothreitol (20 mM) and 1 μl dNTP mix (10 mM) were mixed in tube A. After incubation at room temperature, RNase inhibitor (0.25 μl) and SMART Scribe reverse transcriptase (1 μl) were added. In another tube (tube B), 2 μg RNA isolated from midbrain of male C. punctata using TRI reagent was mixed with 1 μl 5’-cds primer A and total volume was adjusted to 3.75 μl with sterile water. The RNA containing tube B was incubated initially at 72 οC for 3 min and then at 42 οC for 2 min in a hot-lid thermocycler. After centrifugation at 14,000 g for 10 s, one microliter of SMART IITM A oligonucleotide was added. After spinning, content of tube B was mixed with tube A and kept at 42 οC for 90 min followed by incubation at 70 οC for 10 min in a thermocycler. Finally, tricine-EDTA buffer (50 μl) was added and cDNA thus prepared was stored at -20 οC until further use.

To amplify nucleotide sequence from 5’ terminus of lepr, PCR was carried out using Advantage® 2PCR kit [#639207, Clontech, Takara Biotechnology (Dalian) Co., Ltd.]. A total of 10 μl PCR reaction mix comprising of 5 μl buffer (10X advantage 2 PCR), 1 μl dNTP mix (10 mM), 1 μl advantage 2 polymerase (50X), 1 μl universal primer mix (10X), 0.2 μl lepr-specific 5’ RACE primer and remaining volume of PCR-grade water was prepared. Thermocycling conditions adopted for PCR are enlisted as: preliminary denaturation (94 οC for 1 min), and thereafter 30 cycles of each, denaturation (94 οC for 30 sec/ cycle), annealing (68.3 οC for 30 sec/ cycle) and extension (72 οC for 3 min/ cycle). For validation of cDNA, qPCR primers of lepr [30] were used as positive control. The amplified product was resolved by electrophoresis on 1% agarose gel containing 0.05% ethidium bromide and observed under ultraviolet illumination. To identify the length of DNA product, 100 base pair DNA ladder (Thermo Fisher Scientific, Massachusetts, USA) was run in a parallel well. The portion of agarose gel containing desirable length of product was excised and processed for elution of DNA using DNA elution kit, Wizard® SV Gel and PCR Clean-Up System (#A9281, Promega Corporation, Madison, USA). The eluted PCR product was ligated with pGEM-T vector using pGEM®-T easy vector system I kit (#A1360, Promega Corporation, Madison, USA) and transformed into competent Escherichia coli DH5α following heat shock method [31]. Thereafter, positive white colonies were picked and cultured in 10 ml Luria-Bertani medium (100 μg/ml ampicillin) for 6–8 h at 37 οC. Plasmid isolated from bacterial culture using commercially available kit, Wizard® Plus SV Minipreps DNA Purification System (#A1330, Promega Corporation, Madison, USA), was subjected to DNA-insert verification by conducting PCR using M13 universal primers (forward primer: 5’ GTT TTC CCA GTC ACG AC 3’; reverse primer: 5’ CAG GAA ACA GCT ATG AC 3’; Ta = 55 οC). Full-length lepr sequence achieved by compiling its sequence obtained from amplified product and partial transcript retrieved from transcriptome data of C. punctata was verified employing BLASTn bioinformatics tool.

Primary, secondary and tertiary structural analyses of protein sequences

The predicted protein sequences of Lepa and Lepr was obtained using ExPASy translate tool [32]. Signal peptide in Lepa was predicted by SignalP 4.1 online software [33]. To predict the physicochemical properties including composition of amino acids, instability index [34], molecular weight, aliphatic index [35] and grand average of hydropathy (GRAVY) [34, 36], ExPASy ProtParam tool [32] was applied to primary protein sequence of Lepa and Lepr. The secondary structural features such as proportions of α-helices, β-sheets and turns were deduced using Phyre2 software [37] while hydropathicity was estimated by ExPASy ProtScale [36]. For comparative study of primary and secondary structural features, human LEP and LEPR (NCBI GenBank accession number AAH69452.1 and AAB09673.1, respectively) were also run in parallel. The tertiary structure of Lepa and extra- as well as intra-cellular domains of Lepr was generated using Phyre2 and quality of generated models was verified by PROCHECK analysis [38]. The ligand binding site in Lepr of C. punctata was predicted using 3DLigandSite [39].

Evolutionary analyses

Sequence homology and domain analysis.

The important structural and functional domains in Lepa and Lepr of C. punctata were predicted using simple modular architecture research tool (SMART) [40]. Also, functionally important residues and domains were predicted in Lepa and Lepr of C. punctata based on mutational studies in mammals [6, 4150]. The conservation of predicted motifs and functionally important sites across vertebrates were analysed by generating multiple sequence alignment (MSA) using Clustal Omega [51]. The accession number of proteins used to generate MSA is provided as S2 Table. Using PROVEAN tool [52], effect of substitutions/deletions at functionally important sites were identified at a threshold score of -2.5 considering human LEP [53] and LEPR [54] as reference. Posttranslational modifications were found using motif scan [55].

Phylogenetic tree construction.

To study the relatedness between different species with respect to leptin and its receptor, efforts were made to identify percentage identity between Lepa and Lepr of C. punctata and their respective orthologs in vertebrates using Clustal Omega [51]. In order to understand the evolutionary relationship, separate phylogenetic tree was constructed for leptin and leptin receptor. To achieve this, individual alignment files were prepared by aligning predicted full-length sequence of Lepa and Lepr of C. punctata with respective protein sequences from fishes belonging to different orders and representative of each class of vertebrates using Multiple Sequence Comparison by Log Expectation (MUSCLE) algorithm in Molecular Evolutionary Genetics Analysis (MEGA) 11 software [56]. In addition of Lepa, protein sequences of Lepb were also used. Thereafter, phylogenetic trees were constructed by employing maximum-likelihood method with Jones-Taylor-Thornton substitution model (MEGA 11 software). The reliability of the trees was assessed with 1000 bootstrap replicates. GenBank accession number of each protein sequence is provided in S2 Table.

Molecular evolutionary analysis.

In order to study evolutionary pattern of leptin and leptin receptor in teleosts, selection pressure analysis was conducted. Concisely, separate databases were created for nucleotide sequence of open reading frame of leptin (lepa), and for extracellular domain and intracellular domain of leptin receptor of several fishes including C. punctata. The NCBI accession number of nucleotide sequences used to prepare these files is provided in S2 Table. Sequences of leptin and its receptor of other vertebrate classes were deliberately not included to avoid false positives. The stop codons were cleaned using CleanStopCodons.bf tool in HyPhy package [57] and ‘Universal genetic code’ was selected. This file was used for codon alignment employing MUSCLE algorithm (MEGA 11 software) for further analyses using web server Datamonkey [58, 59]. For detecting site-specific selection, fast, unconstrained Bayesian approximation (FUBAR) at posterior probability of 0.99 [60] was employed. Sudden change (episodic selection) in the codon sequence was recognized using mixed effects model of evolution (MEME; p = 0.05) [61]. Advanced branch-site Random Effects Likelihood (aBSREL; p ≤ 0.05) was used to identify individual branches undergoing diversifying selection [62].

