https://orcid.org/0000-0003-2104-0979
Figures
Abstract
The Zygothrica genus group has been shown to be speciose, with a high number of cryptic species. DNA barcoding approaches have been a valuable tool to uncover cryptic diversity in this lineage, as recently suggested for the Neotropical Mycodrosophila projectans complex, which seems to comprise at least three different species. The aim of this study was to confirm the subdivision of the M. projectans complex while shedding some light on the patterns and processes related to its diversification. In this sense, the use of single and multi-locus datasets under phylogenetic, distance, coalescence, and diagnostic nucleotide approaches confirmed the presence of at least three species under the general morphotype previously described as M. projectans. Only a few subtle morphological differences were found for the three species in terms of aedeagus morphology and abdominal color patterns. Ecologically, sympatry and syntopy seem to be recurrent for these three cryptic species, which present widely overlapping niches, implying niche conservatism. This morphological and ecological similarity has persisted though cladogenesis within the complex, which dates back to the Miocene, providing an interesting example of morphological conservation despite ancient divergence. These results, in addition to contrasting patterns of past demographic fluctuations, allowed us to hypothesize patterns of allopatric or parapatric diversification with secondary contact in Southern Brazil. Nevertheless, genetic diversity was generally high within species, suggesting that migration may encompass an adaptive response to the restrictions imposed by the ephemerality of resources.
Citation: Machado S, Hartwig Bessa M, Nornberg B, Silva Gottschalk M, Robe LJ (2022) Unveiling the Mycodrosophila projectans (Diptera, Drosophilidae) species complex: Insights into the evolution of three Neotropical cryptic and syntopic species. PLoS ONE 17(5): e0268657. https://doi.org/10.1371/journal.pone.0268657
Editor: William J. Etges, University of Arkansas, UNITED STATES
Received: September 2, 2021; Accepted: May 4, 2022; Published: May 25, 2022
Copyright: © 2022 Machado et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: Concerning deposition of data in repositories, all new sequences were submitted to GenBank, and accession numbers are provided in S2 Table. These sequences will be directly released once they appear on a published document, according to NCBI standards. Other relevant data are within the paper and its Supporting Information files.
Funding: This study was supported by Universal-CNPq 14/2013, process numbers 471174/2013-0 and 472973/2013-4. S. M. and M. H. B had a research grant from Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - CAPES (Finance Code 001). L.J.R. is research fellow of CNPq – PQ (# 308371/2018-6). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
The Neotropical region harbors around 13% of the world’s biodiversity [1, 2], encompassing five megadiverse countries [3] and three major biodiversity hotspots [4]. Although the processes responsible for the origin of this diversity have been previously discussed [5–7], it is still estimated that for each known Neotropical species, 10 remain unknown [1]. Molecular taxonomy, and in particular the DNA barcoding approach, has contributed significantly to the task of unravelling these high levels of unknown or cryptic diversity [8]. These tools are especially important when speciation occurs in the absence of morphological divergence, a phenomenon known as cryptic speciation [9–12]. The mechanisms responsible for this pattern are not well understood [13], but it has been suggested that sexual selection acting at the level of non-visual signals [14], recent divergence [15], chance fixation of alleles related to epistatic incompatibilities [16], and allopatric speciation associated with morphological stasis or convergent evolution [17] may help to explain the ubiquity of this phenomenon.
The family Drosophilidae includes more than 4,300 species found in almost all biogeographic regions of the planet [18–20]. Different species are associated with diverse resources, such as fruit, fungi, sap, pollen, and rotten leaves [19, 21]. This ecological diversity is largely due to the saprophagous nature of drosophilids that feed mainly on bacteria and yeast involved in fermentation or on fermentation by-products [18, 19, 22]. Nevertheless, many species are also associated with macroscopic fungi, using them as a resource for feeding (eating spores and hyphae [23]), oviposition and/or breeding sites. This is the case for the Zygothrica genus group, which encompasses five mycophagous genera: Hirtodrosophila, Mycodrosophila, Paraliodrosophila, Paramycodrosophila, and Zygothrica.
Mycodrosophila Oldenberg, 1914, comprises around 130 obligatory mycophagous species, which depend on fungi in all stages of their life cycle [24]. This genus seems to have originated in the Old World, later migrating to the New World, where it currently occupies the Nearctic and Neotropical regions [18, 20, 25]. Although only 4% of its diversity has been reported in the Neotropics [20, 24], there is evidence suggesting that the diversity of Mycodrosophila in this biogeographic region might be underestimated due to sampling bias [26]. In Brazil, for instance, the number of species described in this genus has nearly doubled in the last two years due to integrated taxonomical efforts, associating traditional morphological techniques with DNA barcoding [25, 27, 28]. The latter approach suggested the existence of entirely cryptic species of Mycodrosophila, which cannot be easily differentiated even at the level of male genitalia [28].
Mycodrosophila projectans (Sturtevant, 1916) has been considered a widely distributed Neotropical species, with records from Mexico to Brazil [25, 29]. However, when some of these Neotropical populations were evaluated through DNA Barcoding approaches using only nucleotide sequences of the mitochondrial cytochrome oxidase c subunit I (COI) gene, at least three different lineages were uncovered [28]: M. projectans, M. projectans affinis 1 and M. projectans affinis 2. However, these results should be interpreted with caution because the sole use of mitochondrial genes may be misleading due to the presence of nuclear paralogues of mitochondrial genes (numts [30]) or “hitchhiking” with maternally inherited endoparasites [31]. The presence of numts can lead to divergent sequences even within the same genome [30], and endoparasites can modify the matrilineal history of mitochondrial genes both from intraspecific or interspecific populations, causing divergence or homogenization at the level of their mitochondrial nucleotide sequences [31]. The endoparasite Wolbachia has already been reported in some groups of mycophagous drosophilids, including one species of Hirtodrosophila; therefore, mushrooms may be hotspots for horizontal transfer of this endoparasite, where multiple drosophilid species co-exist [32]. Including nuclear gene sequences or morphological markers, along with mitochondrial genes, may allow insight into these evolutionary relationships.
The aim of the present study was to confirm the subdivision of the M. projectans complex while shedding some light on the patterns and processes related to its diversification. We increased sampling for the mitochondrial COI gene and incorporated sequences of the mitochondrial cytochrome oxidase c subunit II (COII) gene and of the nuclear hunchback (HB) and alpha methyldopa (AMD) genes. We also performed further morphological and ecological niche modelling evaluations. These analyses confirmed the existence of at least three species within the M. projectans complex and indicated some putative autapomorphies related to abdominal color and male genitalia patterns. The morphological and ecological similarity of the three species was notable, especially in the face of divergence dating back to the Miocene.
Materials and methods
Sampling
Collections were made at 45 sites distributed along Amazonian, Atlantic Forest, and Pampa Brazilian Biomes (S1 Table, Fig 1). The Amazonian biome occupies around 6.7 million km2, and its vegetation includes dry land forests, floodplain forests and igapós [33]. The Atlantic Forest includes ca 1.1 million km2 along coastal Brazil, with a large latitudinal range encompassing tropical and subtropical regions [34]. The Pampa biome is restricted to the state of Rio Grande do Sul and occupies an area of 176.5 km2, characterized by grasslands with sparse shrubs and forests within the South Temperate Zone [35]. In these localities, active searches for fruiting bodies of macroscopic fungi were performed in forest fragments during daylight. Adults resting or flying over the fungi were collected with an aspirator [36], and in some cases, fungi were returned to the laboratory and maintained until adults emerged. Flies were stored in absolute ethanol, and an initial identification was performed based on external morphology and male genitalia. Only males were used because morphological differences at the aedeagus level provide more accurate species identification. All material was collected in accordance with Brazilian law, under a scientific collection license (SISBIO number 28013–12). As practices did not involve vertebrate species, Brazilian law does not require approval from the Ethics Committee on Animal use.
Map of sampling points (A) and geographical distribution of COI haplotypes recovered for each species of the M. projectans complex: (B) M. projectans affinis 1, (C) M. projectans affinis 2, and (D) M. projectans affinis 3. Brazilian biomes where collections were performed are highlighted on the map, in which squares indicate sampling points where all three species of the M. projectans complex were collected in sympatry; triangles indicate sampling points where two species were sampled; and circles represent single species records. Colors represent each different sampling point, according to the legend presented on the lower left margin. On the Networks, each circle represents a different haplotype, whose size is proportional to frequency, and whose colors refer to each locality on the map. Black small circles represent median vectors. Dashes in the lines connecting different haplotypes represent the number of mutations between them. Neotropical and Brazilian Biomes shapefiles were obtained from Löwenberg-Neto [108] and from IBGE [109], respectively.
