Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Molecular typing and prevalence of antibiotic resistance and virulence genes in Streptococcus agalactiae isolated from Chinese dairy cows with clinical mastitis

  • Guangli Han ,

    Contributed equally to this work with: Guangli Han, Baohai Zhang

    Roles Methodology, Writing – original draft, Writing – review & editing

    Affiliations College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan, China, Key Laboratory of Animal Disease and Human Health of Sichuan Province, Chengdu, Sichuan, China

  • Baohai Zhang ,

    Contributed equally to this work with: Guangli Han, Baohai Zhang

    Roles Investigation, Methodology, Writing – original draft

    Affiliations College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan, China, Key Laboratory of Animal Disease and Human Health of Sichuan Province, Chengdu, Sichuan, China

  • Zidan Luo,

    Roles Investigation

    Affiliations College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan, China, Key Laboratory of Animal Disease and Human Health of Sichuan Province, Chengdu, Sichuan, China

  • Biao Lu,

    Roles Investigation

    Affiliations College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan, China, Key Laboratory of Animal Disease and Human Health of Sichuan Province, Chengdu, Sichuan, China

  • Zhengzhong Luo,

    Roles Resources

    Affiliations College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan, China, Key Laboratory of Animal Disease and Human Health of Sichuan Province, Chengdu, Sichuan, China

  • Jieru Zhang,

    Roles Investigation

    Affiliations College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan, China, Key Laboratory of Animal Disease and Human Health of Sichuan Province, Chengdu, Sichuan, China

  • Yin Wang,

    Roles Supervision

    Affiliations College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan, China, Key Laboratory of Animal Disease and Human Health of Sichuan Province, Chengdu, Sichuan, China

  • Yan Luo,

    Roles Supervision

    Affiliations College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan, China, Key Laboratory of Animal Disease and Human Health of Sichuan Province, Chengdu, Sichuan, China

  • Zexiao Yang,

    Roles Supervision

    Affiliations College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan, China, Key Laboratory of Animal Disease and Human Health of Sichuan Province, Chengdu, Sichuan, China

  • Liuhong Shen,

    Roles Supervision

    Affiliations College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan, China, Key Laboratory of Animal Disease and Human Health of Sichuan Province, Chengdu, Sichuan, China

  • Shumin Yu,

    Roles Supervision

    Affiliations College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan, China, Key Laboratory of Animal Disease and Human Health of Sichuan Province, Chengdu, Sichuan, China

  • Suizhong Cao ,

    Roles Methodology, Supervision

    suizhongcao@sicau.edu.cn (SC); yaoxueping74@126.com (XY)

    Affiliations College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan, China, Key Laboratory of Animal Disease and Human Health of Sichuan Province, Chengdu, Sichuan, China

  • Xueping Yao

    Roles Methodology, Supervision

    suizhongcao@sicau.edu.cn (SC); yaoxueping74@126.com (XY)

    Affiliations College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan, China, Key Laboratory of Animal Disease and Human Health of Sichuan Province, Chengdu, Sichuan, China

Abstract

Bovine mastitis is a common disease occurring in dairy farms and can be caused by more than 150 species of pathogenic bacteria. One of the most common causative organisms is Streptococcus agalactiae, which is also potentially harmful to humans and aquatic animals. At present, research on S. agalactiae in China is mostly concentrated in the northern region, with limited research in the southeastern and southwestern regions. In this study, a total of 313 clinical mastitis samples from large-scale dairy farms in five regions of Sichuan were collected for isolation of S. agalactiae. The epidemiological distribution of S. agalactiae was inferred by serotyping isolates with multiplex polymerase chain reaction. Susceptibility testing and drug resistance genes were detected to guide the clinical use of antibiotics. Virulence genes were also detected to deduce the pathogenicity of S. agalactiae in Sichuan Province. One hundred and five strains of S. agalactiae (33.6%) were isolated according to phenotypic features, biochemical characteristics, and 16S rRNA sequencing. Serotype multiplex polymerase chain reaction analysis showed that all isolates were of type Ia. The isolates were up to 100% sensitive to aminoglycosides (kanamycin, gentamicin, neomycin, and tobramycin), and the resistance rate to β-lactams (penicillin, amoxicillin, ceftazidime, and piperacillin) was up to 98.1%. The TEM gene (β-lactam-resistant) was detected in all isolates, which was in accordance with a drug-resistant phenotype. Analysis of virulence genes showed that all isolates harbored the cfb, cylE, fbsA, fbsB, hylB, and α-enolase genes and none harbored bac or lmb. These data could aid in the prevention and control of mastitis and improve our understanding of epidemiological trends in dairy cows infected with S. agalactiae in Sichuan Province.

