Complement component 3 haplotypes influence serum complement activity and milk production traits in Chinese Holstein cattle

Yonghui Wang; Junyu Zhai; Chunhong Yang; Jingpeng Wang; Yan Sun; Yuhua Li; Zhihua Ju; Jingming Huang; Changfa Wang

doi:10.1371/journal.pone.0268959

Abstract

Complement component 3 (C3) is the key molecule of the three pathways of complement activation (alternative, classical, and lectin pathways), which are involved in phagocytosis, inflammation, and immunoregulation processes to destroy infectious microorganisms. In this study, three novel single-nucleotide polymorphisms (SNPs) (g.-1293C>G located in the 5′-flanking region, g.56T>C in exon I, and g.7017C>T in exon XII) of the C3 gene were detected using created restriction site polymerase chain reaction, restriction fragment length polymorphism, and DNA sequencing in 952 cattle from three Chinese breeds. The genotypes and haplotypes were analyzed to investigate the polymorphisms and their possible implications, with particular investigative focus on their associations with serum C3 level, complement hemolytic activity (CH50 and ACH50), and milk production traits. The g.56T>C SNP in exon I affected the serum ACH50 (P<0.01) and the milk somatic cell score (SCS) (P<0.05), and the g.7017C>T SNP in exon XII significantly affected the serum ACH50 values (P<0.01). Moreover, statistical analyses revealed that individuals with genotypic combination CCC/GCC showed significantly lower SCS and the lowest C3 concentration in serum compared with cows with CCC/GTT (P = 0.0007) and CTT/CTT (P = 0.0021); the individuals with CCC/CCT had significantly higher ACH50 values than those with CCC/CTC (P = 0.0008) and CTC/GTC (P = 0.001); cows with CCT/CTT had higher values of CH50 and 305-day milk yield (P>0.05). The C3 expression levels were significantly increased in lung and mammary tissues (P<0.05), while significantly decreased in heart, spleen, liver, and kidney tissues in mastitis cows compared with those in healthy animals (P<0.01), respectively. Bacterial counts of serum antibacterial activities were also completed to verify the effect of SNPs on resistance to mastitis pathogens. Genetically resistant cows (CCC/GCC) had serum with noticeably higher antibacterial activity against S. aureus and E. coli in vitro than the genetically susceptible CCC/GTT cows (P<0.05). Results from this study imply that the C3 gene plays a role in resistance to bacterial infection and that it can be used as a molecular marker for complement activity and traits related to milk production.

Citation: Wang Y, Zhai J, Yang C, Wang J, Sun Y, Li Y, et al. (2022) Complement component 3 haplotypes influence serum complement activity and milk production traits in Chinese Holstein cattle. PLoS ONE 17(6): e0268959. https://doi.org/10.1371/journal.pone.0268959

Editor: Tomoyoshi Komiyama, Tokai University School of Medicine, JAPAN

Received: August 18, 2021; Accepted: May 12, 2022; Published: June 30, 2022

Copyright: © 2022 Wang et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the paper and its Supporting Information files.

Funding: This research was funded by the National Natural Science Foundation of China (grant no. 31671287), Taishan Leading Industry Talents – Agricultural Science of Shandong Province (grant no. LJNY201713), Shandong Province Modern Agricultural Technology System Donkey Industrial Innovation Team (grant no. SDAIT-27), and the Open Project of Shandong Collaborative Innovation Center for Donkey Industry Technology (grant no.3193308). Changfa Wang is a funder of all funds and the corresponding author of this paper. He played an important role in study design, analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Mastitis, an inflammatory disease of the mammary gland that is generally caused by intramammary infections, is the most frequent, complex, and costly disease in dairy cattle [1]. Various bacteria including contagious and environmental bacterial pathogens, such as Staphylococcus aureus, Streptococcus uberis, and Escherichia coli, cause mastitis [2, 3]. The disease causes considerable economic losses due to decreases in the quality and quantity of milk production, increase in the cost of treatment and veterinary services, and early culling [1, 4]. In addition to therapeutic, prophylactic, and management strategies, one promising approach to reduce mastitis is the selection of animals that are resistant to mastitis and the incorporation of this trait into herds. Although genetic variability for mastitis resistance represents only a small proportion of the total variance, it is not negligible and provides an attractive complementary way to improve mastitis resistance in dairy cattle. Thus, strategies for recognizing and describing these genes are integral to the development of marker-assisted selection, which can increase their frequency and effectiveness, leading to improved ability to combat these pathogens.

Resistance/susceptibility to mastitis is a complex trait, and genes involved in the innate immune response have been indicated as strong candidates [1, 5, 6]. The bovine complement system is present in serum and milk and plays an important part in the defense mechanism of the mammary gland against mastitis [7–9]. Complement component 3 (C3) contributes to overall defense, where it is an integral part of the complement system and a key molecule of the three complement reaction pathways: the classical pathway (triggered by antibodies), the lectin pathway (triggered by lectin), and the alternative pathway (triggered directly on pathogen surfaces). The bovine C3 gene is located on chromosome 7, and it contains 40 introns and 41 exons encoding 1661 amino acids (Fig 1). The C3 protein, which is a member of the α₂M family, is a 190 kDa glycoprotein essential for eliciting the complement response. It consists of two polypeptide chains (alpha and beta) held together with a single disulfide bridge. An internal thioester in the alpha chain of C3 is cleaved during complement activation. This mediates covalent attachment of the activated C3b to immune complexes and invading microorganisms, thereby opsonizing the target [10].

Download:

Fig 1. Shows the protein fragment of C3: The signal peptide and the alpha and beta chains, which consist of the C3a and C3b fragment.

https://doi.org/10.1371/journal.pone.0268959.g001

Innate immunity is involved in phagocytosis, inflammation, and immunoregulation processes to destroy infectious microorganisms [11, 12]. Second, the study of transcriptome profiling of Streptococcus uberis-induced mastitis reveals fundamental differences in immune gene expression of the mammary gland and the primary cell culture model. For example, the C3 gene is upregulated by 2.36-fold compared with non-infected control groups [6]. Third, Affymetrix DNA microarrays showed that the mRNA abundances of the C3 gene were strongly and significantly increased (3.8-fold) in mammary epithelial cells (MECs) stimulated by E. coli [13]. Furthermore, complement hemolytic activity and C3 concentration in milk are higher in mammary gland with mastitis than in healthy mammary gland [14, 15]. Finally, some studies also found a significant association between different genotypes of C3 and milk production in sheep (P<0.01) [16] and classical complement pathway and alternative complement pathway activity in porcine (P<0.05) [17]. However, little information is available about the bovine C3 single-nucleotide polymorphisms (SNPs) and their associations with infectious bacterial diseases and complement hemolytic activity.

Chinese Holstein Cattle is derived from grading cross breeding and selection between Chinese native cow and purebred Holstein bull introduced in China. The frequency of mastitis in this breed is about 38%–50% [18]. The Luxi Yellow cattle and Bohai Black cattle are two of the representative indigenous bovine (Bos taurus) breeds in China, which have been bred as beef and draft dual-purpose cattle for thousands of years because of their disease resistance and ability to endure unfavorable feeding conditions. The aim of the current study was to investigate the SNPs of the C3 gene and assess their possible associations between SNPs, combined genotypes with SCS, serum C3 concentration, and complement hemolytic activity (ACH50 and CH50) in Chinese Holstein cattle [19].

Materials and methods

Ethical statement

All animal protocols were approved by the Animal Welfare & Ethics Committee of Institute of Animal Sciences, Liaocheng University (No. LC2019-1).

Study animals

The animals used in this study were selected from three common Chinese bovine breeds, including Chinese Holstein (CH; n = 821), Luxi Yellow (LX; n = 106), and Bohai Black (BH; n = 25). Chinese Holstein cattle (4–7 years old and calving numbers one to four) were randomly selected from eight dairy farms in the Jinan and Qingdao Agriculture Development Area, China. Each of the included farms had complete lactation Dairy Herd Improvement (DHI) records. Of the 821 selected individuals, 354 had sufficient serum volume for complement hemolytic activity (CH50 and ACH50) and C3 concentration tests, and samples from these individuals were included in the final analysis. Individuals of the Luxi Yellow and Bohai Black breeds (mean age 14 months) were randomly selected from their original conservation areas. The milk performance parameters (305-day milk yield, somatic cell score (SCS), fat and protein percentage) of Chinese Holstein from 27 sires were provided by the DHI Laboratory of the Dairy Cattle Research Center of Shandong Academy of Agricultural Sciences using a milk composition analyzer (Foss MilkoScan FT 6000, Denmark).