Results

Nucleotide and predicted protein sequence of leptin and leptin receptor

The potential full-length transcript of lepa obtained from testicular transcriptome data contained 1884 bp including 480 bp long coding sequence. Surprisingly, existence of lepb could not be ascertained even after using respective nucleotide and protein sequence of C. argus. In case of lepr, the selected transcript was partial from 5’ end and comprised of 4002 bp. The remaining 838 bp was obtained following 5’ RACE. Further, a complete coding sequence of lepr consisting of 3447 bp was obtained using ORF finder. The ORF of leptin and leptin receptor encoded 159 and 1129 amino acids long proteins, respectively. Sequence analysis of Lepa following SignalP 4.1 predicted a signal peptide consisting of 20 amino acids. The putative full-length sequence of lepa and lepr of C. punctata were submitted to NCBI (GenBank accession number MK039679.1 and MK039680.1, respectively).

Structural analyses

Physicochemical properties of Lepa and Lepr.

The computed physicochemical properties of leptin and leptin receptor of spotted snakehead using human as reference are shown in Table 1. In both Lepa and Lepr of C. punctata, instability index was more than 40, aliphatic index was high and proportion of negatively charged residues was higher than the positively charged amino acids. A positive GRAVY score was evidenced for Lepa (score: 0.060) and transmembrane domain of Lepr (TMD score: 2.539) while negative score for extracellular (ECD) and intracellular (ICD) domains of the receptor (ECD: -0.381; ICD: -0.629). The sequence of leptin showed maximum percentage of leucine (15.7%) and minimum of cysteine and tryptophan (1.3% each) (S1A Fig). The leptin receptor of C. punctata was rich in serine (11.1%) while poor in histidine and methionine (2.2% each) (S1B Fig). The hydrophobicity test using ExPASyProtScale revealed maximum score for leucine at 8th position in Lepa (L-8, score: 2.456; S2A Fig) and valine at 809th position in Lepr (V-809, score: 3.444; S2B Fig) while minimum hydrophobicity score for glutamine in Lepa (Q-111, score: -2.222; S2A Fig) and glutamic acid (E-1080)/glutamine (Q-1081) in Lepr (score: -3.611; S2B Fig).

thumbnail
Table 1. Physicochemical properties of leptin and leptin receptor of Channa punctata.

https://doi.org/10.1371/journal.pone.0270881.t001

Secondary and tertiary structures of Lepa and Lepr.

The secondary structure showed that a large proportion of leptin of C. punctata consisted of α-helices (75%) and not of β-sheets (Fig 1A and 1B). Unlike leptin, β-sheets constituted a major proportion (45%) of Lepr while a minor proportion was represented by α-helices (4%) and transmembrane region (1%) (Fig 1C and 1D). Tertiary structure of leptin of C. punctata consisted of four α-helices designated as helix A (26th-45th amino acid), B (65th-78th), C (84th-104th) and D (134th-154th) along with long AB (46th-64th) and CD (105th-133th) loops and a short BC (79th-83th) loop (S3 Fig). The α-helices appeared to be arranged in an up-up-down-down configuration (Fig 1A and 1B). In case of leptin receptor, various domains including ECD, TMD and ICD were made up of 757, 22 and 334 amino acids, respectively (Fig 1C and 1D; S4 Fig). The Ramachandran plot for quality assessment showed good quality of leptin as most of its residues (85%) were modelled with 90% confidence (Phyre2) and placed in favourable region (S1 Table; S5A Fig). With regard to Lepr, ECD (88% residues modelled with >90% confidence) was of better quality than ICD (only 6% residues showed >90% confidence interval) of Lepr (S1 Table; S5B, S5C Fig).

thumbnail
Fig 1.

Tertiary structure of A,B leptin (Lepa) and C,D leptin receptor of C. punctata. A, B Using ball-and-stick model, residues of leptin involved in binding and signalling are highlighted in red and yellow colours, respectively. The cysteine residues are shown in purple. C In extracellular domain of leptin receptor, residues predicted essential for binding to the ligand and receptor activation/signal transduction are shown in red and yellow, respectively. D Represents intracellular domain of leptin receptor in which residues implicated in JAK2 activation are highlighted by red ball-and-sticks while tyrosine essential for receptor signalling by purple colour. The residues were labelled using YASARA software (version 17.12.24).

https://doi.org/10.1371/journal.pone.0270881.g001

Evolutionary analyses of Lep and Lepr

Identification and conservation of functionally important domains/residues.

A number of residues that might be involved in providing structural integrity to the hormone and responsible for binding as well as receptor activation were identified in leptin (lepa) of C. punctata (Table 2; Fig 1A, 1B). The residues belonging to the helical region of leptin exhibited a higher conservation as compared to loop region. Further, arginine (R-42) in helix A, glutamine (Q-88) in helix C and two cysteine residues, one (C-108) at the start of CD loop and the other (C-159) at C-terminal, were found to be conserved throughout vertebrates and marked to be essential for conferring 3-dimensional (3D) structure to the leptin. With regard to residues involved in binding to the receptor, Q-88 in helix C was conserved in leptin of all the vertebrates. However, most of the other residues including E-37, Q-38, S-95, T-97, G-98, and Y-99 showed moderate conservation among teleosts but divergence from tetrapods. Likewise, the residues (Q-48, A-49, P-50, I-55, K-128, F-130, S-135) identified crucial for receptor activation showed limited conservation among fishes and even tetrapods. A stretch of amino acids ‘LDFIP’ in AB loop of human LEP associated with downstream signalling was seen conserved in amphibians, reptiles and other mammals. In Pisces, gaps were present in homologous region of LDFIP in a few fishes including C. punctata while deviation in amino acids were found in O. mykiss, S. salar, T. fulvidraco, D. rerio, C. idella and H. molitrix (S3 Fig).

thumbnail
Table 2. Predicted effect of substitution/deletion in functionally significant sites of leptin of Channa punctata.

https://doi.org/10.1371/journal.pone.0270881.t002

In Lepr of C. punctata, an N-terminal domain (NTD) (27th-107th), immunoglobulin-like fold (IGD) (281th-368th), two cytokine receptor homology (CRH) domains (CRH I: 98th-296th, CRH II: 488th-686th) and three fibronectin type III domains (FNIII) (181th-261th, 470th-553th, 670th-760th) were identified in the ECD region using SMART and MSA tools. A pair of WSXWS motifs, one (282th-286th) towards N-terminal whilst another (574th-578th) at C-terminal of ligand binding domain (LBD; 304th-365th), and three pairs of cysteine residues (C-389—C-400; C-421—Y-480; C-441—C-451) known to be involved in disulphide bonding were found conserved throughout the vertebrates except the last cysteine residue which was substituted by tyrosine in Lepr of the fishes including C. punctata. However, the predicted LBD of C. punctata showed limited conservation with mammalian protein. In case of ICD, homology motifs box 1, 2 and 3 were predicted ranging from 819th-830th, 860th-875th and 1128th-1131th, respectively, exhibited conservation among vertebrates. Some amino acids [FQPVEGLQA (850th-858th)] required for Janus kinase (JAK) activation showed lesser conservation while other residues [KCSWAKG (831th-837th) and DNFDHL (844th-849th)] implicated in JAK binding and activation were seen highly conserved. Also, residues including L-849, F-850, Y-969, Y-1063 and Y-1128 involved in Lepr signalling were conserved across vertebrates (S4 Fig). The residues in Lepr of C. punctata predicted to be involved in binding to Lep, receptor activation, signal transduction and JAK2 activation are enlisted in Table 3 and highlighted in Fig 1C and 1D.

thumbnail
Table 3. Possible effect of substitution/deletion at functionally significant sites of leptin receptor of Channa punctata.

https://doi.org/10.1371/journal.pone.0270881.t003

Substitutions/Deletions of residues predicting functional modifications.