Introduction

Streptococcus agalactiae, also known as a group B Streptococcus, is a pathogen with high infectivity. The bacterium invades the mammary glands of dairy cows via the skin and teat and causes mastitis [1]. Mastitis caused by S. agalactiae is generally a chronic disease with few acute outbreaks and no significant clinical symptoms but reduces the milk yield and has severe economic consequences for dairy farms [2, 3]. The financial impact of mastitis includes the costs of treatment, milk that must be discarded, increased workload, reduced milk production, and culling and replacement [4]. Many types of Streptococcus cause bovine mastitis, the most important of which is S. agalactiae [5, 6]. S. agalactiae was under great control in northern Europe between the 1960s and 20th century but became a re-emerging pathogen of dairy cattle and recognized as an emerging pathogen in human adults worldwide [710]. S. agalactiae was the causative organism in approximately 20%–40% of cases of bovine mastitis in China [11]. Moreover, S. agalactiae is known to cause serious infections in humans, including infant sepsis, endocarditis, meningitis, and pneumonia in newborns, the elderly, and pregnant women [1217]. It can also infect aquatic animals [18, 19].

In cows, the main route of entry for S. agalactiae is via the teat, but infection can also occur via the oral–fecal route and directly or indirectly trigger mastitis [1, 20]. The pathogenicity of a bacterium depends on multiple virulence factors, which in the case of S. agalactiae include strong adsorption and anti-phagocytosis and immune evasion mechanisms [21]. A variety of surface proteins and endotoxins, including hemolysins and the Christie–Atkins–Munch–Peterson factor, can increase the ability of S. agalactiae to invade and colonize its host. Furthermore, certain pathogenic factors, including fibrinogen binding (fbs A/B) proteins, adhesion (lmb) proteins, and enolase proteins, can damage tissues in the host and cause destruction in the immune system. These virulence factors promote survival and spread of bacteria and seriously compromise the health of both animals and humans [22, 23]. One of the important virulence factors in S. agalactiae is capsular polysaccharide, which has characteristic antigenicity features and differential properties that are useful for serotyping. The studies reported so far have shown that S. agalactiae can be divided into 10 types (Ia, Ib, II–IX) according to the structure of its capsular polysaccharide [24].

Bovine mastitis is a major problem in the dairy industry, costing billions of dollars every year throughout the world, including in China, and S. agalactiae is one of the most important causative pathogens. At present, antibiotics are the first-line treatment for bovine mastitis. However, with the growing issue of antibiotic resistance and emergence of resistant organisms, antibiotics are becoming ineffective. Moreover, there is the problem of antibiotic residues, which are a danger to public health [25, 26]. Researchers have found an association between antibiotic resistance in S. agalactiae and resistance genes within the organism, which can transfer with migration of drug-resistant bacteria to originally drug-susceptible bacteria, which then also become drug-resistant [27]. The increase in drug-resistant strains has led to further increases in the use of antibiotics, which will not only lead to environmental pollution but also threaten human health. Therefore, the purpose of this study was to provide basic data for prevention and control of bovine mastitis by investigating S. agalactiae infection in dairy cows in Sichuan Province, determining drug resistance and carriage of resistance genes in isolated strains, and describing the distribution of virulence genes in isolates.

Materials and methods

Animal welfare statement

This study was carried out in strict accordance with the recommendations in the guide for the care and use of laboratory animals and approved by the Committee on Experimental Animal Management of the Sichuan Agricultural University. All farm owners in this study verbally agreed with the collection of milk samples.