Amplification, sequencing, and manipulation of molecular markers
Total DNA of each adult male was extracted following the phenol-chloroform protocol described by Sassi et al. [37] or using the NucleoSpin Tissue XS kit (Marchery-Nagel). Orthologous sequences of the mitochondrial COI gene were amplified using different combinations of the primers TYJ1460 and C1N2329M (5’ACTGTAAATATATGATGAGCTCATACA3’), modified from Simon et al. [38], HCO1490 and LCO2198 [39], or COIMYCOF (5’AYTTTATTTTYGGRGCHTGR3’) and COIMYCOR (5’WCCTAATGADCCAAADGTTTCY3’), whereas the mitochondrial COII gene was amplified using primers TL2J3037 and TKN3785 [38], or COII3494M (5’GGNARVAYDRYDCGRTTRTCDAC3’) and COII3400M (5’ATYGGNCAYCARTGRTAYTGA3’), modified from Simon et al. [38]. The nuclear HB gene was amplified with primers HB106F and HB903R [40] or HBFMYCOS (5’CATATACGCAAGCACAAGAACC3’) and HBRMYCOS (5’GCTCRGCACTGGCMGCAC3’), whereas the AMD gene was amplified with primers AMDEX4F [41] and AMDBW [42]. The obtained amplicons were purified using a solution of 13% polyethylene glycol (PEG) and 1.6M NaCl. Sanger sequencing was performed by Macrogen (http://www.macrogen.com/eng/).
The resulting electropherograms were assembled using the Staden Package Gap 4 package [43], where each contig was individually checked regarding sequence quality, editing polymorphic sites according to the IUPAC degeneracy code. Orthologous sequences were aligned with the Clustal W algorithm, as implemented in Mega X [44]. Phase 2.1 [45, 46] was used to determine the gametic phase of the nuclear sequences, as implemented in DNAsp 6 [47]. Mitochondrial datasets were checked for the presence of stop codons and frameshifts to avoid the presence of numts. The ratio between the number of nonsynonymous substitutions per nonsynonymous site (dN) and the number of synonymous substitutions per synonymous site (dS) was assessed in Mega X using the Kimura 2-Parameters nucleotide substitution model (K2P) [48]. The same method was also used to perform a codon-based Z test of purifying selection (for details, see [28, 49]).
Morphological and molecular approaches to species delimitation
As Machado et al. [28] employed a DNA barcoding approach suggesting that M. projectans was a potential species complex, both morphological and molecular approaches were used here to delimit species. First, adult males were photographed with a stereoscopic microscope to determine abdominal color patterns, and each right wing was removed for further morphometric analysis (see below). Second, using confocal microscopy, we assessed differences in male aedeagus morphology based on Wheeler and Takada [25]. Male terminalia were treated with 10% potassium hydroxide (KOH) and 70% ethanol, following Klaus et al. [50], and dissected in glycerol. Visualization was performed on a Leica TCS SP8 scanning spectral confocal microscope. Images were acquired using a 20x objective lens, with a 488 nm laser adjusted to full power (11.6 mW) and emission signals detected under 500 to 584 nm.
All individuals were identified by the DNA barcoding in BOLD (Barcode of Life Data) System [51] using COI sequences. Phylogenetic analyses were then performed for each individual gene based on Bayesian inference (BI) to assess phylogenetic structure, as well as reciprocal monophyly of each species. In each case, the best codon partitioning schemes and their respective best substitution models were determined by the Akaike Information Criterion (AIC) [52], as performed in Partition Finder 2.1.1 [53]. BI was performed in MrBayes 3.2 [54], with at least 50,000,000 generations, sampling every 10,000, and burning 25% of the initial trees. Each analysis ended after the average standard deviation between two independent runs was below 0.01, which assures convergence of the results. These analyses were performed using Mycodrosophila elegans, MycoNova_SFP_403B1, a sequence characterized by Machado et al. [28] for an undescribed Neotropical species of Mycodrosophila, and D. melanogaster as outgroups. Sequences for these taxa were downloaded from GenBank (see S2 Table).
Two species delimitation tests based on coalescence approaches that do not require a priori species allocation were also employed: the Generalized Mixed Yule Coalescent method (GMYC) [55, 56], which was designed to find genetic clusters evolving independently using single locus datasets, and a multi-locus species delimitation method implemented in the Stacey package [57]. In both cases, substitution models were selected according to the AIC, as performed in jModelTest 2.1.10 [58, 59], employing datasets comprising sequences of the M. projectans complex, M. elegans and MycoNova_SFP_403B1 (S2 Table). In the first case, ultrametric trees were reconstructed in Beast 2.6 [60], with MCMC encompassing at least 50,000,000 iterations with sampling every 1,000–5,000 chains and burning the first 10%. Further evaluations of the trees were performed using a single threshold analysis in the Splits package (https://github.com/tfujisawa/splits_tmp) in R 1.3.1093 [61], which detects transitions between inter- and intra-specific processes.
Stacey analysis was performed in Beast 2.4.8 [62] under unlinked substitution models, unlinked relaxed molecular clock models, and unlinked Stacey coalescent parameters, with ploidy levels established according to the respective marker. The MCMC encompassed 200,000,000 generations, saving every 10,000, and burning the first 10%. Convergence was evaluated in Tracer 1.60 [63], checking likelihood and posterior probability traces and confirming that all ESS values were above 200. Clustering schemes and species assignments were later evaluated using Species Delimitator Analyzer [64], with a collapse height value of 0.0001.
Additionally, the Automatic Barcode Gap Discovery (ABGD) algorithm was applied for each COI, COII, COI+COII, HB, and AMD dataset, under the Kimura 2-Parameters substitution model, as performed on the website https://bioinfo.mnhn.fr/abi/public/abgd/abgdweb.html. The ABGD groups individuals based on the pairwise distance observed between sequences, without an a priori hypothesis [65]. Finally, the assignments obtained by the strategies described above were employed to measure intra- and interspecific nucleotide distances and to obtain diagnostic characters for each species of the individual datasets (COI, COII, COI+COII, HB and AMD datasets). Pairwise distances were calculated on MEGA X using the Kimura 2-parameter nucleotide substitution model. Diagnostic nucleotides were recovered for each putative species using the Spider package [66] in R.
Morphometric analysis
The right wings of males of the M. projectans complex were photographed with a SteREO DiscoveryV20 microscope with the program AxioVs40 V 4.8.1.0 (Carl Zeiss Imaging Solutions GmbH), using an increase of 37.5X. TPSdig2 [67] was used to mark ten landmarks chosen based on wing venation, representing bifurcations, intersections, and tip veins (S1 Fig, S3 Table). Partial and relative warps, centroid size, and a weight matrix were then calculated with TPSRelwn [68], where a graphic representation from shape variation was obtained. Analysis of variance (ANOVA) was performed to compare the centroid size of the wings within and among species, and a canonical variate analysis (CVA) was performed to compare their relative warps. ANOVA and CVA were performed in PAST 3 [69].
Diversity and population structure analyses
Diversity estimates (number of haplotypes (H) or alleles (A), haplotype diversity (Hd) or expected Heterozygosity (He), nucleotide diversity (π), and number of polymorphic sites (s)) and neutrality tests (Tajima’s D [70], Fu’s and Li’s D and Fu’s and Li’s F [71]) were performed in DNAsp 5.10.01 [72]. Genealogical relationships between haplotypes or alleles (COI, COI+COII, AMD, and HB) were estimated by median-joining, as implemented in Network 10.1.0 [73].
Pairwise fixation indexes (Fst) among species and populations were estimated for each dataset in Arlequin 3.5 [74], with 1,000 permutations. Analysis of Molecular Variance (AMOVA) was also performed with the same software subdividing sequences by species (as identified by DNA Barcoding) and populations (according to sampling localities) to assess the covariance among groups or species (Φct), among populations within groups or species (Φsc) and within populations (Φst). A Mantel test was performed in Arlequin 3.5 to assess the correlation between geographical distances and genetic divergences. Finally, a Bayesian analysis of population structure (BAPS) was performed for mitochondrial markers using BAPS 6.0 [75] to investigate population subdivision without a priori assignments. The latter two analyses were performed only for COI, COII, and COI+COII datasets.
Dating
A chronophylogenetic analysis was performed in Beast 2.6.3 [62] under a multi-species coalescent and a relaxed molecular clock, using the StarBeast package to construct a putative species tree based on the gene trees estimated for COI, COII, HB, and AMD. For this task, in addition to the new sequences characterized here for the M. projectans complex, additional sequences were downloaded from GenBank for D. melanogaster (Sophophora subgenus), D. virilis (Siphlodora subgenus), D. ornatifrons (Drosophila subgenus), D. grimshawii, and Scaptomyza (Hawaiian drosophilids) from the Drosophilinae subfamily, and P. variegata from the Steganinae subfamily (see S2 Table). These species represent a set of different lineages within the Drosophilidae [76] and were employed as successive outgroups, as well as to establish calibration points within our phylogeny (see below). Unlinked molecular substitution models were employed for each gene according to the results provided by the AIC performed in jModelTest. Unlinked substitution rates were estimated for each gene based on calibrations to the split between Scaptomyza and D. grimshawii using a prior with a mean of 17.5 Mya and stdev of 1.25 Mya, according to the fossil data [77, 78] and to the divergence between Sophophora and the remaining Drosophila with a prior with a mean of 55 Mya and stdev of 8 Mya, according to the average calculated between the molecular clock dating estimated by Tamura et al. [79] (~62.9 Mya) and Suvorov et al. [80] (~47 Mya)]. Unlinked gene trees were also evaluated under a Yule model, with ploidy levels established according to the inheritance pattern of each marker. The analysis was performed for 800,000,000 iterations, storing every 10,000 and discarding the first 10% as burn-in. The run was then visualized in Tracer 1.6 to ensure convergence and adequate sampling. Results were summarized in TreeAnnotator 1.8.0 [81] and visualized in FigTree 1.4.3 [82].