As compared to residues of human LEP essential for receptor binding and activation, substitutions/deletions of most of the residues in Lepa of C. punctata observed following MSA when analysed employing Protein Variation Effect Analyzer (PROVEAN) tool (Table 2; Fig 2A and 2B) highlighted major variations in binding specificity between piscine and mammalian leptin. Unlike leptin, majority of the variations in functionally relevant residues and domains of Lepr in C. punctata were found to be neutral (Table 3; Fig 2C–2F).

thumbnail
Fig 2.

Polar curves showing PROVEAN score of the amino acids exhibiting substitution/deletion at the significant sites of (A,B) leptin and (C-F) leptin receptor. The position of amino acid increases clockwise and effect of substitutions/deletions at functionally important sites is identified at a threshold score of -2.5 considering human LEP and LEPR as reference. The PROVEAN score ≤ -2.5 implies that the protein variant would have “deleterious” effect while a score > -2.5 predicts that the variant would have a “neutral” effect.

https://doi.org/10.1371/journal.pone.0270881.g002

Posttranslational modifications.

In leptin of C. punctata, S-126 showed the possible site of phosphorylation while an intramolecular disulphide bond formation was predicted between C-108 and C-159. In leptin receptor, a number of posttranslational modifications were predicted and majority of them were localized in the ECD region (Table 4).

thumbnail
Table 4. Predicted post-translational modifications in leptin and leptin receptor of Channa punctata.

https://doi.org/10.1371/journal.pone.0270881.t004

Analogy of primary sequence of Lepa and Lepr.

The primary sequence of leptin of C. punctata showed maximum similarity with its homolog of C. striata (91.19%) of the same order Anabantiformes. Further, high percentage (>75%) similarity was evidenced with the fishes belonging to order Perciformes (E. coioides, D. labrax), Cichliformes (O. niloticus, O. mossambicus), Scombriformes (S. japonicus), Pleuronectiformes (P. olivaceus, S. maximus), moderate (40–75%) with Beloniformes (O. latipes), Tetraodontiformes (T. rubripes), Syngnathiformes (H. erectus), C. semilaevis, a Pleuronectiform fish and low (<30%) with fishes of order Cypriniformes (C. idella, D. rerio, H. molitrix), Siluriformes (T. fulvidraco) and Salmoniformes (O. mykiss, S. salar). When compared with leptin of tetrapods, percentage similarity was seen very poor ranging between 18–26% (S6A Fig). With regard to receptor, maximum similarity of primary sequence of Lepr of C. punctata was evidenced with that of C. striata (81.28%), followed by Scombriformes (S. japonicas), Pleuronectiformes (P. olivaceus, S. maximus) and Perciformes (D. labrax) (75–80%), and low with rest of the teleosts (40–75%). Similar to leptin, a poor percentage similarity was observed between Lepr of C. punctata and that of tetrapods (<30%) (S6B Fig).

Phylogenetic analysis.

The phylogenetic tree of leptin showed separate clusters for teleosts and tetrapods (Fig 3A). Within teleostean clade, Lepa of C. punctata cladded with that of C. striata and C. argus belonging to the same order, Anabantiformes. Interestingly, lepa of elasmobranchs (Scyliorhinus canicula, Carcharodon carcharias), as well as teleosts including Cypriniformes (C. idella, D. rerio, H. molitrix), Characiformes (Astyanax mexicanus), Gonorhynchus (Chanos chanos), Clupeiformes (Clupea harengus) and Siluriformes (P. fulvidraco) clustered with that of tetrapods. A similar pattern of cladding was noticed with lepb. In case of leptin receptor, two separate clades, one of higher vertebrates and other of fishes, were observed in the phylogenetic tree wherein Lepr of C. punctata clustered with that of C. striata and C. argus (Fig 3B).

thumbnail
Fig 3.

Molecular phylogenetic tree of A leptin and B leptin receptor. The tree was constructed using Maximum Likelihood method based on Jones-Taylor-Thornton substitution model. Numbers over nodes represent confidence interval obtained by bootstrapping (1000 replicates). The scale along the branch length represents number of substitutions per site (MEGA 11). The order of fishes is mentioned besides the name of organism. The cluster of tetrapods is boxed with blue color while that of C. punctata with green color. Red box is used to mark Lepb sequence. There were 74 and 52 protein sequences in Lep and Lepr phylogenetic trees, respectively.

https://doi.org/10.1371/journal.pone.0270881.g003

Selection pressure analysis on teleostean leptin and leptin receptor.

A number of residues were detected in lepa of teleosts that were found to experience selection constraint (Fig 4). Site-specific selection analysis detected 25 sites that had experienced purifying selection while no site was detected for diversifying selection (FUBAR, posterior probability of 0.99, S7A Fig). Further, 5 sites were spotted (55th, 103th, 105th, 134th, 159th) that withstand episodic diversifying selection pressure (MEME at p = 0.05, S7A Fig). Regarding branch-specific selection pressure analysis, a total of 38 branches were formally tested with a single branch comprising of S. auratus under the evidence of episodic diversifying selection in leptin phylogeny (aBSREL, p ≤ 0.05; Fig 5A).

thumbnail
Fig 4. Bar diagram showing percent sites in leptin (lepa) and leptin receptor evidenced diversifying or purifying selection.

Lep: leptin; Extracellular domain of leptin receptor (Lepr): ECD; Intracellular domain of leptin receptor: ICD.

https://doi.org/10.1371/journal.pone.0270881.g004

thumbnail
Fig 5. Adaptive branch-site random effects likelihood analysis of leptin (lepa) and leptin receptor.

Branches undergoing diversifying selection (p ≤ 0.05) in A leptin and B,C different domains of leptin receptor (B: extracellular domain; C: intracellular domain) using 21 teleosts including C. punctata are highlighted with star. Strength of selection pressure (negative/neutral/positive) is indicated in different colours (Black: negative selection, i.e. ω = 0; grey: neutral selection, i.e. ω = 1; blue: positive selection, i.e. ω > 1). The thickness of the branches is an indicator of the proportion of sites undergoing episodic selection.

https://doi.org/10.1371/journal.pone.0270881.g005

In Lepr of teleosts, selection pressure analysed separately for ECD and ICD depicted a number of amino acids under site-specific selection constraint (Fig 4). Analysing ECD region, only one site (114th) was found exhibiting diversifying selection pressure while 161 sites in its different domains showed purifying selection pressure (FUBAR, S7B Fig). The evidence of episodic positive selection was detected at 23 positions and majority of these were localized in NTD, FNIII and CRHI domains (MEME, S7B Fig). The aBSREL analysis (p ≤ 0.05) of ECD of Lepr predicted nodes 14 and 19 under episodic diversifying selection (Fig 5B). In the ICD, 51 sites including residues crucial for signal transduction, JAK binding and activation, and homology motifs box 1 and 2 were detected to undergo site-specific purifying selection while no site showed diversifying selection (FUBAR, S7B Fig). Nonetheless, 9 sites represented the evidence of episodic positive selection (MEME, S7B Fig). Only one (node 9) out of 38 branches was identified to undergo diversifying selection by aBSREL analysis (p = 0.0442; Fig 5C).