Chemicals and reagents

All chemicals were obtained from Sigma (Saint Louis, USA) except as noted. The EZgene™ Blood Genomic DNA Miniprep Kit, Platinum Taq DNA polymerase, restriction endonucleases, and associated buffers were obtained from TaKaRa Biotechnology Co., Ltd. (Dalian, China). The Bovine Complement 3 ELISA Kit was obtained from BlueGene (Shanghai, China). Oligonucleotide primers were obtained from Sangon Biological Engineering (Shanghai, China). DNA sequencing was performed by TaKaRa (Dalian, China).

DNA extraction

Blood samples were obtained from bovine jugular veins and divided into two treatments. In one tube, 10 ml of blood was mixed with 1.6 ml of the anticoagulant acid-citrate-dextrose (0.48% citric acid, 1.32% citrate sodium, 1.47% dextrose) and subsequently stored at -20°C. A phenol: chloroform protocol modified from the methods of [20] was then used to extract genomic DNA. The other one was used to isolate serum (Chinese Holstein samples), which was stored at -70°C. Genomic DNA was extracted by using the EZgene™ Blood Genomic DNA Miniprep Kit. The quantity and quality of DNA were analyzed spectrophotometrically and diluted to 50 ng/μl. All DNA samples were stored at -20°C for subsequent analysis.

Detection of C3 gene polymorphisms

A total of 21 primer pairs were designed on the basis of the DNA sequence of bovine C3 gene (GenBank accession NO. NC_007305.4) by Primer 5.0 software and synthesized by Sangon Biological Engineering Technology to detect the SNPs in the sequences from the 5′region to the 33th exon (Table 1).

Download:

Table 1. The primers to detect the SNPs.

https://doi.org/10.1371/journal.pone.0268959.t001

Polymerase chain reaction (PCR) was carried out in a 25 μl reaction mixture containing 50 ng of template DNA, 10 μmol/l of each primer 0.5 μl, 10× buffer 2.5 μl, 50 mmol/l of Mg²⁺ 0.8 μl, 10 μmol/l of dNTP 0.5 μl, and 5U/μl of Taq DNA polymerase 0.4 μl. After an initial denaturation at 94°C for 5 min, the PCR amplification was performed in 35 cycles using the following parameters: denaturation at 94°C for 30 s, annealing at Tm °C (Table 1) for 30 s, and elongation at 72°C for 30 s. The reaction was continued for a final extension at 72°C for 7 min. The PCR products were evaluated using 1% agarose gel electrophoresis by staining with ethidium bromide.

Three new SNPs were found using the DNA pool sequencing method. The SNP (g.56T>C) in the exon I region of the C3 gene was genotyped by PCR-RFLP method with Sty I, and the SNPs (g.-1293C>G and g.7017C>T) in the 5′ region and the exon XII were genotyped by employing created restriction site PCR (CRS-PCR) with primer Ep and Eex12 containing a nucleotide mismatch, respectively, which enable the use of restriction enzymes for discriminating sequence variations [7]. In brief, the third base C is replaced by G from the 3′ end of primer Ep, and the 11th base C is replaced by A from the 5′ end of primer Eex12, which both create a new Hinf Ⅰ restriction site (G/ANTC) (see Table 2). Restriction enzyme selections and fragment sizes are given in Table 2. The detection results of allelic variation at the SNP sites were based on the electrophoretic pattern of the restriction enzyme-treated PCR products.

Download:

Table 2. PCR primers and PCR–RFLP tests for genotyping SNPs detected in the bovine C3 gene.

https://doi.org/10.1371/journal.pone.0268959.t002

In Table 2, SAF means the size of amplification fragment, AR means amplification region, RES indicates the size of fragments at the indicated allele after digestion of the PCR product using the respective restriction enzyme, and SNP means single-nucleotide polymorphism; underlined nucleotides indicate mismatches between sequences, enabling the creation of a discrimination site for restriction enzymes.

Nucleotide sequencing

The PCR products that showed variable patterns in electrophoresis were sequenced directly from two different directions using the ABI PRISM 3730 DNA analyzer (Applied Biosystems, USA) in accordance with the manufacturer’s instructions. The results were sequenced using the DNASTAR 5.0 package (DNASTAR, Inc., USA).

Classical complement pathway hemolytic titer (CH50) assay

We examined the hemolytic complement activity in 354 individual cattle to assess the in vitro capacity of the complement system in order to evaluate the role of the complement system in host resistance. We followed the established methods of [7, 9, 21] using sensitized rabbit red blood cells (RRBCs) instead of sensitized sheep red blood cells as target cells for measuring the CH50 of bovine. To examine the CH50 of bovine serum, 354 sera from each dairy cattle were diluted with GVB²⁺ at a ratio of 1:75. Different volumes of the diluted sera ranging from 0.4 ml to 1.0 ml were dispensed into 2.0 ml test tubes, and the total volume reached up to 1.3 ml with GVB²⁺. For each tube, 0.2 ml of sensitized RRBC suspension (5×10⁸ cells/ml) was added. Hemolysis control (100%) and a cell blank control were included. The tubes were incubated at 37°C for 60 min with occasional shaking and centrifuged at 1000 g for 5 min. The absorbance of the supernatants at 414 nm (OD₄₁₄) was spectrophotometrically measured [22]. The OD₄₁₄ values, including those of the 100% hemolysis control, were standardized by subtracting the blank absorbance from all samples. Established methods were used to calculate the CH50 values (units/ml) [23, 24].

Alternative complement pathway hemolytic titer (ACH50) assay

ACH50 assay was performed in accordance with the method of [7]. In general, the levels of complement are expressed in ACH50 titers, which are defined as the reciprocal of the serum dilution causing 50% hemolysis of unsensitized RRBCs. For most experiments, target erythrocytes were drawn from the same giant New Zealand male rabbit and washed three times with EGTA-Mg-GVB. Two buffers were used in the ACH50 activity assay: EGTA-Mg-GVB (pH 7.3, 10 mM EGTA, 4 mM Mg²⁺) with GVB (5 mM sodium barbiturate, 149 mM NaCl, and 0.1% gelatin) and EDTA-GVB (pH 7.3, 10 mM EDTA, 5 mM sodium barbiturate, 149 mM NaCl, and 0.1% gelatin).

Measurement of C3 protein level in serum

C3 serum concentration in 354 Chinese Holstein cows was measured using the Bovine Complement 3 ELISA Kit (Blue Gene Biotechnology Co., Ltd., Shanghai, China) in accordance with the manufacturer’s instructions. The kit contains a 96-well test plate, standards of known C3 concentrations, wash buffers, a monoclonal anti-C3, a C3-HRP conjugate, and a substrate solution. The serum samples from the Chinese Holstein cattle and standards of known C3 concentrations were loaded into the appropriate well on the antibody-pre-coated microtiter plate; 100 μl of each serum sample or standard per well and 50 μl of the diluted C3-HRP conjugate were added to each well. The plates were covered and incubated for 1 h at 37°C after the solutions were mixed. The wells were washed, and 50 μl of the substrate for the enzyme was added to each well. After incubation at 25°C for 15 min, the wells were washed three times to remove unbound substrates. For each well, 50 μl of Stop Solution was added. Thereafter, the well was mixed properly. The optical density (OD) at 450 nm was measured within 30 min using an ELISA microplate reader. The calibration curve was constructed with OD values, which corresponded to each of the different standard concentrations. This standard curve allowed OD values to be converted to C3 concentrations, expressed in mg/l.