Extended Bayesian skyline (EBPS) [62] analyses were also performed for each species in Beast 2.6.3, employing COI and COII datasets. This analysis was performed using unlinked substitution models, as selected by the AIC performed in jModelTest. Priors for the unlinked relaxed molecular clock models were established based on the mean of the ucld.means obtained for each gene by the chronophylogenetic analysis described above. Unlinked extended Bayesian models were finally applied for each marker, with population models assigned according to differences in effective population sizes. Each analysis encompassed at least 500,000,000 iterations, sampling every 10,000, and burning the first 10%. These results were evaluated in Tracer 1.6, and skyline plots were constructed in R.
Species distribution modelling
Potential distribution maps were constructed for each species of the M. projectans complex based on environmental niche modelling (ENM) [83]. Bioclimatic variables were first downloaded from the Paleoclim database [84] at a resolution of 2.5 mins, and then cut with a shapefile encompassing the Neotropics. Pearson correlations between the cut layers were estimated in R using the packages Raster [85] and corrplot [86], and the seven least correlated abiotic variables were employed in the modelling strategy: temperature seasonality (Bio-4), mean temperature of the warmest quarter (Bio-10), mean temperature of the coldest quarter (Bio-11), precipitation of the wettest quarter (Bio-16), precipitation of the driest quarter (Bio-17), precipitation of the warmest quarter (Bio-18), and precipitation of the coldest quarter (Bio-19). As cryptic diversity in the M. projectans species complex was previously neglected, only the sampling points recorded in this study (S1 Table) were used. To decrease the effect of sampling bias, background points were selected along a radius of 500 km from each sampling point.
Models were generated in R 1.3.1093 using the maximum entropy algorithm function contained in the “dismo” package [87], with calibration to the present and projection to four moments of the past: Late Pliocene (3.3 Mya), Marine Isotope Stage 19 (MIS19) in Pleistocene (MIS, c. 787 Kya), Last Interglacial (LIG, c. 130 kya), and Last Glacial Maximum (LGM, c. 21 kya). In each case, 75% and 25% of the registers were employed as training and test, respectively, in 25 cross-validation replicates. The accuracy of the predictive distribution models was assessed through the Area Under the Receiving Operating Curve (AUC) mean value.
Measurements of abiotic niche overlap between species and identity tests were performed in R using the ENMTools package [88]. For this task, pairwise niche overlap was evaluated according to Schoener’s D and Hellinger’s I, for which 0 means no overlap and 1 indicates that niches are identical. To identify if observed measures were significantly different from the expectations drawn from the null hypothesis of niche equivalency, the null distribution was derived from 25 replicates, in each of which registers were pooled and randomized and the potential distribution maps were derived under the maximum entropy algorithm.
Results
A total of 172 individuals first recognized as M. projectans were collected, and the following numbers of sequences were characterized: 172 for COI (~727 bp), 70 for COII (~560 bp), 20 for AMD (~921 bp), and 25 for HB (~398 bp) (Table 1; for accession numbers, see S2 Table). Sampling disparity occurred due to frequent amplification failures, which commonly led to the premature termination of some DNA samples. No sequences contained stop codons or frameshifts, and all mitochondrial sequences that did not reject the null hypothesis of neutrality in the codon-based Z test of purifying selection, presenting a dn/ds ratio near one, showed low K2P distances (d < 1.3%), suggesting stochastic deviation in intraspecific variation (S4 Table).
How many M. projectans species are there?
Molecular differentiation.
Of the 172 COI sequences characterized for the M. projectans complex, 33 were identified in BOLD as M. projectans affinis 1, 61 as M. projectans affinis 2, and 78 as M. projectans, hereafter referred to as M. projectans affinis 3. All individuals were recovered as a highly supported monophyletic lineage in BI performed with COI (PP = 0.93), COII (PP = 1.00), and AMD (PP = 1.00), whereas for HB, individuals of M. projectans affinis 1 were recovered as a basal grade (PP ≤ 0.68) (S2 Fig). Except for this grade recovered for M. projectans affinis 1 with HB, the three species were reciprocally monophyletic (PP ≥ 0.99). The analyses performed with GMYC also resulted in three clusters for COI, although COII and HB further subdivided M. projectans affinis 3 into three and two clusters, respectively, and AMD joined M. projectans affinis 1 and M. projectans affinis 3 in one cluster (S5 Table). Nevertheless, the delimitation with higher PP recovered in the multi-locus coalescent Bayesian-based analysis executed in Stacey supported the subdivision of the M. projectans complex in three clusters (PP = 0.015) (S5 Table), in accordance with the separation seen in the phylogenetic analyses. Finally, the ABGD analysis also resulted in three clusters for COI, COII, COI+COII, and HB datasets, although AMD defined only two groups of sequences, one of which grouped sequences of M. projectans affinis 1 and M. projectans affinis 3 (S5 Table).
Considering the delimitation in three species, M. projectans affinis 1, M. projectans affinis 2 and M. projectans affinis 3 showed maximum COI intraspecific distances of 4.8, 3.1 and 6.1%, respectively (Table 1). The minimum interspecific distance for this marker was 12.1%, as recovered in a comparison involving individuals of M. projectans affinis 1 and M. projectans affinis 3. The analysis of diagnostic characters performed for COI resulted in 18 diagnostic sites for M. projectans affinis 1, 17 for M. projectans affinis 2 and 11 for M. projectans affinis 3 (S6 Table). Generally, this pattern was repeated for COII, which showed a barcoding gap of 7.3% for the complex (maximum intraspecific distances of 2.7% and minimum interspecific distances of 10%) (Table 1) and recovered at least 21 diagnostic sites when the subdivision in three species was considered (S6 Table).
Morphological differentiation.
Individuals of the M. projectans complex were extremely similar in external morphology, but three different abdominal color patterns could be identified. Two patterns were shared between M. projectans affinis 1 (n = 12) and M. projectans affinis 3 (n = 30), where the yellow spots of tergite IV were totally or partially separated by a posterior projection of the black area, hereafter called abdominal pattern A (Fig 2A and 2B; S7 Table). The other pattern, hereafter called abdominal pattern B, was exclusive to M. projectans affinis 2 (n = 24) and showed a black background and two yellow spots fully confluent in the dorsal region of tergite IV (Fig 2C; S7 Table). There were two exceptions to this pattern found in this species. A thorough examination of the description of M. projectans provided by Sturtevant [88], the redescription of Wheeler and Takada [25], and the holotype photos provided by the National Museum of Natural History (Washington D.C., USA) confirmed the close resemblance of M. projectans affinis 2 with the described species.
(A) Pattern A1, presenting two individual light spots in tergite IV; (B) Pattern A2, presenting two confluent light spots, that are narrowed in the median region, (C) Pattern B, presenting confluent light spots, without the narrowing in the median region. Patterns A1 and A2 are seen in M. projectans affinis 1 and M. projectans affinis 3, whereas pattern B is exclusive of M. projectans affinis 2. Image (A) of sample 577A109, (B) of sample 581A26 and (C) of sample 577A88 (see S7 Table for more details).
Wing morphometry was used as a potential morphological marker in species identification for 57 individuals, of which 13 belonged to M. projectans affinis 1, 19 to M. projectans affinis 2 and 23 to M. projectans affinis 3. The ANOVA and CVA tests did not show any statistically significant differences among species regarding the centroid size of wings and the scores of the relative warps, respectively (S3 Fig; S8 Table). In fact, a wide overlap of wing shape was detected among species (S3 Fig), so wing morphology did not provide enough resolution to distinguish species within the M. projectans complex.
At the male genitalia level, 2, 9, and 6 individuals of M. projectans affinis 1, M. projectans affinis 2 and M. projectans affinis 3, respectively, were examined by optical microscopy, and 7, 14, and 5, respectively, were examined by confocal microscopy. These evaluations revealed the presence of two male genitalia patterns within the M. projectans complex (Fig 3; S7 Table): one type of aedeagus structure was shared between M. projectans affinis 2 and M. projectans affinis 3 and resembled the illustrations provided by Wheeler and Takada ([25], pg. 396, Figs 15–18) for M. projectans (hereafter called type I) (Fig 3A); the second type was exclusive to M. projectans affinis 1, with a longer aedeagus showing a rounded and wider apical region in the lateral view in comparison to the previous morphology (hereafter called type II) (Fig 3B).