Discussion

In the current study, unearthing of leptin transcript of C. punctata affirm the existence of lepa across the species of Anabantiformes. In addition, we isolated cDNA encoding lepr to develop an insight on physicochemical properties, structural/functional and evolutionary aspects of ligand and its receptor in C. punctata. To our surprise, physicochemical properties of Lepa and Lepr have not been investigated so far despite characterization of leptin system in all classes of vertebrates. In the present study, leptin system of C. punctata studied in parallel with human LEP and LEPR exhibited similarity in physicochemical properties of their respective proteins. The instability index, a measure to estimate the stability of a protein under ex vivo condition [63], greater than 40 for leptin as well as leptin receptor of both C. punctata and human indicates their lesser stability in test tube. Further, we hypothesize hydrophobic nature of leptin in vertebrates based on its GRAVY score in C. punctata and human as this score has been considered an indicator of solubility of proteins [34, 36, 64]. This assumption gets support from a recent study in O. mykiss in which presence of leptin binding proteins (LBPs) has been demonstrated along with a proposition of their role in aiding transport of leptin across blood-brain barrier [20]. Moreover, studies in mammals report bound form of leptin either with LBPs [65] or soluble leptin receptor [66]. In case of Lepr, a negative GRAVY score for extra- and intra-cellular domains in C. punctata and human suggests hydrophilic nature of these domains while transmembrane domain seems to be hydrophobic due to its positive score. Another physicochemical property, aliphatic index was recorded high for Lepa and Lepr of C. punctata and human indicating that these proteins are thermostable. This proposition is based on evidence that aliphatic index gauge the relative volume of a protein occupied by aliphatic side chains (alanine, valine, isoleucine and leucine) and indicates thermostability [35].

Despite having low primary sequence similarity, the higher order structure of leptin of C. punctata is comparable to that of several fishes [3, 67, 68] and tetrapods [6, 45, 47, 50]. This could be attributed to highly conserved residues that have been reported essential for conferring three-dimensional (3D) structure to the leptin. Further, conserved adjacent arginine in helix A (R-42) and glutamine in helix C (Q-88) interact with each other and form a binding site. Besides, two cysteine residues conserved in vertebrates are reported to form a disulphide bond [50] and a unique ‘cysteine knotted’ motif [69] which enables efficient folding and thereby provides structural integrity and stability to the leptin. However, divergence in ligand residues involved in binding and receptor activation between teleosts including C. punctata and tetrapods point towards variation in binding affinity/specificity of leptin from aquatic to terrestrial vertebrates. A recent in vitro bioassay strengthens this assumption wherein low affinity of piscine leptin is demonstrated to human LEPR [70]. Our results on structural analysis of Lepr of C. punctata are consistent with that reported in other fishes [5]. In extracellular region, CRH/IGD/FNIII domains involved in signal transduction exhibited low conservation. Further, LBD in Lepr of C. punctata exhibited less conservation with homologous residues of human LEPR re-strengthening our proposition of variation in Lep-Lepr interaction specificity in fishes as compared to mammals. Such a variation in binding specificity of Lep with Lepr has been attributed to reduced evolutionary pressure on piscine leptin [47]. This suggests a possibility of binding of leptin with, yet unknown, multiple receptors with multiple binding confirmations. On the contrary, homology box 1, 2 and 3 and the residues in intracellular region implicated in recruitment, binding and activation of Janus kinase (JAK) and signal transducer and activator of transcription (STAT3) [5, 71, 72] were seen conserved suggesting possible likeness in downstream signalling mechanism of leptin receptor from teleosts to mammals. Further, two WSXWS motifs, characteristic of class I cytokine receptors [73], were found to be conserved. These motifs have a π-cation stack configuration that in turn assists the receptor in binding with ligand [74]. Also, WSXWS motifs are reported to aid in receptor dimerization and activation [73]. This implies that Lepr across vertebrates might be undergoing dimerization to translate its physiological actions.

Apart from molecular conservation, the present study predicted the effect of substitutions/deletions at functionally relevant residues in leptin and its receptor using in silico approach. The human leptin after substitution of serine at 141th and threonine at 142th positions by alanine (S141A/T142A) has been reported to be capable to bind LEPR but incapable to activate the receptor [46]. The substitution at homologous positions (serine by threonine at 133th, and threonine by valine at 134th position) was also observed in leptin of C. punctata though these were predicted to be neutral. Using mutagenesis approach, however, additional residues in Lep and Lepr have been recognized that play pivotal role in interaction of ligand with receptor and its downstream signalling [43, 75]. Among these, in the current study, substitution of T-37, I-63, N-103, R-105, L-107, S-138, E-143 in LEP of human by Q-38, S-56, S-95, T-97, Y-99, F-130, S-135, respectively, of Lepa of C. punctata and T-894, H-902 in human LEPR by N-845, V-853 of snakehead Lepr or deletion of L-60, D-61, F-62 in LEP and L-505, K-594, T-907 in LEPR predicted major variations in ligand-receptor interaction. Nonetheless, majority of the substitutions/deletions in residues of homology box 1, box 2 and box 3 as well as those identified for receptor activation were found to be neutral in case of Lepr of C. punctata, thereby, re-strengthening our proposition of similar mode of receptor activation in fishes as in mammals.

With regard to posttranslational modifications, formation of disulphide bond between two cysteine residues had been first reported in human leptin [76] and thereafter predicted conserved in several vertebrates [6]. In the current study, in addition to disulphide bond formation, phosphorylation of serine at 126th position was predicted in Lepa of C. punctata though no such observation has been made so far in teleosts or other vertebrates. In case of Lepr of C. punctata, extracellular domain was predicted to be heavily glycosylated and phosphorylated. Studies in mammals suggest that there is an apparent increase (approximately 60 kDa) in the molecular weight of leptin receptor due to N-glycosylation [77, 78]. Although functional relevance of these modifications is least investigated, N-linked glycosylation in Ig-like and FNIII domains has been proposed to provide thermodynamic stability to maintain tertiary structure of Lepr [79]. Also, second WSXWS motif (X = asparagine in human LEPR) towards C-terminal of CRH domain has been predicted to remain exposed to the solvent due to glycosylation of its asparagine residue at 624th position [42]. A similar proposition may be made in case of Lepr of C. punctata where N-569 close to the WSXWS motif was predicted to undergo N-linked glycosylation. In addition to glycosylation, posttranslational modification leading to disulphide bonding between cysteine residues has been reported in ECD of murine LEPR. Further, this modification has been demonstrated to cause oligomerization of the receptor as deletion of domains encompassing these residues led to the formation of monomers that otherwise formed ligand-independent oligomers [49]. Among cysteine residues, mutation in C-751 is reported to have no effect on binding of leptin or downstream signalling. However, in STAT-dependent signalling, C-672 has been proven to be important. Moreover, double mutation at both of these cysteine residues has resulted in an inactivation of JAK leading to impairment of signal transduction [49]. In a separate study, an additional disulphide bond formation is reported between C-606 and C-674 [74]. Although functional studies on posttranslational modifications have not been carried out in teleosts cysteine residues identified in Lepr of C. punctata at homologous positions in the present study point towards structural and functional significance of disulphide bonding in fishes also. As compared to ECD, fewer posttranslational modifications were observed in intracellular domain of Lepr of C. punctata wherein asparagine (N-867) undergoing glycosylation were localized in homology box 2. Apart from glycosylation, highly conserved tyrosine kinase phosphorylation in Lepr of C. punctata was predicted at Y-969, Y-1063 and Y-1128 which may be involved in downstream signalling through STAT molecules.