Serum antibacterial activity of different haplotypic combinations

Two of the most common mastitis-causing pathogens Staphylococcus aureus ATCC29213 and Escherichia coli ATCC35218 were purchased from the China Institute of Veterinary Drug Control. These pathogens were incubated in Luria–Bertani (LB) broth or mannitol salt medium and allowed to reach a logarithmic growth phase before bacteria were harvested by centrifugation at 5000 g for 20 min at 4°C. Bacterial pellets were then resuspended in sterilized PBS at a density of 10⁵ CFU/ml and used for further analysis.

Results from the haplotypic combination analysis were used to select 12 serum samples from mastitis-resistant individuals (CCC/GCC, H1H5) and 18 samples from mastitis-susceptible individuals (CCC/GTT, H1H8) for examination of antibacterial activity.

Mixtures containing 100 μl of individual sera from the mastitis-resistant (CCC/GCC) or mastitis-susceptible samples (CCC/GTT) and an equal volume of E. coli suspended in LB with 10⁵ CFU/ml or S. aureus suspended in mannitol salt agar with 10⁵ CFU/ml were preincubated at 37°C for 12 h. About 30 μl of these mixtures was plated with eosin methylene blue agar for E. coli or mannitol salt agar plate for S. aureus, 6 plates each. Plates were incubated for 24 h at 37°C before colonies in each plate were counted. For the control, the same procedure was followed, but resistant sera were replaced by LB for E. coli or mannitol salt agar for S. aureus. The survival of bacteria was expressed as percent survival relative to the number of cells incubated with LB or mannitol salt agar (100% control). Each sample was tested separately three times [7, 25].

For determination of antibacterial activity in the presence of C3, inhibition experiments were carried out with CTC/GTT serum samples that had been pretreated at 56°C for 30 min, with 10 mM EDTA or with rat anti-bovine C3 (25 μl diluted 10⁻³) [25]. EDTA or antiserum was added to the individual serum samples for 30 min prior to the addition of E. coli and S. aureus.

Fluorescence quantitative real-time PCR (RT-PCR)

Total RNA was isolated from heart, liver, spleen, lung, kidney, and mammary tissues from six Chinese Holstein cattle (three healthy samples and three diseased samples with clinical mastitis) using TRIzol reagent (Bioteke, Beijing, China) in accordance with the manufacturer’s instructions. cDNA was synthesized with the transcriptor first-strand cDNA synthesis kit (TaKaRa, Dalian, China). RT-PCR analysis was performed using a 20 μl mixture containing 50 ng of cDNA, 0.4 μM of sense and antisense primers, 6.8 μl of dH₂O, 10.0 μl of SYBR® Premix Ex Taq™ (2×), and 0.4 μl of ROX Reference Dye (50×) (TaKaRa, Dalian, China). To normalize differences in the amount of total cDNA added to each reaction, the reaction mixture was denatured for 30 s at 95°C and incubated for 40 cycles (denaturing for 5 s at 95°C, annealing for 31 s at 60°C).

The primers used in the experiment based on C3 (accession NO. NM_001040469.2) were as follows: F: GAGATTCTGGCCGTGAGCTTG, R: GATCGCTCGGATCTCCACTTG. The PCR was monitored by the ABI PRISM 7000HT Fast Real-Time PCR system. The relative quantification of the C3 gene expression was calculated using the standard curve-based method for relative RT-PCR.

Statistical analysis

The distribution frequency of SCS is usually skewness [8], so we calculated the SCS (cells/μl)-based parameter SCS using the following equation: SCS = log₂ (SCS/100) + 3 [26].

Indirect methods of estimation are commonly used. Milk SCS can be employed for selection of mastitis resistance in cattle breeding instead of a direct index of the mastitis phenotype (Interbull: http://www-interbull.slu.se/national_ges_info2/framesida-ges.htm). This indirect index correlates genetically with the occurrence of clinical mastitis (r = 0.7) [26].

TFPGA software was used for genetic analysis, including calculation of both genotypic and allelic frequencies for each SNP, to test for the Hardy–Weinberg equilibrium (χ²) in genotype distributions across breeds and to determine values for polymorphism information content (PIC), heterozygosities (H_e), and effective number of alleles (N_e) [27]. SHEsis software was employed to conduct haplotype analysis and linkage disequilibrium analysis [28].

Correlation analyses between the three SNPs (single or combined) of the C3 gene and milk traits, the hemolytic activity, and the concentration in Chinese Holstein were analyzed following the general least-square model: where Y_ijkml = the observed value of each milk trait or serum level trait; μ = overall mean; G_i = fixed effect of genotype or combined genotype; YS_j = fixed effect of season; H_k = fixed effect of farm; P_l = fixed effect of parity; FS_m = random effect of sire; e_ijkml = random error.

The antibacterial activity analyses were performed using SPSS Statistics 17.0 software. The data were subjected to Student’s independent samples t-test to determine the differences between the means of the different groups. Values of P<0.05 were considered significant. Multiple comparisons were performed by Duncan’s multiple range test [29].

Results

SNPs of the C3 gene

Compared with the sequence of the bovine C3 gene (GenBank accession NO. NC_007305.4), three new SNPs (g.-1293C>G, g.56T>C, g.7017C>T) were detected in all three tested breeds (Fig 2). One SNP (g.-1293C>G) of the C3 gene was located in the 5′-flanking regions, and the two other SNPs (g.56T>C, g.7017C>T) in exon I and exon XII, which showed one non-synonymous mutation ATG (Met)>ACG (Thr) (at position 19th aa of signal peptide) and one synonymous mutation CAC (His)>CAT (His) (at position 455th aa), respectively. Three new SNPs were submitted to the National Center for Biotechnology Information (NCBI) database (ss289377982, ss289377985, ss289377986). The SNPs such as C>T(rs43501920), A>G (rs43501919), and C>T(rs43501924) of the bovine C3 gene, which had been deposited on the BLASTN program of the NCBI, were not found in our test cattle. We hypothesized that the differences of the bovine population may cause differences in the SNP loci.

Download:

Fig 2. Shows the 5′ region and the exons of the C3 gene in the vertical line and the three new SNPs that we found by sequencing.

https://doi.org/10.1371/journal.pone.0268959.g002

TESS (http://www.cbil.upenn.edu/cgi-bin/tess/tess) and Signal Scan (http://www-bimas.cit.nih.gov/molbio/signal/) were used to confirm the presence of the TATA box and binding sequence motifs by screening the 2 kb 5′-flanking region upstream of the C3 gene. We found that the loci of g.-1293C>G may be involved in the formation of the GC-rich stem-loop structure. This structure participates in the formation of termination mechanism independent of ρ factor of the prokaryotic terminator.

PCR-RFLP and allele frequencies

The three primers, the respective amplified sizes of fragment, and annealing temperatures for the novel SNPs are shown in Table 2. Digestion of the PCR product by Hinf I (containing the C3 g.-1293C>G locus) generated fragments with lengths of 416 and 23 bp for genotype GG; 439, 416, and 23 bp for genotype CG; and 439 bp for genotype CC. Digestion with Sty I (containing the C3 g.56T>C locus) generated fragments of 651 bp for genotype CC; 651, 509, and 142 bp for genotype CT; and 509 and 142 bp for genotype TT owing to a nucleotide substitution. Digestion of the PCR fragment by Hinf I (containing C3 g.7017C>T locus) produced two bands (75 and 50 bp), four bands (75, 50, 40, and 10 bp), and three bands (75, 40, and 10 bp) for the CC, CT, and TT genotypes, respectively. The 23 and 10 bp fragments were not noticeable in the gel due to their small size (Fig 3).

Download:

Fig 3. PCR-RFLP detection results of the three new SNPs (g.-1293C>G, g.56T>C, g.7017C>T) in bovine C3 gene.

https://doi.org/10.1371/journal.pone.0268959.g003

The allele and genotype frequencies of the three SNPs in bovine C3 gene are shown in Table 3. The alleles C, T, and C were the dominant alleles at positions g.-1293C>G, g.56T>C, and g.7017C>T, respectively, in the three breeds. The frequency of alleles C, T, and C varied from 0.76 to 0.8821 at g.-1293C>G, 0.6937 to 0.8585 at g.56T>C, and 0.80 to 0.8289 at g.7017C>T in Chinese Holstein, Luxi Yellow, and Bohai Black breeds, respectively. The homozygote CC genotype at position -1293 was the dominant genotype in Chinese Holstein (0.6991), Luxi Yellow (0.8019), and Bohai Black (0.56) breeds. The heterozygous TC at position 56 was the most common genotype in Chinese Holstein (0.4713), while homozygote TT was the most common genotype in Luxi Yellow (0.717) and Bohai Black (0.64) breeds. At the g.7017C>T locus, the homozygote CC genotype was the dominant genotype in Chinese Holstein (0.6955), Luxi Yellow (0.6132), and Bohai Black (0.60) breeds.