(A) Type I, encountered in M. projectans affinis 2 and M. projectans affinis 3; (B) Type II, detected for M. projectans affinis 1. From top to bottom: lateral, dorsolateral, and ventral views. Images (A) of sample 584A35 and (B) of sample 584A39 (see S7 Table for more details).
How and when did this diversification occur?
Phylogenetic relationships and divergence dating.
The resulting phylogenetic gene trees supported the monophyly of the M. projectans complex (PP = 1), although the topology of the relationships within the complex varied among the genes. In fact, even both mitochondrial markers recovered different topologies, with COI presenting M. projectans affinis 1 and M. projectans affinis 3 as sister species (PP = 0.33), whereas COII clustered M. projectans affinis 1 with M. projectans affinis 2 (PP = 1). Conversely, both nuclear markers supported the clustering of M. projectans affinis 2 and M. projectans affinis 3 [PP = 0.94 (HB) and PP = 0.75 (AMD)] (Fig 4A–4D). This incongruence is reflected in the low support reported for the early offshoot of M. projectans affinis 3 in the species tree (PP = 0.50) (Fig 4E). According to this chronophylogenetic tree, the first divergence within the complex occurred ca. 17 Mya, and the next split occurred ca. 15 Mya.
(A) COI gene tree, (B) COII gene tree, (C) HB gene tree, (D) AMD gene tree, and (E) multi-locus species tree. Numbers above internal nodes in the gene trees and below the internal nodes in the species tree represent support values, as represented by the posterior probability (PP) of each clade. Numbers above internal nodes in the species tree represent mean divergence dates. Bars within internal nodes represent the confidence intervals (CI).
Patterns of distribution of genetic diversity and abiotic niches help to disentangle evolutionary history and suggest modes of speciation
Genetic diversity, population structure, and demographic history.
In general, the analysis of haplotype diversity (Hd) or expected heterozygosity (He) for mitochondrial and nuclear markers, respectively, nucleotide diversity (π) and number of polymorphic sites (S) revealed higher values for all four genes for M. projectans affinis 2 and M. projectans affinis 3 than for M. projectans affinis 1 (Table 1). Neutrality tests showed some significantly negative values for COI, COII, COI+COII, and HB in all three species (Table 1).
Pairwise Fst indexes revealed significant values in the comparisons between species for all datasets, although the values recovered for AMD were lower than those reported for COI, COII, COI+COII, and HB (S9A–S9D Table). AMOVA tests executed with the same sequences showed that at least 51% of the total genetic variation was explained by differences among species (S10 Table). Conversely, the variation encountered among populations within the same species was very similar or even lower than that encountered within populations, especially for the nuclear markers (S10 Table).
The networks recovered for the three species using COI sequences generally showed star-like patterns, with central and more frequent haplotypes connected with peripheral and exclusive ones through a few mutational steps (Fig 1). However, there were some exceptions, such as haplotype 6 (Foz do Iguaçu/PR) in M. projectans affinis 1, haplotypes 4 (Teodoro Sampaio/SP) and 26 (Foz do Iguaçu/PR) in M. projectans affinis 2, and haplotypes 20 (Derrubadas/RS) and 29 (Pelotas/RS) in M. projectans affinis 3, which were separated by up to 7–17 mutational steps from their most similar haplotypes.
Although differentiation among species attained a minimum of 34 mutational steps for COI, intraspecific gene flow seems to have been maintained despite long distances. Thus, in M. projectans affinis 2, for example, haplotypes that were collected about 3,000 km apart, such as haplotypes 37 and 7, were differentiated by only two mutational steps (Fig 1C). Likewise, in the same species, haplotypes differing by as many as 10 mutational steps were found at the same point. Nonetheless, for M. projectans affinis 3, two haplogroups could be observed (Fig 1D): the first, with the most common haplotypes sampled in the west (H2 and H24) and radiating to the east, was almost restricted to the Atlantic Forest (only one individual found in the border between Atlantic Forest and Pampa (at Santa Maria) shared a haplotype from this haplogroup); and the other was almost restricted to the Pampa biome, with several haplotypes being sampled along the border between the Atlantic Forest and Pampa and radiating to the south. Conversely, the COI networks of M. projectans affinis 1 and 2 (Fig 1B and 1C) contained the most common haplotype originating from west of the Atlantic Forest, from which it radiated haplotypes to the east in M. projectans affinis 1 and to the east in the Atlantic Forest, to the south in the Pampa, and to the north in the Amazon in M. projectans affinis 2. These patterns were somewhat diluted in the COI+COII concatenated, AMD, and HB networks, due to reduced sampling, although differentiation among species remained very pronounced (S4 and S5 Figs).
According to BAPS, COI did not recover any population subdivision in any of the three species, whereas COII subdivided M. projectans affinis 1 and M. projectans affinis 3 in two subpopulations and M. projectans affinis 2 in three subpopulations, with two groups composed of individuals from the Atlantic Forest and another group exclusively composed of specimens from the Pampa biome (S6 Fig). Furthermore, the results provided by the Mantel Tests (S11 Table) revealed significant correlations between genetic and geographic distances only for M. projectans affinis 1 (rCOI = 0.770, p = 0.035) and M. projectans affinis 3 (rCOI = 0.398, p = 0.002; rCOII = 0.437, p = 0.026; rCOI+COII = 0.424, p = 0.029).
The results of the Extended Bayesian Skyline (EBSP) analysis agreed with the neutrality tests and the star-like patterns seen for the COI networks. In fact, EBSP suggests that M. projectans affinis 2 and M. projectans affinis 3 experienced an expansion of population size, but in different magnitudes and moments, initiated around 200 and 400 Kya, respectively (S7 Fig). According to the 95% HPD sum(indicators.alltrees) parameter, the number of effective population size changes in M. projectans affinis 3 and M. projectans affinis 2 ranged between 1 and 3 (median 1) and 1 and 3 (median 2), respectively. Nevertheless, for M. projectans affinis 1, as 0 was within the 95% HPD range of the sum(indicators.alltrees) parameter, EBSP did not provide significant evidence of changes in effective population size.
Environmental distribution patterns and ecological requirements.
Currently, the three species of the M. projectans complex are sympatric in an area encompassing the southern region of Brazil (Fig 1, S1 Table), but some species of the complex have been collected in tropical and subtropical areas from the Neotropical Region. In the sampled areas, species of the complex were found to be associated with fungal species of Ganoderma, Polyporus, and Trametes (S12 Table), and at least twice, all three species were found in syntopy. In these cases, the triad was simultaneously collected using Ganoderma and another unidentified fungi, at Derrubadas and Foz do Iguaçu, respectively, two conserved areas of the Atlantic Forest. Mycodrosophila projectans affinis 2 and M. projectans affinis 3 also co-occurred in species of Ganoderma and Polyporus at Bossoroca and Derrubadas, respectively (S12 Table).
ENM for all three species showed AUC values higher than 0.809 (S13 Table). These models suggested the range of suitable areas differs among the three species, with present and past overlapping ranges in Southern Brazil (Fig 5). Nevertheless, suitability of the sampling area seems to have decreased progressively during the Pleistocene, reaching the lowest levels during the LGM for all three species.
Environmental distribution models predicted by maximum entropy for each of the three species of the M. projectans complex for the (A) Pliocene, (B) Pleistocene (787 kya), (C) Last Interglacial, (D) Last Glacial Maximum, (E) Present. Neotropical shapefile was obtained from Löwenberg-Neto [108], as available at http://purl.org/biochartis/neo2014shp.
Although the climatic variable that contributed most to the models in M. projectans affinis 2 and M. projectans affinis 3 was the precipitation of the driest quarter (Bio-17), for M. projectans affinis 1, the precipitation of the coldest quarter (Bio-19) was the most important variable (S14 Table). Measures of abiotic niche overlap based on ENM results were higher in the comparisons involving M. projectans affinis 1 and M. projectans affinis 2 (D = 0.904, I = 0.994), than when any of these were compared to M. projectans affinis 3 (D = 0.549, I = 0.839; D = 0.528, I = 0.858, respectively) (S15 Table). However, the null hypothesis of niche equivalency could not be rejected in any of the pairwise comparisons.
Discussion
This study revealed an additional example of cryptic diversity for Mycodrosophila, which was already hypothesized as having several cryptic species [28, 89]. Although the application of DNA barcoding was fundamental to disentangling the M. projectans species complex, caution is necessary when interpreting results obtained solely with COI, since mitochondrial markers may suffer from the interference of numts or even hitchhiking due to maternally inherited endoparasites [31]. The influence of both factors on the proposed inclusion of three species in the M. projectans complex [28] can be discounted by the evidence presented in the current study.