The phylogenetic trees constructed for leptin and leptin receptor in the present study exhibited different cluster for teleosts and tetrapods as shown in other fishes [3, 16, 20, 67, 8082]. Further, both leptin and leptin receptor of C. punctata clustered close to C. striata and C. argus in the teleostean clade. Regarding assessment of selection pressure on teleostean leptin gene, a single report is available where purifying selection and not the diversifying selection have been observed [25]. They have suggested that poikilothermy might be keeping teleostean leptin gene under constant negative selection pressure as fishes do not adapt to alteration in surrounding temperature. However, no effort has been made to explore the effect of selection pressure on teleostean leptin receptor gene. The analysis of selection pressure on lepa and lepr of teleosts in the current study showed evidence of purifying as well as diversifying selection though negative selection pressure was more pronounced, implying that these genes adhere to maintain structure and function in fishes. Unlike teleosts, a considerable number of studies report diversifying selection pressure on leptin gene in mammals including seals [21, 23], whales [23], pikas [22] and bats [83]. In these species, positive selection pressure has been suggested to help in adapting to diverse environmental conditions [23]. In case of leptin receptor, however, no evidence of positive selection is reported in mammals [23, 26]. It is worthwhile to mention that pervasive as well as episodic diversifying selection pressure was observed in current study on both ECD and ICD of teleostean leptin receptor. Furthermore, marginally higher evidence of diversifying selection on ECD than ICD points towards co-evolution of leptin and its receptor in fishes.

Conclusion

The sequence-to-structure prediction and homology of higher order structures of leptin and its receptor of C. punctata with that of human provided an explanation to resemblance in secondary and tertiary structures of respective proteins despite poor similarity in their primary sequences among vertebrates. Most of the key residues of Lepa and Lepr involved in conferring structural integrity and transducing action were seen to be conserved. This assumption is reinforced by mutational analysis wherein majority of substitutions were predicted to be neutral. Nevertheless, residues of Lepa predicted in receptor binding varied from fish to mammals indicating that Lep and Lepr binding affinity is vertebrate class-specific. The posttranslational modifications predicted in leptin and its receptor in the present study point towards their contribution in maintaining integrity of tertiary structure of both ligand and its receptor. Also, heavily glycosylated extracellular domain of the receptor in C. punctata forecasts its thermodynamic stability. The current study speculates existence of leptin binding proteins in C. punctata based on hydrophobic nature of leptin due to its positive grand average of hydropathy score. In addition to structural and functional predictions, evolutionary analysis depicted a closeness of leptin system of fishes belonging to order Anabantiformes with that of Pleuronectiformes, Scombriformes and Perciformes. Further, present study paves the way to understand how selection pressure on genes encoding leptin and its receptor had shaped their evolution in Pisces, the most diverse class of vertebrates. Considerably higher evidence of purifying selection on lepa and lepr points towards a stringency acting on these genes to adhere to their structure and concomitantly, function in fishes. Nevertheless, incidence of both pervasive and episodic diversifying selection in leptin and extra- as well as intra-cellular domains of leptin receptor provides ground to co-evolution of ligand and receptor in teleosts.

Supporting information

S1 Fig. Bar diagram showing percentage of amino acids present in A Lepa and B Lepr of Channa punctata.

Lepa: leptin paralog a; Lepr: leptin receptor. Human LEP and LEPR were considered as reference.

https://doi.org/10.1371/journal.pone.0270881.s001

(PDF)

S2 Fig.

Hydropathy plots of A leptin and B leptin receptor of Channa punctata. In parallel, human C LEP and D LEPR were also run on ExPASy ProtScale tool.

https://doi.org/10.1371/journal.pone.0270881.s002

(PDF)

S3 Fig. Multiple sequence alignment of leptin (Lepa) of Channa punctata and its orthologs in other vertebrates.

Twenty-five organisms including 19 fishes and representatives from each vertebrate class were used. Based on human LEP, helices (A, B, C, D) and loops (AB, BC, CD) are marked in leptin sequence. The functionally important residues are denoted by different colours [Signal peptide in grey color; conserved R-42 in helix A, Q-88 in helix C, C-108 in CD loop and C-159 at C-terminal conferring 3D structural integrity to leptin in yellow; E-37, Q-38, R-42, Q-88, S-95, T-97, G-98, Y-99 implicated in binding to the receptor and showing limited conservation, except R-42 and Q-88 in red color which are conserved throughout vertebrates; Q-48, A-49, P-50, L-53, T-54, I-55, L-60, D-61, F-62, I-63, P-64, K-128, F-130, T-133, V-134, S-135 suggested in Lepr signalling but showing less conservation among tetrapods and teleosts in purple color]. In multi-sequences alignment, asterisk ‘*’, colon ‘:’ and period ‘.’ indicate a site with perfect alignment, a site belonging to a group with strong similarity and a site belonging to a group with weak similarity, respectively (https://www.ddbj.nig.ac.jp/faq/en/explain-three-symbols-e.html). Solid triangle represents predicted site of phosphorylation.

https://doi.org/10.1371/journal.pone.0270881.s003

(PDF)

S4 Fig. Multiple sequence alignment of leptin receptor.

Twenty-five organisms, 19 fishes including C. punctata and representatives from each vertebrate class, were used. The extracellular domain (ECD), transmembrane domain (TMD) and intracellular domain (ICD) are underlined in orange, blue and red, respectively. The structural/functional domains are highlighted with different colors [N-terminal domain (NTD) in yellow; residues of immunoglobulin-like domain (IGD) in blue bold; ligand binding domain (LBD) in cyan; residues implicated in binding to the ligand, receptor activation, signal transduction and JAK2 activation are highlighted in red, yellow, green and purple, respectively. The conserved tyrosine Y-969, Y-1063, Y-1128 essential for signalling via SH2 containing tyrosine phosphatase 2, STAT5 and STAT3, respectively are also shown in purple]. Three fibronectin III domains (FNIII) are enclosed within black square brackets and two cytokine receptor homology (CRH) domains in curly brackets. The two conserved WSXWS motifs are enclosed in blue solid box while three conserved homology motifs box 1, 2 and 3 in black solid boxes. The residues involved in JAK2 binding are enclosed in green solid box. Three disulphide bonds formed between conserved cysteine residues (C-389- -—C-400; C-441- -—C-451; C-421- -—C-481) are highlighted in maroon solid boxes and joined by S-S bond. In multi-sequences alignment, asterisk ‘*’, colon ‘:’ and period ‘.’ indicate a site with perfect alignment, a site belonging to a group with strong similarity and a site belonging to a group with weak similarity, respectively (https://www.ddbj.nig.ac.jp/faq/en/explain-three-symbols-e.html). Solid triangles and squares represent predicted sites undergoing phosphorylation and glycosylation, respectively.

https://doi.org/10.1371/journal.pone.0270881.s004

(PDF)

S5 Fig. Quality assessment of tertiary structures of leptin and leptin receptor of Channa punctata.

Ramachandran plot for A leptin a, B extracellular domain of leptin receptor and C intracellular domain of leptin receptor. Plot areas A, B and L represent the residues in the most favoured region; a, b, l, p represent the residues in additional allowed region; ~a, ~b, ~l, ~p represent the residues in generously allowed region. Glycine is represented by triangles.

https://doi.org/10.1371/journal.pone.0270881.s005

(PDF)

S6 Fig. Analogy of leptin and leptin receptor sequence of Channa punctata with respective sequences in other fishes.