Download:

Table 3. Genotypic distribution and allelic frequencies of 3 SNPs of the bovine C3 gene of three breeds.

https://doi.org/10.1371/journal.pone.0268959.t003

The genetic index was evaluated in the three breeds. The value of χ² test, H_e, N_e, PIC, and Shannon’s information index are presented in Table 4. The result of the χ² test indicated that only position g.-1293C>G did not meet the Hardy–Weinberg equilibrium (P<0.05) in Luxi Yellow breed, while SNPs g.56T>C and g.7017C>T in all three breeds all met the Hardy–Weinberg equilibrium (P>0.05).

Download:

Table 4. χ² tests, heterozygosities (He), effective number of alleles (Ne) and polymorphism information contents (PIC) of C3 gene of three breeds.

https://doi.org/10.1371/journal.pone.0268959.t004

The linkage disequilibrium estimation indicated that the three SNPs were unlinked in the 821 Chinese Holstein cattle (D’<0.75, r²<0.33) (Table 5).

Download:

Table 5. Analysis of pairwise linkage disequilibrium in C3 gene.

https://doi.org/10.1371/journal.pone.0268959.t005

Relationships between SNPs, combined genotypes of C3 gene, and Chinese Holstein cow milk production traits

Table 6 summarizes the effects on milk production traits (rates of fat and protein and milk yield at 305-days) and SCSs. Polymorphism at g.56T>C was strongly correlated with SCS (P<0.05). Cattle that showed the homozygous genotype CC, rather than TC or TT, at position 56 also showed significantly lower SCS (P<0.05). Polymorphism at g.-1293C>G was related to protein rate for studied Chinese Holstein cattle (P<0.05). The homozygous genotype GG at position -1293 had significantly higher protein content than those with genotypes of CC and CG (P<0.05). However, no significant correlation between g.-1293C>G/g.7017C>T polymorphism and SCS/milk traits was found in 821 Chinese Holstein cattle (P>0.05) (Table 6).

Download:

Table 6. Least squares mean (LSM) and standard errors (SE) for SCS, fat, protein rate and milk yield of different C3 genotypes in 821 Chinese Holstein.

https://doi.org/10.1371/journal.pone.0268959.t006

The polymorphism at g.56T>C and g.7017C>T was significantly correlated with serum ACH50 values in 354 Chinese Holstein cows (P<0.01) (Table 7). The homozygous genotype CC at position 56 had significantly higher ACH50 than the genotypes of TC and TT (P<0.01), while the homozygous genotype CC at position 7017 had significantly lower ACH50 than genotypes of CT and TT (P<0.01). The correlation between g.-1293C>G polymorphism and ACH50 was insignificant for the 354 Chinese Holstein cattle (P>0.05).

Download:

Table 7. Least squares mean (LSM) ± standard errors (SE) of various milk production traits in relation to different C3 genotypes among 354 Chinese Holstein cows.

https://doi.org/10.1371/journal.pone.0268959.t007

The C3 SNPs (g.-1293C>G, g.56T>C, and g.7017C>T) were used for haplotype reconstruction, including H1: CCC, H2: CCT, H3: CTC, H4: CTT, H5: GCC, H6: GCT, H7: GTC, and H8: GTT. The estimated frequencies were 0.208, 0.040, 0.476, 0.113, 0.043, 0.002, 0.108, and 0.009 for H1–H8, respectively. Among them, H6 was the least common, while H3 was the most common. Although 27 combined haplotypes were possible across the three SNPs, only 21 combinations were observed in the studied Chinese Holstein individuals.

Six combined genotypes, H1H6(3), H2H2(2), H2H8(2), H4H8(3), H5H8(1), and H7H8 (2), were not included in the association analysis due to the small sample sizes (<4). Statistical results showed that the fat rate, SCS, and protein rate in combinations of haplotype (three SNPs) are significantly different (P<0.05) in the 821 tested Chinese Holstein population (Table 7). No significant difference in 305-day milk yield was determined in various haplotype combinations (Table 8). The individuals with haplotype combination of H1H5 presented a lower SCS than those with haplotype combinations of H1H8 and H4H4 (P<0.05). The individuals with haplotype combinations of H1H1 and H4H4 showed significantly higher protein rate than those with haplotype combinations of H1H4, H1H8, H3H4, and H3H7 (P<0.05). The individuals with haplotype combination of H1H1 had significantly higher fat rate than those with haplotype combination of H1H8 (P<0.05).

Download:

Table 8. Least squares mean (LSM) and standard error (SE) for SCC、fat、protein and milk yield of different C3 haplotype combinations in 821 Chinese Holstein.

https://doi.org/10.1371/journal.pone.0268959.t008

No significant difference in C3 concentration and CH50 305-day milk yield was observed in various haplotype combinations in 354 Chinese Holstein cows (Table 9). However, the individuals with haplotype combination of H1H2 showed higher ACH50 value than those with haplotype combinations of H1H3 (P = 0.0008) and H3H7 (P = 0.001) in 354 Chinese Holstein cows.

Download:

Table 9. Least squares mean (LSM) + standard error (SE) of C3 concentration, ACH50 and CH50 values in different haplotypic combinations among 354 Chinese Holstein cows.

https://doi.org/10.1371/journal.pone.0268959.t009

C3 gene expression

The C3 gene expression levels differed across tissues between healthy and mastitic cattle (Fig 4). Quantitative data indicate that the spleen, heart, and liver tissues had higher C3 expression than the mammary tissues in healthy Chinese Holstein cows (normal group). However, the C3 expression levels were significantly increased in lung and mammary tissues in mastitic cows (abnormal group) compared with those in healthy animals (P<0.05), while the C3 expression levels were significantly decreased in heart, spleen, liver, and kidney tissues in mastitic cows (abnormal group) compared with those in healthy animals (P<0.01).

Download:

Fig 4. C3 expression in different tissues of healthy cow samples and diseased samples.

https://doi.org/10.1371/journal.pone.0268959.g004

C3 antibacterial activity

Genetically resistant cows (H1H5) had serum with noticeably higher antibacterial activity against S. aureus and E. coli (Fig 4) in vitro than genetically susceptible H1H8 cows (P<0.05). Resistant serum (H1H5) that was preincubated with EDTA, heated at 56°C for 30 min, or treated with C3 antibody lost antibacterial activity against both tested strains (Fig 5).

Download:

Fig 5. Serum antibacterial activity of resistant and susceptible cows and neutralization of antibacterial activity from resistant subjects by specific inhibition of C3.

The differences in Log (CFU/ml) between resistant serum and others were highly significant (P<0.001). Data are means ± standard deviation.

https://doi.org/10.1371/journal.pone.0268959.g005

Discussion

Complement, one of the essential effective systems of innate immunity, is present in lower animals such as fish and higher animals such as humans and bovines [30]. The complement system plays a crucial role in innate defense against pathogens and serves as a functional bridge with adaptive immunity to allow integrated host defense [31]. It is a potential therapeutic target for improved general immune response in many species. In the current study, we scanned most exons of the C3 sequence to study the associations between polymorphisms in the C3 gene with the productive traits and immune response traits [18].