Concerns related to the co-amplification of numts were diminished by the absence of stop codons, frameshifts, or high levels of divergence for COI sequences, patterns associated with neutral evolution that are commonly observed in paralogous copies of mitochondrial genes [41]. In addition, because numts generally cover a small portion of the mitochondrial genome [30], the congruence between the results obtained for COI and COII can be considered additional evidence against the presence of such artefacts here. In fact, for both COI and COII, we showed that reciprocal monophyly was consistent with the presence of a gap between the maximum intraspecific distances and the minimum interspecific divergences. In addition, each of the tree species presented at least 11 diagnostic characters that seemed to be fixed for each mitochondrial marker. Finally, for both markers, AMOVA indicated that more than 80% of the variation occurred among the three haplogroups, whose pairwise Fst values were close to 1.0.
In addition to the congruent results recovered by COI and COII, the nuclear markers AMD and HB also supported reciprocal monophyly of three or at least two of the lineages, respectively. The use of both the ABGD algorithm and coalescence-based Bayesian analysis, using single or multi-locus strategies, reinforced the subdivision of the M. projectans complex into at least three clusters, with an exact correspondence to the three lineages previously defined using DNA barcoding. These results allowed us to reject the hypothesis that the clades observed by Machado et al. [28] would be a result of selective scanning associated with three different and recent invasions of Wolbachia in M. projectans [31]. Nevertheless, it is still possible that such patterns are the result of ancient invasions independently fixed in different populations, which were first associated with cytoplasmic incompatibility and post-zygotic isolation, and later enhanced the emergence or pre-zygotic isolation through reinforcement [89–91]. In this case, Wolbachia could act as a pro-speciation factor, and such a longstanding infection could result in fixation also for nuclear alleles. In fact, there is evidence of Wolbachia infection in at least one species of the Zygothrica genus group, and this endosymbiont was shown to be more frequent in mycophagous than non-mycophagous Diptera [32]. Although simple diagnostic amplification could be used to confirm the presence of Wolbachia in our samples, shortages related to the amplification success of some of our markers showed that such estimates of infection rates would not be precise. Thus, it remains to be further evaluated whether Wolbachia was involved in the diversification of the M. projectans complex. Even so, this uncertainty does not affect the conclusion about the presence of at least three species under the general morphotype previously ascribed to M. projectans.
The cryptic morphology among the three species was confirmed after rigorous analysis, and only a few subtle morphological differences were found for the three species in terms of aedeagus morphology and abdominal color patterns. However, none of these allowed the three species of the complex to be unambiguously distinguished. In addition to this cryptic morphology, the M. projectans complex also detaches for recurrent sympatry and syntopy among its species, as observed here in three samples from the Atlantic Forest and the Pampa biome. The coexistence of cryptic species seems to be a common pattern in Mycodrosophila since Lacy [92] also reported syntopy for two cryptic species in the Nearctic (M. claytonae A and B). Within the Zygothrica genus group, the co-occurrence of cryptic species has also been reported for Neotropical species of the genera Zygothrica and Hirtodrosophila [28, 93]. Nevertheless, for the M. projectans complex, beyond co-occurrence, patterns of biotic and abiotic niches were also quite similar, and species used the same genera of fungi as breeding sites. Despite differences among species concerning the amplitude of potential distribution, neither pairwise comparison between abiotic niches recovered through ENM strategies rejected the null hypothesis of niche equivalency. These results support the hypothesis of niche conservatism for the M. projectans complex [29], suggesting that it may be a common pattern in the Zygothrica genus group. Nevertheless, further ecological studies are necessary to clarify how these species are using their resources and how competition affects their co-occurrence.
Patterns of morphological similarity and niche equivalency seem to have been maintained despite ancient divergence. In this sense, although there were incongruences among gene trees regarding the topology of the relationships within the M. projectans complex, the multi-locus strategy used to reconstruct the species tree under a relaxed molecular clock strategy allowed us to date the two cladogenesis events to approximately 17–15 Mya ago. These estimates indicated that the diversification of the M. projectans complex occurred in the Neogene period during the Miocene [94]. This contrasts with the pattern commonly found for Drosophilidae, in which cryptic species encompass recently diverged lineages [93, 95, 96] that did not have enough time to accumulate diagnosable features. Thus, this study provides an interesting example of morphological conservation, despite ancient divergence. Furthermore, this ancient divergence, in view of the similarity of niches evidenced here for the three lineages, allows us to hypothesize that divergence of the species occurred in allopatry or parapatry, with current records of sympatry and syntopy reflecting secondary contact. This hypothesis of allo- or parapatric distribution in more ancient times was also supported by EBSP analyses, which showed contrasting patterns of demographic fluctuations for all species. In fact, whereas M. projectans affinis 1 did not present significant signals of population expansion, such signals were supported for M. projectans affinis 2 and M. projectans affinis 3 as occurring at different moments of the Middle Pleistocene [94], ca. 200 and 400 Kya, respectively. Such differences would certainly not be expected if species were sympatric, especially in the face of straightforward evidence of niche equivalence.
Furthermore, these three species seem to have expanded to Southern Brazil quite recently, as shown by the ENMs projected for different moments of the past. The influence of precipitation on the modelling strategies further supported the interference of the climatic oscillations of the Quaternary in the population dynamics of these species, since this period is characterized by alternating periods of dry and wet conditions in the Southern Hemisphere [97, 98]. These results are also concordant with phylogeographic studies performed with other Brazilian drosophilids, which also showed signals of population expansion dated to the Pleistocene [99–101]. This general pattern suggests that several drosophilid species have been subject to demographic oscillations during the glacial–interglacial cycles of this Epoch [99, 102]. However, although for cactophilic species, expansions are frequently dated to glacial periods [99], the effect of glaciations was the opposite for other species, as recently supported for D. maculifrons and D. ornatifrons [100, 101]. The pattern found here for the M. projectans complex adds three more species to the list of Drosophilidae species suggesting recent population expansion in southern Brazil. Although further sampling is necessary to clarify this scenario, especially in other distribution areas, such results certainly help to disentangle some complexities related to the evolution of the M. projectans complex.
Even with this recent diversification, some species of the M. projectans complex showed significant levels of population structure between the two southernmost Brazilian biomes: the Pampa and Atlantic Forest. The levels of nucleotide and haplotype or allele diversity seen here for the M. projectans complex were also considerably higher than those previously found for several other Drosophilidae species [99, 100, 102–106]. In fact, nucleotide diversity for M. projectans affinis 3 reached more than 10,000 times the value found for D. maculifrons, a species that also showed signals of population expansion dated to the LGM [100]. This high diversity could be an intrinsic characteristic of the M. projectans complex and possibly of other Mycodrosophila species, suggesting the occurrence of high levels of gene flow in response to the restrictions imposed by the ephemerality of resources [24, 92]. In this sense, several cases in which haplotypes from different locations were much more similar in the number of mutational steps than some haplotypes found in the same locality were observed in the haplotype networks of M. projectans affinis 2. This suggests metapopulation dynamics, as proposed for other Neotropical species of Drosophila in response to cyclic fluctuations in the availability of resources [107]. Even so, for M. projectans affinis 1 and M. projectans affinis 3, the Mantel tests recovered a significant correlation between geographical distances and genetic divergences, suggesting the application of an isolation-by-distance pattern of population differentiation.
Conclusion
In conclusion, this study supports the existence of at least three cryptic species within the M. projectans complex, as initially proposed by Machado et al. [28]. As congruent results were obtained for different markers and techniques, it was possible to exclude numts and recent hitchhiking with endosymbiont parasites. Despite diversification of these lineages dated to around 17–15 Mya (Miocene), only subtle morphological differences were encountered among species, and abiotic niches were equivalent among them. Although the three species seem to have expanded to the sampled region after the LGM, they showed high levels of genetic diversity, and in some cases, some level of population structure between Biomes. Despite inherent difficulties in sampling these species, this study represents a step forward in the understanding of potential spatiotemporal and ecological patterns related to their diversification.
Supporting information
S1 Fig. Illustration of the right wing of a specimen of the M. projectans complex showing the landmarks chosen for morphometry analysis.
https://doi.org/10.1371/journal.pone.0268657.s001
(PDF)
S2 Fig.
Majority rule consensus tree recovered through Bayesian analysis based on (A) COI, (B) COII, (C) HB, and (D) AMD datasets. Branch lengths are proportional to the scale, given in substitutions per site. Values near the internal branches represent the posterior probability (PP) of each clade.
https://doi.org/10.1371/journal.pone.0268657.s002
(PDF)
S3 Fig. Cartesian plot from wings relative warps reported for each of the three species of the M. projectans complex.
https://doi.org/10.1371/journal.pone.0268657.s003
(PDF)
S4 Fig. Median-joining network reconstructed with COI+COII haplotypes characterized for each of the three species of the M. projectans complex.
(A) M. projectans affinis 1, (B) M. projectans affinis 2, and (C) M. projectans affinis 3. Each circle represents a different haplotype, whose size is proportional to frequency. Each color represents different sampling points, in accordance with the legend presented on Fig 1. Black small circles represent median vectors. Dashes in the lines connecting different haplotypes represent the number of mutations between them.
https://doi.org/10.1371/journal.pone.0268657.s004
(PDF)
S5 Fig.