Heat map showing percentage similarity of primary sequence of A leptin (Lepa) and B leptin receptor (Lepr) of C. punctata with that of fishes belonging to different orders.

https://doi.org/10.1371/journal.pone.0270881.s006

(TIF)

S7 Fig. Sites in A leptin and B extracellular as well as C intracellular domains of leptin receptor of Channa punctata under selection pressure constraint.

Multiple sequence alignment of leptin (lepa) and leptin receptor of C. punctata with respective homologs in other teleosts highlighting the sites on which selection pressure acted. Color key: yellow box indicates positively selected sites by FUBAR; blue box shows negatively selected sites by FUBAR and green box shows evidence of episodic diversifying selection detected by MEME.

https://doi.org/10.1371/journal.pone.0270881.s007

(PDF)

S1 Table. Quality assessment of tertiary structure of leptin and leptin receptor of C. punctata.

https://doi.org/10.1371/journal.pone.0270881.s008

(DOCX)

S2 Table. NCBI accession number of protein and nucleotide sequences of leptin and its receptor of vertebrates.

https://doi.org/10.1371/journal.pone.0270881.s009

(DOCX)

Acknowledgments

We are thankful to Dr. Manisha Priyam for helping in selection pressure analysis. We also thank Dr. Shashank Kumar Maurya for assisting in obtaining higher resolution figures. First author is thankful to Council of Scientific and Industrial Research, Government of India for Senior Research Fellowship (CSIR file No. 09/045(1411)/2016-EMR-I).