The SNP (g.56T>C) in exon I showed one non-synonymous mutation ATG (Met)>ACG (Thr). The loci are at position 19th aa of the signal peptide, which is the C-terminal near the side of action of the signal peptidase. The C-terminal plays an essential role in combining the C3 protein with signal recognition particle, indicating that the region affects the C3 secretion [32]. Twenty-one primer pairs were designed based on DNA sequence of the bovine C3 gene (GenBank accession NO. NC_007305.4) and synthesized to find the SNPs (Table 1). More than 18,000 bp had been detected, only three SNPs have been found in 952 individuals of Chinese Holstein, Luxi Yellow, and Bohai Black breeds. Thus, the gene may be relatively conservative. However, the three breeds did not show all three different genotypes: the Luxi Yellow and Bohai Black cattle with the SNP (g.56T>C) only showed the TT and TC genotypes, while Bohai Black cattle with the SNP (g.7017C>T) only showed the CC and CT genotypes (Table 3). The χ² test results showed that the three SNPs all accord with the Hardy–Weinberg disequilibrium (P>0.05), except for the Luxi Yellow cattle with the SNP (g.-1293C>G) (Table 4). This finding implies that the three SNPs become stable after long-term artificial selection in the chosen samples.

The SNP (g.-1293C>G) is significantly associated with the protein content (Table 6), and the protein content of cows with g.-1293C>G-GG genotype is considerably higher than that of cows with g.-1293C>G-CC and -CG genotypes (P<0.05). The SCS of cows with g.56T>C-CC genotype was significantly lower than that of cows with g.56T>C-TC and -TT genotypes (P<0.05). However, the ACH50 value of cows with g.56T>C-CC genotype was significantly higher than that of cows with g.56T>C-TC and -TT genotypes (P<0.01). The allelic frequencies of G and C of g.-1293C>G and g.56T>C are 16.5% and 29.38%, respectively (Table 3). The results confirmed the importance of the two SNPs, which are better for animals to resist pathogens.

The study wanted to determine why the value of ACH50 was significantly associated with cows with the SNP (g.7017C>T) (P<0.01) (Table 3) and cows with CC have significantly lower ACH50 than those with TT and CT. A previous study [33] found that rare silent mutation can affect protein function in some cellular environments. It may be due to the T allele leading to some three-dimensional structure change of the C3 beta chain and involving the process or the other protein to combine it.

In this study, individuals with the haplotype combination of H1H1 (CCC/CCC) showed higher protein and fat contents (P<0.05) than those with haplotype combinations of H1H8 (CCC/GTT) (P<0.05). Given that individuals with haplotype combination of H1H5 (CCC/GCC) showed significantly lower SCSs and the lowest C3 concentration in serum than individuals with haplotype combinations of H1H8 (CCC/GTT) (P = 0.0007) and H4H4 (CTT/CTT) (P = 0.0021), we can conclude that H1H8 (CCC/GTT) should be abandoned. Cattle with H1H1 (CCC/CCC) and H1H5 (CCC/GCC) haplotype combinations can be selected for breeding to obtain low SCS. Cattle with H1H1 (CCC/CCC) and H1H5 (CCC/GCC) haplotype combinations can be selected for breeding to obtain low SCS. Cows with haplotype combination of H2H4 (CCT/CTT) had a higher value of CH50 and 305-day milk yield than other cows (P>0.05). The individuals with haplotype combination of H1H2 (CCC/CCT) had significantly higher ACH50 than those with haplotype combinations of H1H3 (CCC/CTC) (P = 0.0008) and H3H7 (CTC/GTC) (P = 0.001). Thus, cows having haplotype combinations of H2H4 and H1H2 can be used for breeding to become more resistant to pathogens. A previous study [34] reported the crystal structure of the C3 convertase formed by C3b and the protease fragment Bb, which was stabilized by the bacterial immune-evasion protein SCIN (Staphylococcal complement inhibitor). Thus, the SCIN from S. aureus can obstruct the activation of C3 protein and can affect a series of reactions caused by C3 activation [34]. The results of the preliminary test of antibacterial activity of C3 (Fig 5) further verified that cows with the haplotype combination of H1H5 (CCC/GCC) are more resistant than those with H1H8 (CCC/GTT). The bacterial count increased when resistant serum samples with the H1H5 (CCC/GCC) haplotype combination were incubated with EDTA and C3 antibody samples and treated at 56°C for 30 min (Fig 5). This finding indicates that C3 protein plays an indispensable role in the complement system.

Mastitis resistance is a complex trait. It depends on a genetic component and physiological and environmental factors, including infectious pressure Intramammary infections with E. coli often result in acute mastitis with severe clinical consequences [3]. Some S. aureus infections may also cause subclinical mastitis with no apparent clinical symptoms (e.g., swelling of the udder, milk flakes, fever) and only intermittent detection of bacteria in milk paired with elevated somatic cell counts. Our findings demonstrate an association between the C3 gene and hemolytic complement activity. Although complement is a complex multigene process, which serves in the defence against many pathogenic agents, this aspect of complement is now better understood, reinforcing the overall importance of C3 as a candidate gene for natural forms of defence against various microorganisms.

For humans, homozygous deficiency at the C3 locus is a rare autosomal disease characterized by increased susceptibility to bacteria such as Neisseria meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae [35, 36] or viral infections [37]. C3 plays a vital role as an opsonin for bacteria during the early years of life and is less critical in adults, in whom protective antibodies and anamnestic responses have developed [38]. Several studies have investigated the association of polymorphisms in the C3 component of the male complement system and the susceptibility of some of its alleles to some diseases. The Human serum complement C3 component is the core of the complement system. Several receptor sites of the C3 molecule act broadly with pathogens, blood cells, and stromal cells [39, 40], especially the sites that bind to the type I receptor of the erythrocyte complement (CR1, CD35) and the complement type III receptor of the monocytes and macrophages (CR3, CD11b/CD18) [36]. Thus, C3 mediates the adhesion of pathogens, killing and clearing the immune complex in vivo as a bridge [37].

The study indicates that the C3 gene plays a role in resistance to bacterial infection and can be used as a molecular marker for complement activity and traits related to milk production. This study is the first to describe the association between polymorphisms in the bovine C3 gene and milk production traits and complement activity, which has never been done before. Our study investigated the bovine C3 as a candidate gene for complement activity and provides valuable information for further research. Therefore, the compound effect of haplotypes and combined genotypes should be analyzed instead of single locus.

Supporting information

S1 Fig. Bohai Black cattle.

https://doi.org/10.1371/journal.pone.0268959.s001

(TIFF)

S2 Fig. Chinese Holstein cattle.

https://doi.org/10.1371/journal.pone.0268959.s002

(TIFF)

S3 Fig. Luxi Yellow cattle.

https://doi.org/10.1371/journal.pone.0268959.s003

(TIFF)

S1 Raw images.

https://doi.org/10.1371/journal.pone.0268959.s004

(PDF)

Acknowledgments

Our deepest gratitude goes to the editors for their careful work and thoughtful suggestions that improved the manuscript substantially.