Median-joining network reconstructed with (A) HB, and (B) AMD phased alleles characterized for each of the three species of the M. projectans complex. Each circle represents a different haplotype, whose size is proportional to frequency. Each color represents different sampling points, in accordance with the legend presented on Fig 1. Black small circles represent median vectors. Dashes in the lines connecting different haplotypes represent the number of mutations between them.
https://doi.org/10.1371/journal.pone.0268657.s005
(PDF)
S6 Fig.
Results from the spatial clustering analysis performed by BAPS for each of the three species of the M. projectans complex based on (A) COI, and (B) COII datasets. Axis x and y reflect the longitude and latitude of each population, whereas each color represents a different cluster of populations.
https://doi.org/10.1371/journal.pone.0268657.s006
(PDF)
S7 Fig.
Extended Bayesian Skyline Plots depicting oscillations of population sizes faced by M. projectans affinis 2 (A) and M. projectans affinis 3 (B) during the last 1 Mya.
https://doi.org/10.1371/journal.pone.0268657.s007
(PDF)
S1 Table. List of sampling sites of the M. projectans complex, with their respective geographic coordinates.
https://doi.org/10.1371/journal.pone.0268657.s008
(XLSX)
S2 Table. List of specimens used in this study, with their respective origin and GenBank accession numbers.
https://doi.org/10.1371/journal.pone.0268657.s009
(XLSX)
S3 Table. Description of wing landmarks used in morphometric analysis.
https://doi.org/10.1371/journal.pone.0268657.s010
(XLSX)
S4 Table. Results of pairwise comparisons involving Dn and Ds, and the codon-based Z test of purifying selection performed to assist in the detection of numts for the two mitochondrial datasets.
https://doi.org/10.1371/journal.pone.0268657.s011
(XLSX)
S5 Table. Number of clusters recovered for the M. projectans complex by ABGD, GMYC, and Stacey, under different datasets.
https://doi.org/10.1371/journal.pone.0268657.s012
(XLSX)
S6 Table. List of diagnostic characters recovered for each of the three species of the M. projectans complex under the COI, and COII datasets.
Sites that did not reveal diagnostic nucleotides were omitted.
https://doi.org/10.1371/journal.pone.0268657.s013
(XLSX)
S7 Table. Patterns of morphology found in different specimens of the M. projectans complex based on the evaluation of abdominal spots and aedeagus type.
https://doi.org/10.1371/journal.pone.0268657.s014
(XLSX)
S8 Table. Results of ANOVA and CVA of wing variation among the three species of the M. projectans complex.
https://doi.org/10.1371/journal.pone.0268657.s015
(XLSX)
S9 Table. Pairwise values of Fst among the three species of the M. projectans complex, as calculated for different datasets.
https://doi.org/10.1371/journal.pone.0268657.s016
(XLSX)
S10 Table. Results of the Analyses of Molecular Variance (AMOVA) considering the subdivision of the M. projectans complex in three species, as recovered with the use of different datasets.
https://doi.org/10.1371/journal.pone.0268657.s017
(XLSX)
S11 Table. Results of the Mantel tests performed for each of the three species of the M. projectans complex with the use of different datasets.
https://doi.org/10.1371/journal.pone.0268657.s018
(XLSX)
S12 Table. List of resources in which each of the three species of the M. projectans complex was collected.
Sampling point number refers to codes presented on S1 Table.
https://doi.org/10.1371/journal.pone.0268657.s019
(XLSX)
S13 Table. Number of points and mean AUC values presented by the ENM reconstructed for each of the three species of the M. projectans complex.
https://doi.org/10.1371/journal.pone.0268657.s020
(XLSX)
S14 Table. Estimates of relative contributions of each of the employed environmental variables to the ENMs reconstructed for each of the three species of the M. projectans complex.
https://doi.org/10.1371/journal.pone.0268657.s021
(XLSX)
S15 Table.
Pairwise values of abiotic niche overlap estimated among the three species of the M. projectans complex according to Schoener’s D (D) (above diagonal) and Hellinger’s (I) (below diagonal) indexes.
https://doi.org/10.1371/journal.pone.0268657.s022
(XLSX)
Acknowledgments
We are grateful to the authorities responsible for Brazilian Ecological Stations, Reserves or Parks and to the private properties owners that allowed us to perform Drosophilidae searches in their area. All these collections were authorized by the Brazilian Ministério do Meio Ambiente (MMA), in the form of the Sistema de Autorização e Informação em Biodiversidade (SISBIO), and we thank them for their commitment to ethical guidelines and conservation efforts concerning Brazilian scientific activities. We would also like to thank to Dr. Eduardo Bernardi for the fungi identification and to M.Sc. João Pedro Junges dos Santos for his help in drosophilids identification.
References
- 1. Lewinsohn TM, Prado PI. How many species are there in Brazil? Conservation Biology. 2005; 19:619–624.
- 2. Giam X, Scheffers BR, Sodhi NS, Wilcove DS, Ceballos G, Ehrlich PR. Reservoirs of richness: least disturbed tropical forests are centres of undescribed species diversity. Proceedings of the Royal Society of London Series B. 2012; 279:67–76. pmid:21593037
- 3. Morrone JJ. Biogeographis areas and transition zones of Latin America and The Carribean islands based on panbiogeographic and cladistic analyses of the entomofauna. Annual Review of Entomology. 2006; 51:467–94. pmid:16332220
- 4. Myers N, Mittermeier RA, Mittermeier CG, da Fonseca GAB, Kent J. Biodiversity hotspots for conservation priorities. Nature. 2000; 403:853–858. pmid:10706275
- 5. Bennett KD. Continuing the debate on the role of Quaternary environmental change for macroevolution. Philosophical Transactions of the Royal Society, Series B: Biological Sciences. 2004; 359:295–303. pmid:15101585
- 6. Rull V. Speciation timing and Neotropical biodiversity: the Tertiary–Quaternary debate in the light of molecular phylogenetic evidence. Molecular Ecology. 2008; 17:2722–2729. pmid:18494610
- 7. Rull V. Neotropical biodiversity: timing and potential drivers. Trends in Ecology and Evolution. 2011; 26:508–513. pmid:21703715
- 8.
Freeland JR., Kirk H, Petersen S. Molecular Ecology. Oxford, Wiley-NlackNelll. 2011.
- 9. Clare EL, Lim BK, Fenton MB, Hebert PDN. Neotropical Bats: estimating species diversity with DNA Barcodes. PLoS ONE. 2011; 6:e22648. pmid:21818359
- 10. Crawford A J, Cruz C, Griffth D, Ross H., Ibáñez R, Lips KR, et al. DNA barcoding applied to ex situ tropical amphibian conservation programme reveals cryptic diversity in captive populations. Molecular Ecology Resources. 2012; 13(6):1005–18. pmid:23280343
- 11. Domingos FMCB Colli GR, Lemmon A Lemmon EM, Beheregaray LB. In the shadows: Phylogenomics and coalescent species delimitation unveil cryptic diversity in a Cerrado endemic lizard (Squamata: Tropidurus). Molecular Phylogenetics and Evolution. 2017; 107:455–465. pmid:27940330
- 12. Janzen D, Burns JM, Qian C, Hallwachsa W, Dapkeya T, Manjunathe R, et al. Nuclear genomes distinguish cryptic species suggested by their DNA barcodes and ecology. PNAS. 2017; 114(31):8313–8318. pmid:28716927
- 13. Bickford D, Lohman JD, Sodhi NS, Ng PKL, Meier R, Winker K, et al. Cryptic species as a window on diversity and conservation. Trends in Ecology and Evolution. 2006; 22:148–155. pmid:17129636
- 14. Henry CS. Singing and cryptic speciation in insects. Trends in Ecology and Evolution. 1994; 9:388–392. pmid:21236899
- 15. Struck TH, Feder JL, Bendiksby M, Birkeland S, Cerca J, Gusarov VI, et al. Finding evolutionary processes hidden in cryptic species. Trends in Ecology & Evolution. 2018; 33(3):153–163. pmid:29241941
- 16. Turelli M, Orr HA. Dominance, epistasis and the genetics of postzygotic isolation. Genetics. 2000; 154:1663–1679. pmid:10747061
- 17. Vodă R, Dapporto L, Dincă V, Vila R. Cryptic matters: overlooked species generate most butterfly beta-diversity. Ecography. 2015; 38:405–409.
- 18.
Throckmorton LH. The phylogeny, ecology and geography of Drosophila. In: King R.C. (Ed.), Handbook of Genetics. Plenun, New York. 1975. 421–469.
- 19. Markow TA O’Grady P. Reproductive ecology of Drosophila. Functional Ecology. 2008; 22:747–759.
- 20. Bächli G. Taxodros database: The database on taxonomy of Drosophilidae. 2021. Available from: http://www.taxodros.unizh.ch/
- 21.