References

  1. 1. Indian Council of Agricultural Research, Ministry of Agriculture and Farmers welfare. https://www.icar.org.in/content/captive-breeding-and-seed-production-striped-murrel.mygov.in. Accessed 4 January 2020.
  2. 2. Deck CA, Honeycutt JL, Cheung E, Reynolds HM, Borski RJ. Assessing the functional role of leptin in energy homeostasis and the stress response in vertebrates. Frontiers in Endocrinology. 2017;8:63. pmid:28439255
  3. 3. Kurokawa T, Uji S, Suzuki T. Identification of cDNA coding for a homologue to mammalian leptin from pufferfish, Takifugu rubripes. Peptides. 2005;26(5):745–50. pmid:15808904
  4. 4. Wong MM, Yu RM, Ng PK, Law SH, Tsang AK. Characterization of a hypoxia-responsive leptin receptor (omLepRL) cDNA from the marine medaka (Oryzias melastigma). Marine Pollution Bulletin. 2007;54(6):797–803. pmid:17382971
  5. 5. Denver RJ, Bonett RM, Boorse GC. Evolution of leptin structure and function. Neuroendocrinology. 2011;94(1):21–38. pmid:21677426
  6. 6. Londraville RL, Prokop JW, Duff RJ, Liu Q, Tuttle M. On the molecular evolution of leptin, leptin receptor, and endospanin. Frontiers in Endocrinology. 2017;8:58. pmid:28443063
  7. 7. Wen ZY, Qin CJ, Wang J, He Y, Li HT, Li R, et al. Molecular characterization of two leptin genes and their transcriptional changes in response to fasting and refeeding in Northern snakehead (Channa argus). Gene. 2020;736:144420. pmid:32007585
  8. 8. Nelson JS, Grande TC, Wilson MVH. Fishes of the World. (5th ed.). Wiley 2016 ISBN 978-1-118-34233-6
  9. 9. Collins RA, Britz R, Rüber L. Phylogenetic systematics of leaffishes (Teleostei: Polycentridae, Nandidae). Journal of Zoological Systematics and Evolutionary Research. 2015;53(4):259–272. https://doi.org/10.1111/jzs.12103
  10. 10. Meyer A, Van de Peer Y. From 2R to 3R: evidence for a fish‐specific genome duplication (FSGD). Bioessays. 2005;27(9):937–45. pmid:16108068
  11. 11. Gorissen M, Flik G. Leptin in teleostean fish, towards the origins of leptin physiology. Journal of Chemical Neuroanatomy. 2014;61:200–6. pmid:24977940
  12. 12. Yuan X, Li A, Liang XF, Huang W, Song Y, He S, et al. Leptin expression in mandarin fish Siniperca chuatsi (Basilewsky): Regulation by postprandial and short-term fasting treatment. Comparative Biochemistry and Physiology Part A Molecular and Integrative Physiology. 2016;194:8–18. pmid:26806058
  13. 13. He S, Liang XF, Li L, Huang W, Shen D, Tao YX. Gene structure and expression of leptin in Chinese perch. General and Comparative Endocrinology. 2013;194:183–8. pmid:24076538
  14. 14. Angotzi AR, Stefansson SO, Nilsen TO, Rathore RM, Rønnestad I. Molecular cloning and genomic characterization of novel leptin-like genes in salmonids provide new insight into the evolution of the leptin gene family. General and Comparative Endocrinology. 2013;187:48–59. pmid:23583470
  15. 15. Huising MO, Geven EJ, Kruiswijk CP, Nabuurs SB, Stolte EH, Spanings FT, et al. Increased leptin expression in common carp (Cyprinus carpio) after food intake but not after fasting or feeding to satiation. Endocrinology. 2006;147(12):5786–97. pmid:16935838
  16. 16. Rønnestad I, Nilsen TO, Murashita K, Angotzi AR, Moen AG, Stefansson SO, et al. Leptin and leptin receptor genes in Atlantic salmon: cloning, phylogeny, tissue distribution and expression correlated to long-term feeding status. General and Comparative Endocrinology. 2010;168(1):55–70. pmid:20403358
  17. 17. Kumaresan V, Pasupuleti M, Arasu MV, Al-Dhabi NA, Arshad A, Amin SN, et al. A comparative transcriptome approach for identification of molecular changes in Aphanomyces invadans infected Channa striatus. Molecular Biology Reports. 2018;45(6):2511–23. pmid:30306509
  18. 18. Morini M, Pasquier J, Dirks R, van den Thillart G, Tomkiewicz J, Rousseau K, et al. Duplicated leptin receptors in two species of eel bring new insights into the evolution of the leptin system in vertebrates. PloS One. 2015;10(5):e0126008. pmid:25946034
  19. 19. Cao YB, Xue JL, Wu LY, Jiang W, Hu PN, Zhu J. The detection of 3 leptin receptor isoforms in crucian carp gill and the influence of fasting and hypoxia on their expression. Domestic Animal Endocrinology. 2011;41(2):74–80. pmid:21741575
  20. 20. Gong N, Einarsdottir IE, Johansson M, Björnsson BT. Alternative splice variants of the rainbow trout leptin receptor encode multiple circulating leptin-binding proteins. Endocrinology. 2013;154(7):2331–40. pmid:23645152
  21. 21. Hammond JA, Bennett KA, Walton MJ, Hall AJ. Molecular cloning and expression of leptin in gray and harbor seal blubber, bone marrow, and lung and its potential role in marine mammal respiratory physiology. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology. 2005;289(2):R545–53. pmid:15831765
  22. 22. Yang J, Wang ZL, Zhao XQ, Wang DP, Qi DL, Xu BH, et al. Natural selection and adaptive evolution of leptin in the ochotona family driven by the cold environmental stress. PLoS One. 2008;3(1):e1472. pmid:18213380
  23. 23. Yu L, Jin W, Zhang X, Wang D, Zheng JS, Yang G, et al. Evidence for positive selection on the leptin gene in Cetacea and Pinnipedia. PLoS One. 2011;6(10):e26579. pmid:22046310
  24. 24. Zou G, Zhang Y, Yu L. Natural selection and adaptive evolution of leptin. Chinese Science Bulletin. 2013;58(18):2104–12. https://doi.org/10.1007/s11434-012-5635-8
  25. 25. Wang S, Wang R, Xu T. Purifying selection on leptin genes in teleosts may be due to poikilothermy. Journal of Genetics. 2014;93(2):551–6. pmid:25189258
  26. 26. Benner SA, Trabesinger N, Schreiber D. Post-genomic science: converting primary structure into physiological function. Advances in Enzyme Regulation. 1998;38(1):155–80. pmid:9762352
  27. 27. Roy A, Basak R, Rai U. De novo sequencing and comparative analysis of testicular transcriptome from different reproductive phases in freshwater spotted snakehead Channa punctatus. Plos One. 2017;12(3):e0173178. pmid:28253373
  28. 28. Wheeler DL, Church DM, Federhen S, Lash AE, Madden TL, Pontius JU, et al. Database resources of the National Center for Biotechnology Information. Nucleic Acids Research. 2003;31(1):28–33. pmid:12519941
  29. 29. Lima AO, Garcês SP. Intrageneric primer design: bringing bioinformatics tools to the class. Biochemistry and Molecular Biology Education. 2006;34(5):332–7. pmid:21638710
  30. 30. Bakshi A, Rai U. Reproductive phase-dependent variation, sexually dimorphic expression and sex steroids-mediated transcriptional regulation of lep and lepr in lymphoid organs of Channa punctata. Scientific Reports. 2020;10(1):1–11. pmid:31969648
  31. 31. Froger A, Hall JE. Transformation of plasmid DNA into E. coli using the heat shock method. Journal of Visualized Experiments. 2007(6). pmid:18997900
  32. 32. Gasteiger E, Gattiker A, Hoogland C, Ivanyi I, Appel RD, Bairoch A. ExPASy: the proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Research. 2003;31(13):3784–8. pmid:12824418
  33. 33. Petersen TN, Brunak S, Von Heijne G, Nielsen H. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nature Methods. 2011;8(10):785–6. pmid:21959131
  34. 34. Grasso EJ, Sottile AE, Coronel CE. Structural prediction and in silico physicochemical characterization for mouse Caltrin I and bovine caltrin proteins. Bioinformatics and Biology Insights. 2016;10:BBI-S38191. pmid:27812283
  35. 35. Ikai A. Thermostability and aliphatic index of globular proteins. The Journal of Biochemistry. 1980;88(6):1895–8. pmid:7462208
  36. 36. Kyte J, Doolittle RF. A simple method for displaying the hydropathic character of a protein. Journal of Molecular Biology. 1982;157(1):105–32. pmid:7108955
  37. 37. Kelley LA, Mezulis S, Yates CM, Wass MN, Sternberg MJ. The Phyre2 web portal for protein modeling, prediction and analysis. Nature Protocols. 2015;10(6):845–58. pmid:25950237
  38. 38. Laskowski RA, MacArthur MW, Moss DS, Thornton JM. PROCHECK: a program to check the stereochemical quality of protein structures. Journal of Applied Crystallography. 1993;26(2):283–91. PMID: 8969307
  39. 39. Wass MN, Kelley LA, Sternberg MJ. 3DLigandSite: predicting ligand-binding sites using similar structures. Nucleic Acids Research. 2010;38:469–73. pmid:20513649
  40. 40. Letunic I, Doerks T, Bork P. SMART: recent updates, new developments and status in 2015. Nucleic Acids Research. 2015;43(D1):D257–60. pmid:25300481
  41. 41. Fong TM, Huang RR, Tota MR, Mao C, Smith T, Varnerin J, et al. Localization of leptin binding domain in the leptin receptor. Molecular Pharmacology. 1998;53(2):234–40. pmid:9463481
  42. 42. Haniu M, Arakawa T, Bures EJ, Young Y, Hui JO, Rohde MF, et al. Human leptin receptor: determination of disulfide structure and N-glycosylation sites of the extracellular domain. Journal of Biological Chemistry. 1998;273(44):28691–9. pmid:9786864
  43. 43. Iserentant H, Peelman F, Defeau D, Vandekerckhove J, Zabeau L, Tavernier J. Mapping of the interface between leptin and the leptin receptor CRH2 domain. Journal of Cell Science. 2005;118(11):2519–27. pmid:15923664