References

1. Thompson-Crispi K, Atalla H, Miglior F, Mallard B. Bovine Mastitis: Frontiers in Immunogenetics. Frontiers in Immunology. 2014;5(493). pmid:25339959
- View Article
- PubMed/NCBI
- Google Scholar
2. Hertl J, Schukken Y, Welcome F, Tauer L, Gröhn Y. Effects of pathogen-specific clinical mastitis on probability of conception in Holstein dairy cows. Journal of dairy science. 2014;97 11:6942–54. pmid:25173468
- View Article
- PubMed/NCBI
- Google Scholar
3. Leelahapongsathon K, Schukken Y, Suriyasathaporn W. Quarter, cow, and farm risk factors for intramammary infections with major pathogens relative to minor pathogens in Thai dairy cows. Tropical Animal Health and Production. 2014;46:1067–78. pmid:24823898
- View Article
- PubMed/NCBI
- Google Scholar
4. Vliegher SD, Fox L, Piepers S, McDougall S, Barkema H. Invited review: Mastitis in dairy heifers: nature of the disease, potential impact, prevention, and control. Journal of dairy science. 2012;95 3:1025–40.
- View Article
- Google Scholar
5. Oviedo-Boyso J, Valdez-Alarcón JJ, Cajero-Juárez M, Ochoa-Zarzosa A, López-Meza J, Bravo-Patiño A, et al. Innate immune response of bovine mammary gland to pathogenic bacteria responsible for mastitis. The Journal of infection. 2007;54 4:399–409. pmid:16882453
- View Article
- PubMed/NCBI
- Google Scholar
6. Swanson K, Stelwagen K, Dobson J, Henderson H, Davis S, Farr V, et al. Transcriptome profiling of Streptococcus uberis-induced mastitis reveals fundamental differences between immune gene expression in the mammary gland and in a primary cell culture model. Journal of dairy science. 2009;92 1:117–29.
- View Article
- Google Scholar
7. Liu J, Ju Z, Li Q, Huang J, Li R, Li J, et al. Mannose-binding lectin 1 haplotypes influence serum MBL-A concentration, complement activity, and milk production traits in Chinese Holstein cattle. Immunogenetics. 2011;63:727–42. pmid:21695551
- View Article
- PubMed/NCBI
- Google Scholar
8. Wang X, Ju Z, Huang J, Hou M, Zhou L, Qi C, et al. The relationship between the variants of the bovine MBL2 gene and milk production traits, mastitis, serum MBL-C levels and complement activity. Veterinary immunology and immunopathology. 2012;148 3–4:311–9. pmid:22771198
- View Article
- PubMed/NCBI
- Google Scholar
9. Yang Y, Li Q, Ju Z, Huang J, Zhou L, Li R, et al. Three novel single-nucleotide polymorphisms of complement component 4 gene (C4A) in Chinese Holstein cattle and their associations with milk performance traits and CH50. Veterinary immunology and immunopathology. 2012;145 1–2:223–32.
- View Article
- Google Scholar
10. Fredslund F, Jenner L, Husted L, Nyborg J, Andersen G, Sottrup-jensen L. The structure of bovine complement component 3 reveals the basis for thioester function. Journal of molecular biology. 2006;361(1):115–27. pmid:16831446
- View Article
- PubMed/NCBI
- Google Scholar
11. Sahu A, Lambris J. Structure and biology of complement protein C3, a connecting link between innate and acquired immunity. Immunological Reviews. 2001;180.
- View Article
- Google Scholar
12. Minton K. Innate immunity: The inside story on complement activation. Nature Reviews Immunology. 2014;14:61–. pmid:24378841
- View Article
- PubMed/NCBI
- Google Scholar
13. Günther J, Koczan D, Yang W, Nürnberg G, Repsilber D, Schuberth H, et al. Assessment of the immune capacity of mammary epithelial cells: comparison with mammary tissue after challenge with Escherichia coli. Veterinary Research. 2009;40.
- View Article
- Google Scholar
14. Rainard P. The complement in milk and defense of the bovine mammary gland against infections. Veterinary research. 2003;34(5):647–70. pmid:14556699
- View Article
- PubMed/NCBI
- Google Scholar
15. Danielsen M, Codrea M, Ingvartsen K, Friggens N, Bendixen E, Røntved C. Quantitative milk proteomics Host responses to lipopolysaccharid… mediated inflammation of bovine mammary gland. Proteomics. 2010; 10(12):2240–9. pmid:20352626
- View Article
- PubMed/NCBI
- Google Scholar
16. Sotirov L, Dimitrov I, Djorbineva M, Jeliazkov E. Effect of complement C3 genotypes on milk production in sheep. Revue De Medecine Veterinaire. 2006;157:391–5.
- View Article
- Google Scholar
17. Wimmers K, Mekchay S, Schellander K, Ponsuksili S. Molecular characterization of the pig C3 gene and its association with complement activity. Immunogenetics. 2003;54:714–24. pmid:12557058
- View Article
- PubMed/NCBI
- Google Scholar
18. Xu L. Survey of Incidence of Cow Mastitis in West Liaoning and the Integrated Control Measures. China Cattle Science. 2007;33(4):61–3.
- View Article
- Google Scholar
19. El-Halawany N, Shawky A-E-MA, AL-TOHAMY AFM, Hegazy L, Abdel-Shafy H, Abdel-Latif MA, et al. Complement component 3: characterization and association with mastitis resistance in Egyptian water buffalo and cattle. Journal of Genetics. 2017;96:65–73. pmid:28360391
- View Article
- PubMed/NCBI
- Google Scholar
20. Gan H, Li J, Wang H, Gao Y, Liu W, Zhong J. Allele frequencies of TYR and MC1R in Chinese native cattle. Animal Science Journal. 2007;78:484–8.
- View Article
- Google Scholar
21. Wang X, Huang J, Zhao L, Wang C, Ju Z, Li Q, et al. The exon 29 c.3535A>T in the alpha-2-macroglobulin gene causing aberrant splice variants is associated with mastitis in dairy cattle. Immunogenetics. 2012;64:807–16. pmid:22923050
- View Article
- PubMed/NCBI
- Google Scholar
22. Koppenheffer T, Spong K, Falvo HM. The complement system of the marsupial Monodelphis domestica. Developmental and comparative immunology. 1998;22 2:231–7. pmid:9639092
- View Article
- PubMed/NCBI
- Google Scholar
23. Sherman N, Romsdahl M, Evans H, Zagars G, Oswald M. Desmoid tumors: a 20-year radiotherapy experience. International journal of radiation oncology, biology, physics. 1990;19 1:37–40. pmid:2380093
- View Article
- PubMed/NCBI
- Google Scholar
24. Uemura T, Nakao M, Matsuyama H, Yano T. An Improved Method for the Preparation of EAC14, an Intermediate in Immune Hemolysis by Carp Complement. Journal of The Faculty of Agriculture Kyushu University. 1992;36:273–8.
- View Article
- Google Scholar
25. Capparelli R, Parlato M, Amoroso MG, Roperto S, Marabelli R, Roperto F, et al. Mannose-binding lectin haplotypes influence Brucella abortus infection in the water buffalo (Bubalus bubalis). Immunogenetics. 2008;60:157–65. pmid:18330558
- View Article
- PubMed/NCBI
- Google Scholar
26. Rupp R, Boichard D. Genetic parameters for clinical mastitis, somatic cell score, production, udder type traits, and milking ease in first lactation Holsteins. Journal of dairy science. 1999;82 10:2198–204.
- View Article
- Google Scholar
27. Miller MP. Tools for Population Genetic Analysis (TFPGA) 1.3: A Windows Program for the Analysis of Elysium and Molecular Population Genetic Data. 1997.
- View Article
- Google Scholar
28. Yong Y, He L. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Research. 2005;15:97–8. pmid:15740637
- View Article
- PubMed/NCBI
- Google Scholar
29. Duncan DB. Multiple range and multiple f tests. Biometrics. 1955;11:1–42.
- View Article
- Google Scholar
30. Sunyer J, Zarkadis I, Lambris J. Complement diversity: a mechanism for generating immune diversity? Immunology today. 1998;19(11):519–23. pmid:9818547
- View Article
- PubMed/NCBI
- Google Scholar
31. Dunkelberger J, Song W. Complement and its role in innate and adaptive immune responses. Cell Research. 2010;20:34–50. pmid:20010915
- View Article
- PubMed/NCBI
- Google Scholar
32. Ricklin D, Reis ES, Mastellos DC, Gros P, Lambris JD. Complement component C3—The "Swiss Army Knife" of innate immunity and host defense. Immunol Rev. 2016; 274(1):33–58. pmid:27782325
- View Article
- PubMed/NCBI
- Google Scholar
33. Hunt R, Sauna Z, Ambudkar S, Gottesman M, Kimchi-Sarfaty C. Silent (synonymous) SNPs: should we care about them? Methods in molecular biology. 2009;578:23–39. pmid:19768585
- View Article
- PubMed/NCBI
- Google Scholar
34. Rooijakkers S, Wu J, Ruyken M, Domselaar R, Planken KL, Tzekou A, et al., editors. Structural and functional implications of the alternative complement pathway C3 convertase stabilized by a staphylococcal inhibitor. 2009;10(7):721–727. pmid:19503103
- View Article
- PubMed/NCBI
- Google Scholar
35. Kopf M, Abel B, Gallimore A, Carroll M, Bachmann M. Complement component C3 promotes T-cell priming and lung migration to control acute influenza virus infection. Nature Medicine. 2002;8:373–8. pmid:11927943
- View Article
- PubMed/NCBI
- Google Scholar
36. Craig M, Waitumbi J, Taylor R. Processing of C3b-Opsonized Immune Complexes Bound to Non-Complement Receptor 1 (CR1) Sites on Red Cells: Phagocytosis, Transfer, and Associations with CR11. The Journal of Immunology. 2005;174:3059–66. pmid:15728520
- View Article
- PubMed/NCBI
- Google Scholar
37. Colucci-Guyon E, Niedergang F, Wallar B, Peng J, Alberts A, Chavrier P. A Role for Mammalian Diaphanous-Related Formins in Complement Receptor (CR3)-Mediated Phagocytosis in Macrophages. Current Biology. 2005;15:2007–12. pmid:16303559
- View Article
- PubMed/NCBI
- Google Scholar
38. Botto M, Kirschfink M, Macor P, Pickering M, Würzner R, Tedesco FS. Complement in human diseases: Lessons from complement deficiencies. Molecular immunology. 2009;46(14):2774–83. pmid:19481265
- View Article
- PubMed/NCBI
- Google Scholar
39. Janssen B., Huizinga E., Raaijmakers H. et al. Structures of complement component C3 provide insights into the function and evolution of immunity. Nature. 2005; 437:505–511. pmid:16177781
- View Article
- PubMed/NCBI
- Google Scholar
40. S Reis E, Falcão DA, Isaac L. Clinical aspects and molecular basis of primary deficiencies of complement component C3 and its regulatory proteins factor I and factor H. Scand J Immunol. 2006;63(3):155–68 pmid:16499568
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Thompson-Crispi K, Atalla H, Miglior F, Mallard B. Bovine Mastitis: Frontiers in Immunogenetics. Frontiers in Immunology. 2014;5(493). pmid:25339959
View Article
PubMed/NCBI
Google Scholar