Carson HL. The ecology of Drosophila breeding sites. Harold L. Lyon Arboretum Lecture Number Two. The University of Hawaii, Honolulu. 1971. pp.1–27.
- 22.
Powell JR. Progress and prospects in evolutionary biology: the Drosophila model. New York: Oxford University Press. 1997.
- 23. Grimaldi DA. Phylogenetics and taxonomy of Zygothrica (Diptera: Drosophilidae). Bulletin of the American Museum of Natural History. 1987; 186:103–268.
- 24. Courtney SP, Kibota KK, Singleton TA. Ecology of mushroom-feeding Drosophilidae. Advances in Ecological Research. 1990; 20:225–274.
- 25. Wheeler MR, Takada H. A revision of the American species of Mycodrosophila (Diptera, Drosophilidae). Annals of the Entomological Society of America. 1963; 56:392–399.
- 26. McEvey SF, Polak M. Mycodrosophila (Diptera: Drosophilidae) of Fiji and Vanuatu With Description of Nine New Species. Bishop Museum Occasional Papers. 2005; 84, 35–67.
- 27. Junges J, Gottschalk MS, Loreto EL, Robe LJ. Two new species of Mycodrosophila (Diptera, Drosophilidae) proposed by molecular and morphological approaches, with a key to American species. Revista Brasileira de Entomologia. 2016; 60(1):30–39.
- 28. Machado S, Dos Santos JP, Fonseca PM, Bolzan AR, David J, Loreto ELS, et al. Neotropical mycophagous drosophilids (Diptera, Drosophilidae): DNA barcoding as a way of overcoming the taxonomic impediment. Insect Conservation and Diversity. 2017; 10(03):271–281.
- 29. Robe LJ, Machado S, Bolzan AR, dos Santos JPJ, Valer F, dos Santos AP, et al. Comparative ecological niche modeling and evolutionary ecology of Neotropical mycophagous Drosophilidae (Diptera) species. Studies on Neotropical Fauna and Environment. 2014; 49(2):79–94.
- 30. Richly E, Leister D. NUMTs in Sequenced Eukaryotic Genomes. Molecular Biology and Evolution. 2004; 21(6):1081–1084. pmid:15014143
- 31. Hurst GDD, Jiggins FM. Problems with mitochondrial DNA as a marker in population, phylogeographic and phylogenetic studies: the effects of inherited symbionts. Proceedings of the Royal Society B-Biological Sciences. 2005; 272:1525–1534. pmid:16048766
- 32. Stahlhut J, Clark ME, Baldo L, Russel J, Werren JH, Jaenike J. The mushroom habitat as an ecological arena for global exchange of Wolbachia. Molecular Ecology. 2010; 19:1940–1952. pmid:20529071
- 33. Linhares S, Gewandsznajder F. Biologia Hoje—Vol 3. São Paulo: ed. Ática. 1998.
- 34.
Câmara IG. Brief history of conservation in the Atlantic Forest. In: GalindoLeal C., Câmara I.G. (Eds.), The Atlantic Forest of South America: Biodiversity Status, Threats, and Outlook. CABS and Island Press, Washington. 2003. pp. 31–42.
- 35. Roesch LFW, Vieira FCB, Pereira VA, Schünemann AL, Teixeira IF, Senna AJT, et al. The Brazilian pampa: a fragile biome. Diversity. 2009; 1:182–198
- 36. Machado S, dos Santos JPJ, Robe LJ, Loreto ELS. An efficient and cheap entomological aspirator to collect mycophylic and anthophilic adult Drosophilidae flies. Drosophila Information Service. 2014; 97:169–171.
- 37. Sassi KA, Heredia F, Loreto ELS, Valente VLS, Rohde C. Transposable elements P and gypsy in natural populations of Drosophila willistoni. Genetics and Molecular Biology. 2005; 28(4):734–739.
- 38. Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annual Review of Entomology. 1994; 87:651–701.
- 39. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology. 1994; 3(5):294–299. pmid:7881515
- 40. Mota NR, Robe LJ, Valente VLS, Budnik M, Loreto ELS. Phylogeny of the Drosophila mesophragmatica group (Diptera, Drosophilidae): an example of Andean evolution. Zoological Science. 2008; 25:526–532. pmid:18558806
- 41. Robe LJ, Loreto EL, Valente VLS. Radiation of the Drosophila subgenus (Drosophilidae, Diptera) in the Neotropics. Journal of Zoological Systematics and Evolutionary Research. 2010; 48:310–321.
- 42. Tatarenkov A, Kwiatowski J, Sharecky D, Barrío E, Ayala FJ. On the evolution of Dopa decarboxylase (Ddc) and Drosophila systematics. Journal of Molecular Evolution. 1999; 48:445–462. pmid:10079283
- 43. Staden R. The Staden sequence analysis package. Molecular Biotechnology. 1996; 5(3):233–241. pmid:8837029
- 44. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Molecular Biology and Evolution. 2018; 35(6):1547–1549. pmid:29722887
- 45. Stephens M, Smith N, Donnelly P. A new statistical method for haplotype reconstruction from population data. American Journal of Human Genetics. 2001; 68:978–989. pmid:11254454
- 46. Stephens M, Donnelly P. A comparison of Bayesian methods for haplotype reconstruction from population genotype data. American Journal of Human Genetics. 2003; 73:1162–1169. pmid:14574645
- 47. Rozas J, Ferrer-Mata A, Sánchez-DelBarrio JC, Guirao-Rico S, Librado, P, Ramos-Onsins SE, et al. DnaSP 6: DNA Sequence Polymorphism Analysis of Large Datasets. Molecular Biology and Evolution. 2017; 34:3299–3302. pmid:29029172
- 48. Kimura M. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution. 1980; 16:111–120. pmid:7463489
- 49. Robe LJ, Machado S, Bartholomei-Santos ML. The DNA Barcoding and the caveats with respect to its application to some species of Palaemonidae (Crustacea, Decapoda). Zoological Science. 2012; 29:714–724. pmid:23030345
- 50. Klaus AV, Kulasekera VL, Schawaroch V. Three-dimensional visualization of insect morphology using confocal laser scanning microscopy. Journal of Microscopy. 2003; 212:107–121. pmid:14629560
- 51. Ratnasingham S, Hebert PDN. BOLD: The Barcode of Life Data System (http://www.barcodinglife.org). Molecular Ecology Notes. 2007; 7(3):355–364. pmid:18784790
- 52. Akaike H. A new look at the statistical model identification. IEEE Transactions on Automatic Control. 1974; 19:716–723.
- 53. Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B. PartitionFinder 2: New Methods for Selecting Partitioned Models of Evolution for Molecular and Morphological Phylogenetic Analyses. Molecular Biology and Evolution. 2016; 34(3):772–773. pmid:28013191
- 54. Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhn S, et al. MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Systematic Biology. 2012; 61(3):539–542. pmid:22357727
- 55. Pons J, Barraclough T, Gomez-Zurita J, Cardoso A, Duran D, Hazell S, et al. Sequence-Based Species Delimitation for the DNA Taxonomy of Undescribed Insects. Systematic Biology. 2006; 55:595–609. pmid:16967577
- 56. Fujisawa T, Barraclough TG. Delimiting species using single-locus data and the generalized mixed yule coalescent approach: a revised method and evaluation on simulated data sets. Systematic Biology. 2013; 62:707–24. pmid:23681854
- 57. Jones G, Aydin Z, Oxelman B. DISSECT: an assignment-free Bayesian discovery method for species delimitation under the multispecies coalescent. Bioinformatics. 2014; 31(7):991–998. pmid:25422051
- 58. Guindon S, Gascuel O. A simple, fast and accurate method to estimate large phylogenies by maximum-likelihood. Systematic Biology. 2003; 52:696–704. pmid:14530136
- 59. Darriba D, Taboada GL, Doallo R, Posada D. jModelTest 2: more models, new heuristics and parallel computing. Nature Methods. 2012; 9(8):772. pmid:22847109
- 60. Bouckaert R, Vaughan TG, Barido-Sottani J, Duchêne S, Fourment M, Gavryushkina A, et al. BEAST 2.5: An advanced software platform for Bayesian evolutionary analysis. PloS Computational Biology. 2019; 15(4):e1006650. pmid:30958812
- 61.
R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. 2017. Available from https://www.R-project.org/
- 62. Bouckaert R, Heled J, Kühnert D, Vaughan T, Wu C-H, Xie D, et al. BEAST 2: A Software Platform for Bayesian Evolutionary Analysis. PLoS Computational Biology. 2014; 10(4):e1003537. pmid:24722319
- 63. Rambaut A, Suchard MA, Xie D, Drummond AJ. Tracer v1.6. 2014. Available from http://beast.bio.ed.ac.uk/Tracer
- 64. Jones G. Algorithmic improvements to species delimitation and phylogeny estimation under the multispecies coalescent. Journal of Mathematical Biology. 2017; 74:447–467. pmid:27287395
- 65. Puillandre N, Lambert A, Bouillet S, Achaz G. ABGD, Automatic Barcode Gap Discovery for primary species delimitation. Molecular Ecology. 2012; 21(8):1864–1877. pmid:21883587
- 66. Brown SDJ, Collins RA, Boyer S, Lefort M-C, Malumbres-Olarte J, Vink CJ, et al. SPIDER: an R package for the analysis of species identity and evolution, with particular reference to DNA barcoding. Molecular Ecology Resources. 2012; 12:562–565. pmid:22243808
- 67.