  44. 44. Londraville RL, Macotela Y, Duff RJ, Easterling MR, Liu Q, Crespi EJ. Comparative endocrinology of leptin: assessing function in a phylogenetic context. General and Comparative Endocrinology. 2014;203:146–57. pmid:24525452
  45. 45. Madej T, Boguski MS, Bryant SH. Threading analysis suggests that the obese gene product may be a helical cytokine. FEBS Letters. 1995;373(1):13–8. pmid:7589424
  46. 46. Peelman F, Van Beneden K, Zabeau L, Iserentant H, Ulrichts P, Defeau D, et al. Mapping of the leptin binding sites and design of a leptin antagonist. Journal of Biological Chemistry. 2004;279(39):41038–46. pmid:15213225
  47. 47. Prokop JW, Duff RJ, Ball HC, Copeland DL, Londraville RL. Leptin and leptin receptor: analysis of a structure to function relationship in interaction and evolution from humans to fish. Peptides. 2012;38(2):326–36. pmid:23085324
  48. 48. Sandowski Y, Raver N, Gussakovsky EE, Shochat S, Dym O, Livnah O, et al. Subcloning, expression, purification, and characterization of recombinant human leptin-binding domain. Journal of Biological Chemistry. 2002;277(48):46304–9. pmid:12226096
  49. 49. Zabeau L, Defeau D, Van der Heyden J, Iserentant H, Vandekerckhove J, Tavernier J. Functional analysis of leptin receptor activation using a Janus kinase/signal transducer and activator of transcription complementation assay. Molecular Endocrinology. 2004;18(1):150–61. pmid:14525952
  50. 50. Zhang F, Basinski MB, Beals JM, Briggs SL, Churgay LM, Clawson DK, et al. Crystal structure of the obese protein leptin-E100. Nature. 1997;387(6629):206–9. pmid:9144295
  51. 51. Madeira F, Park YM, Lee J, Buso N, Gur T, Madhusoodanan N, et al. The EMBL-EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Research. 2019;47(W1):W636–41. pmid:30976793
  52. 52. Choi Y, Chan AP. PROVEAN web server: a tool to predict the functional effect of amino acid substitutions and indels. Bioinformatics. 2015;31(16):2745–7. pmid:25851949
  53. 53. Strausberg RL, Feingold EA, Grouse LH, Derge JG, Klausner RD, Collins FS. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proceedings of the National Academy of Sciences. 2002;99(26):16899–903. pmid:12477932
  54. 54. Thompson BD, Ravussin E, Bennett PH, Bogardus C. Structure and sequence variation at the human leptin receptor gene in lean and obese Pima Indians. Human Molecular Genetics. 1997;6(5):675–9. pmid:9158141
  55. 55. Motif Scan. https://myhits.isb-sib.ch/cgi-bin/motif_scan#freq_pat:CK2_PHOSPHO_SITE. Accessed on 25 November 2019.
  56. 56. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research. 2004;32(5):1792–7. pmid:15034147
  57. 57. Pond SL, Frost SD, Muse SV. HyPhy: hypothesis testing using phylogenies. Bioinformatics. 2005;21(5):676–9. pmid:15509596
  58. 58. Pond SL, Frost SD. Datamonkey: rapid detection of selective pressure on individual sites of codon alignments. Bioinformatics. 2005;21(10):2531–3. pmid:15713735
  59. 59. Weaver S, Shank SD, Spielman SJ, Li M, Muse SV, Kosakovsky Pond SL. Datamonkey 2.0: a modern web application for characterizing selective and other evolutionary processes. Molecular Biology and Evolution. 2018;35(3):773–7. pmid:29301006
  60. 60. Murrell B, Moola S, Mabona A, Weighill T, Sheward D, Kosakovsky Pond SL, et al. FUBAR: a fast, unconstrained bayesian approximation for inferring selection. Molecular Biology and Evolution. 2013;30(5):1196–205. pmid:23420840
  61. 61. Murrell B, Wertheim JO, Moola S, Weighill T, Scheffler K, Kosakovsky Pond SL. Detecting individual sites subject to episodic diversifying selection. PLoS Genetics. 2012;8(7):e1002764. pmid:22807683
  62. 62. Smith MD, Wertheim JO, Weaver S, Murrell B, Scheffler K, Kosakovsky Pond SL. Less is more: an adaptive branch-site random effects model for efficient detection of episodic diversifying selection. Molecular Biology and Evolution. 2015;32(5):1342–53. pmid:25697341
  63. 63. Wilkins MR, Gasteiger E, Hoogland C, Gattiker A, Wilkins MR, Appel RD, et al. Protein identification and analysis tools in the ExPASy server. 2-D Proteome Analysis Protocols. Methods in Molecular Biology. 1999;112:531–552. pmid:10027275
  64. 64. Magdeldin S, Yoshida Y, Li H, Maeda Y, Yokoyama M, Enany S, et al. Murine colon proteome and characterization of the protein pathways. BioData Mining. 2012;5(1):1–4. pmid:22929016
  65. 65. Houseknecht KL, Mantzoros CS, Kuliawat R, Hadro E, Flier JS, Kahn BB. Evidence for leptin binding to proteins in serum of rodents and humans: modulation with obesity. Diabetes. 1996;45(11):1638–43. pmid:8866573
  66. 66. Lammert A, Kiess W, Bottner A, Glasow A, Kratzsch J. Soluble leptin receptor represents the main leptin binding activity in human blood. Biochemical and Biophysical Research Communications. 2001;283(4):982–8. pmid:11350082
  67. 67. Kurokawa T, Murashita K. Genomic characterization of multiple leptin genes and a leptin receptor gene in the Japanese medaka, Oryzias latipes. General and Comparative Endocrinology. 2009;161(2):229–37. pmid:19523397
  68. 68. Ohga H, Matsumori K, Kodama R, Kitano H, Nagano N, Yamaguchi A, et al. Two leptin genes and a leptin receptor gene of female chub mackerel (Scomber japonicus): molecular cloning, tissue distribution and expression in different obesity indices and pubertal stages. General and Comparative Endocrinology. 2015;222:88–98. pmid:26065595
  69. 69. Haglund E, Sułkowska JI, He Z, Feng GS, Jennings PA, Onuchic JN. The unique cysteine knot regulates the pleotropic hormone leptin. PLoS One. 2012;7(9): e45654. pmid:23029163
  70. 70. Shpilman M, Hollander-Cohen L, Ventura T, Gertler A, Levavi-Sivan B. Production, gene structure and characterization of two orthologs of leptin and a leptin receptor in tilapia. General and Comparative Endocrinology. 2014;207:74–85. pmid:24852346
  71. 71. Bahrenberg G, Behrmann I, Barthel A, Hekerman P, Heinrich PC, Joost HG, et al. Identification of the critical sequence elements in the cytoplasmic domain of leptin receptor isoforms required for Janus kinase/signal transducer and activator of transcription activation by receptor heterodimers. Molecular Endocrinology. 2002;16(4):859–72. pmid:11923481
  72. 72. Kloek C, Haq AK, Dunn SL, Lavery HJ, Banks AS, Myers MG. Regulation of Jak kinases by intracellular leptin receptor sequences. Journal of Biological Chemistry. 2002;277(44):41547–55. pmid:12196522
  73. 73. Dagil R, Knudsen MJ, Olsen JG, O’Shea C, Franzmann M, Goffin V, et al. The WSXWS motif in cytokine receptors is a molecular switch involved in receptor activation: insight from structures of the prolactin receptor. Structure. 2012;20(2):270–82. pmid:22325776
  74. 74. Carpenter B, Hemsworth GR, Wu Z, Maamra M, Strasburger CJ, Ross RJ, et al. Structure of the human obesity receptor leptin-binding domain reveals the mechanism of leptin antagonism by a monoclonal antibody. Structure. 2012;20(3):487–97. pmid:22405007
  75. 75. Niv-Spector L, Raver N, Friedman-Einat M, Grosclaude J, Gussakovsky EE, Livnah O, et al. Mapping leptin-interacting sites in recombinant leptin-binding domain (LBD) subcloned from chicken leptin receptor. Biochemical Journal. 2005;390(2):475–84. pmid:15842201
  76. 76. Cohen SL, Halaas JL, Friedman JM, Chait BT, Bennett L, Chang D, et al. Human leptin characterization. Nature. 1996;382(6592):589. pmid:8757126
  77. 77. Bjørbæk C, Uotani S, Da Silva B, Flier JS. Divergent signaling capacities of the long and short isoforms of the leptin receptor. Journal of Biological Chemistry. 1997;272(51):32686–95. pmid:9405487
  78. 78. Ghilardi N, Skoda RC. The leptin receptor activates janus kinase 2 and signals for proliferation in a factor-dependent cell line. Molecular Endocrinology. 1997;11(4):393–9. pmid:9092791
  79. 79. Kamikubo Y, Dellas C, Loskutoff DJ, Quigley JP, Ruggeri ZM. Contribution of leptin receptor N-linked glycans to leptin binding. Biochemical Journal. 2008;410(3):595–604. pmid:17983356
  80. 80. Li GG, Liang XF, Xie Q, Li G, Yu Y, Lai K. Gene structure, recombinant expression and functional characterization of grass carp leptin. General and Comparative Endocrinology. 2010;166(1):117–27. pmid:19857495
  81. 81. Murashita K, Uji S, Yamamoto T, Rønnestad I, Kurokawa T. Production of recombinant leptin and its effects on food intake in rainbow trout (Oncorhynchus mykiss). Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology. 2008;150(4):377–84. pmid:18539064
  82. 82. Zhang H, Chen H, Zhang Y, Li S, Lu D, Zhang H, et al. Molecular cloning, characterization and expression profiles of multiple leptin genes and a leptin receptor gene in orange-spotted grouper (Epinephelus coioides). General and Comparative Endocrinology. 2013;181:295–305. pmid:23022580
  83. 83. Yuan L, Zhao X, Lin B, Rossiter SJ, He L, Zuo X, et al. Adaptive evolution of leptin in heterothermic bats. PloS One. 2011;6(11):e27189. pmid:22110614