[2] View Article

[3] PubMed/NCBI

[4] Google Scholar

[ref2] 2. Hertl J, Schukken Y, Welcome F, Tauer L, Gröhn Y. Effects of pathogen-specific clinical mastitis on probability of conception in Holstein dairy cows. Journal of dairy science. 2014;97 11:6942–54. pmid:25173468
View Article
PubMed/NCBI
Google Scholar

[6] View Article

[7] PubMed/NCBI

[8] Google Scholar

[ref3] 3. Leelahapongsathon K, Schukken Y, Suriyasathaporn W. Quarter, cow, and farm risk factors for intramammary infections with major pathogens relative to minor pathogens in Thai dairy cows. Tropical Animal Health and Production. 2014;46:1067–78. pmid:24823898
View Article
PubMed/NCBI
Google Scholar

[10] View Article

[11] PubMed/NCBI

[12] Google Scholar

[ref4] 4. Vliegher SD, Fox L, Piepers S, McDougall S, Barkema H. Invited review: Mastitis in dairy heifers: nature of the disease, potential impact, prevention, and control. Journal of dairy science. 2012;95 3:1025–40.
View Article
Google Scholar

[14] View Article

[15] Google Scholar

[ref5] 5. Oviedo-Boyso J, Valdez-Alarcón JJ, Cajero-Juárez M, Ochoa-Zarzosa A, López-Meza J, Bravo-Patiño A, et al. Innate immune response of bovine mammary gland to pathogenic bacteria responsible for mastitis. The Journal of infection. 2007;54 4:399–409. pmid:16882453
View Article
PubMed/NCBI
Google Scholar

[17] View Article

[18] PubMed/NCBI

[19] Google Scholar

[ref6] 6. Swanson K, Stelwagen K, Dobson J, Henderson H, Davis S, Farr V, et al. Transcriptome profiling of Streptococcus uberis-induced mastitis reveals fundamental differences between immune gene expression in the mammary gland and in a primary cell culture model. Journal of dairy science. 2009;92 1:117–29.
View Article
Google Scholar

[21] View Article

[22] Google Scholar

[ref7] 7. Liu J, Ju Z, Li Q, Huang J, Li R, Li J, et al. Mannose-binding lectin 1 haplotypes influence serum MBL-A concentration, complement activity, and milk production traits in Chinese Holstein cattle. Immunogenetics. 2011;63:727–42. pmid:21695551
View Article
PubMed/NCBI
Google Scholar

[24] View Article

[25] PubMed/NCBI

[26] Google Scholar

[ref8] 8. Wang X, Ju Z, Huang J, Hou M, Zhou L, Qi C, et al. The relationship between the variants of the bovine MBL2 gene and milk production traits, mastitis, serum MBL-C levels and complement activity. Veterinary immunology and immunopathology. 2012;148 3–4:311–9. pmid:22771198
View Article
PubMed/NCBI
Google Scholar

[28] View Article

[29] PubMed/NCBI

[30] Google Scholar

[ref9] 9. Yang Y, Li Q, Ju Z, Huang J, Zhou L, Li R, et al. Three novel single-nucleotide polymorphisms of complement component 4 gene (C4A) in Chinese Holstein cattle and their associations with milk performance traits and CH50. Veterinary immunology and immunopathology. 2012;145 1–2:223–32.
View Article
Google Scholar

[32] View Article

[33] Google Scholar

[ref10] 10. Fredslund F, Jenner L, Husted L, Nyborg J, Andersen G, Sottrup-jensen L. The structure of bovine complement component 3 reveals the basis for thioester function. Journal of molecular biology. 2006;361(1):115–27. pmid:16831446
View Article
PubMed/NCBI
Google Scholar

[35] View Article

[36] PubMed/NCBI

[37] Google Scholar

[ref11] 11. Sahu A, Lambris J. Structure and biology of complement protein C3, a connecting link between innate and acquired immunity. Immunological Reviews. 2001;180.
View Article
Google Scholar

[39] View Article

[40] Google Scholar

[ref12] 12. Minton K. Innate immunity: The inside story on complement activation. Nature Reviews Immunology. 2014;14:61–. pmid:24378841
View Article
PubMed/NCBI
Google Scholar

[42] View Article

[43] PubMed/NCBI

[44] Google Scholar

[ref13] 13. Günther J, Koczan D, Yang W, Nürnberg G, Repsilber D, Schuberth H, et al. Assessment of the immune capacity of mammary epithelial cells: comparison with mammary tissue after challenge with Escherichia coli. Veterinary Research. 2009;40.
View Article
Google Scholar

[46] View Article

[47] Google Scholar

[ref14] 14. Rainard P. The complement in milk and defense of the bovine mammary gland against infections. Veterinary research. 2003;34(5):647–70. pmid:14556699
View Article
PubMed/NCBI
Google Scholar

[49] View Article

[50] PubMed/NCBI

[51] Google Scholar

[ref15] 15. Danielsen M, Codrea M, Ingvartsen K, Friggens N, Bendixen E, Røntved C. Quantitative milk proteomics Host responses to lipopolysaccharid… mediated inflammation of bovine mammary gland. Proteomics. 2010; 10(12):2240–9. pmid:20352626
View Article
PubMed/NCBI
Google Scholar

[53] View Article

[54] PubMed/NCBI

[55] Google Scholar

[ref16] 16. Sotirov L, Dimitrov I, Djorbineva M, Jeliazkov E. Effect of complement C3 genotypes on milk production in sheep. Revue De Medecine Veterinaire. 2006;157:391–5.
View Article
Google Scholar

[57] View Article

[58] Google Scholar

[ref17] 17. Wimmers K, Mekchay S, Schellander K, Ponsuksili S. Molecular characterization of the pig C3 gene and its association with complement activity. Immunogenetics. 2003;54:714–24. pmid:12557058
View Article
PubMed/NCBI
Google Scholar

[60] View Article

[61] PubMed/NCBI

[62] Google Scholar

[ref18] 18. Xu L. Survey of Incidence of Cow Mastitis in West Liaoning and the Integrated Control Measures. China Cattle Science. 2007;33(4):61–3.
View Article
Google Scholar

[64] View Article

[65] Google Scholar

[ref19] 19. El-Halawany N, Shawky A-E-MA, AL-TOHAMY AFM, Hegazy L, Abdel-Shafy H, Abdel-Latif MA, et al. Complement component 3: characterization and association with mastitis resistance in Egyptian water buffalo and cattle. Journal of Genetics. 2017;96:65–73. pmid:28360391
View Article
PubMed/NCBI
Google Scholar