Rohlf FJ. tpsDig2, digitize landmarks and outlines, version 2.10. Dept Ecology & Evolution, St. Univ. New York, Stony Brook, New York. 2006.
- 68.
Rohlf FJ. tpsRelw, relative warps analysis, version5/13/05. Dept Ecology & Evolution, St. Univ. New York, Stony Brook, New York. 2007.
- 69. Hammer Ø, Harper DAT, Ryan PD. PAST: Paleontological Statistics Software Package for Education and Data Analysis. Palaeontologia Electronica. 2001; 4(1):9.
- 70. Tajima F. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics. 1989; 123:585–595. pmid:2513255
- 71. Fu YX. Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics. 1997; 147:915–925. pmid:9335623
- 72. Librado P, Rozas J. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics. 2009; 25:1451–1452. pmid:19346325
- 73. Bandelt H-J, Forster P, Rohl A. Median-joining networks for inferring intraspecific phylogenies. Molecular Biology and Evolution. 1999; 16: 37–48. pmid:10331250
- 74. Excoffier L, Licher HEL. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources. 2010; 10:564–567. pmid:21565059
- 75. Corander J, Marttinen P, Mäntyniemi S. Bayesian identification of stock mixtures from molecular marker data. Fishery Bulletin. 2006; 104:550–558.
- 76. Yassin A. Phylogenetic classification of the Drosophilidae rondani (Diptera): the role of morphology in the postgenomic era. Systematic Entomology. 2013; 38:349–364.
- 77.
Grimaldi DA. Relicts in the Drosophilidae (Diptera). In Liebherr J. K.(ed.), Zoogeography of Caribbean insects. Ithaca: Cornall Univ. Press. 1988. pp.183–213.
- 78. Iturralde-Vinent MA, MacPhee RDE. Age and paleogeographical origin of Dominican amber. Science. 1996; 273:1250–1252.
- 79. Tamura K, Subramanian S, Kumar S. Temporal patterns of fruit fly (Drosophila) evolution revealed by mutation clocks. Molecular Biology and Evolution. 2004; 21, 36–44. pmid:12949132
- 80. Suvorov A, Kim BY, Wang J, Armstrong EE, Peede D, D`Agostino ERR, et al. Widespread introgression across a phylogeny of 155 Drosophila genomes. BioRxiv, preprint. 2021. pmid:34788634
- 81. Drummond AJ, Rambaut A. BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology. 2007; 7:214. pmid:17996036
- 82.
Rambaut A. FigTree v1.3.1. Institute of Evolutionary Biology, University of Edinburgh, Edinburgh. 2010. Available from http://tree.bio.ed.ac.uk/software/figtree/
- 83. Elith J, Leathwick JR. Species distribution models: ecological explanation and prediction across space and time. Annual Review of Ecology, Evolution, and Systematics. 2009; 40:677–697.
- 84. Brown JL, Hill DJ, Dolan AM, Carnaval AC, Haywood AM. PaleoClim, high spatial resolution paleoclimate surfaces for global land areas. Scientific Data. 2018; 5: 180254. pmid:30422125
- 85. Hijmans RJ, van Etten J. Raster: Geographic analysis and modeling with raster data. R package version 2.0–12. 2012. Available from http://CRAN.R-project.org/package=raster
- 86. Wei T, Simko V. R package "corrplot": Visualization of a Correlation Matrix (Version 0.84).2017. Available from https://github.com/taiyun/corrplot
- 87. Hijmans RJ, Phillips S, Leathwick J, Elith J. Dismo: Species Distribution Modeling. R Package Version 1.3–3. 2020.
- 88. Warren DL, Matzke N, Cardillo M, Baumgartner J, Beaumont L, Huron N, et al. ENMTools (Software Package). 2019.
- 89. Werren JH. Wolbachia and speciation. Endless forms: species and speciation. 1998; 245–260.
- 90. Bordenstein SR. 17 Symbiosis and the Origin of Species. Insect symbiosis. 2003; 283.
- 91. Telschow A, Hammerstein P, Werren JH. The effect of Wolbachia versus genetic incompatibilities on reinforcement and speciation. Evolution. 2005; 59(8), 1607–1619. pmid:16329235
- 92. Lacy RC. Niche breadth and abundance as determinants of genetic variation in populations of mycophagous drosophilid flies (Diptera: Drosophilidae). Evolution. 1982; 36(6):1265–1275. pmid:28563563
- 93. Fonseca PM, Loreto EL, Gottschalk MS, Robe LJ. Cryptic diversity and speciation in the Zygothrica genus group (Diptera, Drosophilidae): the case of Z. vittimaculosa Wiedemann. Insect Systematics & Evolution. 2017; 48(3):285–313.
- 94. Cohen KM, Finney SC, Gibbard PL, Fan J-X. The ICS International Chronostratigraphic Chart. Episodes. 2013; 36:199–204.
- 95. Robe LJ, Cordeiro J, Loreto ELS, Valente VLS. Taxonomic boundaries, phylogenetic relationships and biogeography of the Drosophila willistoni subgroup (Diptera: Drosophilidae). Genetica. 2010; 138(6):601–617. pmid:20049511
- 96. Castro Vargas C, Richmond MP, Ramirez Loustalot Laclette M, Markow TA Early events in speciation: cryptic species of Drosophila aldrichi. Ecology and Evolution. 2017; 7(12):4220–4228.
- 97. Haffer J. Speciation in Amazonian Forest birds. Science. 1969; 165:131–137 pmid:17834730
- 98. Ab’Saber AN. Os domínios morfoclimáticos na América do Sul. Geomorfologia. 1977; 52:1–22.
- 99. Franco FF, Manfrin MH. Recent demographic history of cactophilic Drosophila species can be related to Quaternary palaeoclimatic changes in South America. Journal of Biogeography. 2013; 40:142–154.
- 100. De Ré FC, Gustani EC, Oliveira APF, Machado LPB, Mateus RP, Loreto ELS, et al. Brazilian populations of Drosophila maculifrons (Diptera: Drosophilidae): low diversity levels and signals of a population expansion after the Last Glacial Maximum. Biological Journal of the Linnean Society. 2014; 112:55–66.
- 101. Gustani E, Oliveira AP, Santos MS, Machado LB, Rogério PM. Demographic Structure and Evolutionary History of Drosophila ornatifrons (Diptera, Drosophilidae) from Atlantic Forest of Southern Brazil. Zoological Science. 2015; 32(2):141–150. pmid:25826062
- 102. Moraes EM, Yotoko KSC, Manfrin MH, Solferini VN, Sene FM. Phylogeography of the cactophilic species Drosophila gouveai: demographic events and divergence timing in dry vegetation enclaves in eastern Brazil. Journal of Biogeography. 2009; 36:2136–2147.
- 103. De Brito RA., Manfrin MH, Sene FM. Mitochondrial DNA phylogeography of Brazilian populations of Drosophila buzzatii. Genetics and Molecular Biology. 2012; 25:161–171.
- 104. Hurtado LA, Erez T, Castrezana S, Markow TA. Contrasting population genetic patterns and evolutionary histories among sympatric Sonoran Desert cactophilic Drosophila. Molecular Ecology. 2014; 13:1365–1375. pmid:15140083
- 105. Reed LK, Nyboer M, Markow TA. Evolutionary relationships of Drosophila mojavensis geographic host races and their sister species Drosophila arizonae. Molecular Ecology. 2007; 16:1007–1022. pmid:17305857
- 106. Mirol PM, Routtu J, Hoikkala A, Butlin RK. Signals of demographic expansion in Drosophila virilis. BMC Evolutionary Biology. 2008; 8:59. pmid:18298823
- 107. De Ré FC, Wallau GL, Robe LJ, Loreto ELS. Characterization of the complete mitochondrial genome of flower-breeding Drosophila incompta (Diptera, Drosophilidae). Genetica. 2014; 142(6):525–535. pmid:25416157
- 108. Löwenberg-Neto P. Neotropical region: a shapefile of Morrone’s (2014) biogeographical regionalisation. Zootaxa. 2014; 3802(2): 300–300. pmid:24871011
- 109. IBGE. Biomas e Sistemas Marinho-Costeiro do Brasil– 1:250 000. 2019. Available at https://www.ibge.gov.br/geociencias/cartas-e-mapas/informacoes-ambientais/15842-biomas.html?=&t=publicacoes