[67] View Article

[68] PubMed/NCBI

[69] Google Scholar

[ref20] 20. Gan H, Li J, Wang H, Gao Y, Liu W, Zhong J. Allele frequencies of TYR and MC1R in Chinese native cattle. Animal Science Journal. 2007;78:484–8.
View Article
Google Scholar

[71] View Article

[72] Google Scholar

[ref21] 21. Wang X, Huang J, Zhao L, Wang C, Ju Z, Li Q, et al. The exon 29 c.3535A>T in the alpha-2-macroglobulin gene causing aberrant splice variants is associated with mastitis in dairy cattle. Immunogenetics. 2012;64:807–16. pmid:22923050
View Article
PubMed/NCBI
Google Scholar

[74] View Article

[75] PubMed/NCBI

[76] Google Scholar

[ref22] 22. Koppenheffer T, Spong K, Falvo HM. The complement system of the marsupial Monodelphis domestica. Developmental and comparative immunology. 1998;22 2:231–7. pmid:9639092
View Article
PubMed/NCBI
Google Scholar

[78] View Article

[79] PubMed/NCBI

[80] Google Scholar

[ref23] 23. Sherman N, Romsdahl M, Evans H, Zagars G, Oswald M. Desmoid tumors: a 20-year radiotherapy experience. International journal of radiation oncology, biology, physics. 1990;19 1:37–40. pmid:2380093
View Article
PubMed/NCBI
Google Scholar

[82] View Article

[83] PubMed/NCBI

[84] Google Scholar

[ref24] 24. Uemura T, Nakao M, Matsuyama H, Yano T. An Improved Method for the Preparation of EAC14, an Intermediate in Immune Hemolysis by Carp Complement. Journal of The Faculty of Agriculture Kyushu University. 1992;36:273–8.
View Article
Google Scholar

[86] View Article

[87] Google Scholar

[ref25] 25. Capparelli R, Parlato M, Amoroso MG, Roperto S, Marabelli R, Roperto F, et al. Mannose-binding lectin haplotypes influence Brucella abortus infection in the water buffalo (Bubalus bubalis). Immunogenetics. 2008;60:157–65. pmid:18330558
View Article
PubMed/NCBI
Google Scholar

[89] View Article

[90] PubMed/NCBI

[91] Google Scholar

[ref26] 26. Rupp R, Boichard D. Genetic parameters for clinical mastitis, somatic cell score, production, udder type traits, and milking ease in first lactation Holsteins. Journal of dairy science. 1999;82 10:2198–204.
View Article
Google Scholar

[93] View Article

[94] Google Scholar

[ref27] 27. Miller MP. Tools for Population Genetic Analysis (TFPGA) 1.3: A Windows Program for the Analysis of Elysium and Molecular Population Genetic Data. 1997.
View Article
Google Scholar

[96] View Article

[97] Google Scholar

[ref28] 28. Yong Y, He L. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Research. 2005;15:97–8. pmid:15740637
View Article
PubMed/NCBI
Google Scholar

[99] View Article

[100] PubMed/NCBI

[101] Google Scholar

[ref29] 29. Duncan DB. Multiple range and multiple f tests. Biometrics. 1955;11:1–42.
View Article
Google Scholar

[103] View Article

[104] Google Scholar

[ref30] 30. Sunyer J, Zarkadis I, Lambris J. Complement diversity: a mechanism for generating immune diversity? Immunology today. 1998;19(11):519–23. pmid:9818547
View Article
PubMed/NCBI
Google Scholar

[106] View Article

[107] PubMed/NCBI

[108] Google Scholar

[ref31] 31. Dunkelberger J, Song W. Complement and its role in innate and adaptive immune responses. Cell Research. 2010;20:34–50. pmid:20010915
View Article
PubMed/NCBI
Google Scholar

[110] View Article

[111] PubMed/NCBI

[112] Google Scholar

[ref32] 32. Ricklin D, Reis ES, Mastellos DC, Gros P, Lambris JD. Complement component C3—The "Swiss Army Knife" of innate immunity and host defense. Immunol Rev. 2016; 274(1):33–58. pmid:27782325
View Article
PubMed/NCBI
Google Scholar

[114] View Article

[115] PubMed/NCBI

[116] Google Scholar

[ref33] 33. Hunt R, Sauna Z, Ambudkar S, Gottesman M, Kimchi-Sarfaty C. Silent (synonymous) SNPs: should we care about them? Methods in molecular biology. 2009;578:23–39. pmid:19768585
View Article
PubMed/NCBI
Google Scholar

[118] View Article

[119] PubMed/NCBI

[120] Google Scholar

[ref34] 34. Rooijakkers S, Wu J, Ruyken M, Domselaar R, Planken KL, Tzekou A, et al., editors. Structural and functional implications of the alternative complement pathway C3 convertase stabilized by a staphylococcal inhibitor. 2009;10(7):721–727. pmid:19503103
View Article
PubMed/NCBI
Google Scholar

[122] View Article

[123] PubMed/NCBI

[124] Google Scholar

[ref35] 35. Kopf M, Abel B, Gallimore A, Carroll M, Bachmann M. Complement component C3 promotes T-cell priming and lung migration to control acute influenza virus infection. Nature Medicine. 2002;8:373–8. pmid:11927943
View Article
PubMed/NCBI
Google Scholar

[126] View Article

[127] PubMed/NCBI

[128] Google Scholar

[ref36] 36. Craig M, Waitumbi J, Taylor R. Processing of C3b-Opsonized Immune Complexes Bound to Non-Complement Receptor 1 (CR1) Sites on Red Cells: Phagocytosis, Transfer, and Associations with CR11. The Journal of Immunology. 2005;174:3059–66. pmid:15728520
View Article
PubMed/NCBI
Google Scholar

[130] View Article

[131] PubMed/NCBI

[132] Google Scholar

[ref37] 37. Colucci-Guyon E, Niedergang F, Wallar B, Peng J, Alberts A, Chavrier P. A Role for Mammalian Diaphanous-Related Formins in Complement Receptor (CR3)-Mediated Phagocytosis in Macrophages. Current Biology. 2005;15:2007–12. pmid:16303559
View Article
PubMed/NCBI
Google Scholar

[134] View Article

[135] PubMed/NCBI

[136] Google Scholar

[ref38] 38. Botto M, Kirschfink M, Macor P, Pickering M, Würzner R, Tedesco FS. Complement in human diseases: Lessons from complement deficiencies. Molecular immunology. 2009;46(14):2774–83. pmid:19481265
View Article
PubMed/NCBI
Google Scholar

[138] View Article

[139] PubMed/NCBI

[140] Google Scholar

[ref39] 39. Janssen B., Huizinga E., Raaijmakers H. et al. Structures of complement component C3 provide insights into the function and evolution of immunity. Nature. 2005; 437:505–511. pmid:16177781
View Article
PubMed/NCBI
Google Scholar

[142] View Article

[143] PubMed/NCBI

[144] Google Scholar

[ref40] 40. S Reis E, Falcão DA, Isaac L. Clinical aspects and molecular basis of primary deficiencies of complement component C3 and its regulatory proteins factor I and factor H. Scand J Immunol. 2006;63(3):155–68 pmid:16499568
View Article
PubMed/NCBI
Google Scholar

[146] View Article

[147] PubMed/NCBI

[148] Google Scholar

Figures

Abstract

Introduction

Materials and methods

Ethical statement

Study animals

Chemicals and reagents

DNA extraction

Detection of C3 gene polymorphisms

Nucleotide sequencing

Classical complement pathway hemolytic titer (CH50) assay

Alternative complement pathway hemolytic titer (ACH50) assay

Measurement of C3 protein level in serum

Serum antibacterial activity of different haplotypic combinations

Fluorescence quantitative real-time PCR (RT-PCR)

Statistical analysis

Results

SNPs of the C3 gene

PCR-RFLP and allele frequencies

Relationships between SNPs, combined genotypes of C3 gene, and Chinese Holstein cow milk production traits

C3 gene expression

C3 antibacterial activity

Discussion

Supporting information

S1 Fig. Bohai Black cattle.

S2 Fig. Chinese Holstein cattle.

S3 Fig. Luxi Yellow cattle.

S1 Raw images.

Acknowledgments

References