Collection of milk samples and isolation of bacteria

Visible inflammation of the mammary glands and milk degeneration can be used to for comprehensive diagnosis of clinical-type mastitis [28]. A total of 313 milk samples were collected from cows with clinical mastitis from dairy farms in several regions of Sichuan Province between 2017 and 2019, specific sampling times, sampling rates and geographic locations are detailed in Table 1 and Fig 1. During the course of the study, we maintained cooperative relationships with six dairy farms in several region of Sichuan, China. When the cattle showed clinical symptoms, the dairy farmers would notify us to come collect samples and perform pathogen detection. To this end, we had prepared aseptic centrifuge tubes to collect quarter-level milk; these were placed in a foam box filled with ice bags and transported to the laboratory. All samples were obtained aseptically and sent to the laboratory within 12 hours, where they were inoculated on basic culture medium of Columbia agar containing 5% defibrinated sheep blood at 37°C for 18–24 h.

thumbnail
Fig 1. Geographical location of sampling.

A, map of China, the colored plate represents Sichuan Province; B, map of Sichuan Province, red star represents Hongya farm, orange star represents Yangba farm, green star represents Yushu farm, blue star represents Qingbaijiang farm, purple star represents Songya farm, and black star represents Ninggang farm, percentages identical to the symbol color indicate the sample collection rate in that dairy farm. All original maps were download from d-maps.com.

https://doi.org/10.1371/journal.pone.0268262.g001

thumbnail
Table 1. Geographic distribution of samples collected in this study.

https://doi.org/10.1371/journal.pone.0268262.t001

Biochemical characterization

A single clone of each isolated strain was stained, and the suspected positive Streptococcus spp. (purple, spherical, and chain like) was tested with catalase and the Christie–Atkins–Munch–Peterson (CAMP) assay [25]. The existence of bubbles indicates catalase positivity after treating bacteria with 3% hydrogen peroxide [29]. The CAMP test was assessed with Staphylococcus aureus, CAMP positivity was indicated by significant hemolysis between the vertical but not the intersecting two bacteria after incubation for 18–24 h at 37°C. After Gram staining and biochemical testing, the isolates that were Gram positive, catalase-negative, and CAMP-positive were confirmed with 16S rRNA polymerase chain reaction (PCR).

Genomic DNA extraction and 16S rRNA sequence analysis

Genomic DNA was extracted from bacteria cultured (incubated in brain heart infusion broth at 37°C overnight) using a bacterial DNA extraction kit (TIANamp Bacteria DNA Kit, TIANGEN BIOTECH (BEIJING) CO., LTD) according to the manufacturer’s instructions. The extracted DNA was stored at -20°C for future use.

DNA samples were determined with partial 16S rRNA sequencing, whereby forward (5’- AGAGTTTGATCCTGGCTCAG -3’) and reverse (5’- GGTTACCTTGTTACGACTT -3’) primers were used to amplify a product of approximately 1500 bp [30]. The amplified products were sent to Tsingke Biotechnology Co., Ltd. (Beijing, China) for Sanger sequencing, and the sequences were compared against those in the nucleotide database at the National Center for Biotechnology Information.

Serotyping

Multiplex PCR was used for detection of serotypes using the method described by Imperi et al. [31] All primers were used at a concentration of 250 nM except for primers cpsI-Ia-6-7-F and cpsI-7-9-F, for which the concentration was 400 nM. The reaction mixture (25 μL) was amplified with an initial denaturation step at 95°C for 5 min, followed by 15 cycles of denaturation at 95°C for 1 min, annealing at 54°C for 1 min, and extension at 72°C for 2 min, followed by 25 cycles of denaturation at 95°C for 1 min, annealing at 56°C for 1 min, and extension at 72°C for 2 min, with a final extension at 72°C for 10 min.

Analysis of antimicrobial susceptibility

All S. agalactiae isolates were tested for susceptibility to 10 antimicrobial agents that were frequently used in local dairy farms, including piperacillin (100 μg), ceftriaxone (30 μg), penicillin (10 U), amoxicillin (20 μg), ceftazidime (30 μg), kanamycin (30 μg), gentamicin (10 μg), neomycin (30 μg), streptomycin (10 μg), and tobramycin (10 μg) using the disc diffusion method on Mueller-Hinton agar plates. The cultures were incubated overnight at 37°C, and the results were interpreted in accordance with the recommendations of the Clinical and Laboratory Standards Institute (formerly the National Committee for Clinical Laboratory Standards 2020).

Detection of resistance and virulence genes

All S. agalactiae isolates were screened for the presence of the following resistance genes: TEM, IMP, DHA, and OXA (β-lactam resistance genes) and aph(3’)Ia, ant(3’)I, aac(6’)Ib, and aac(3’)Ib (aminoglycoside resistance genes). PCR was performed using specific primers, the amplification conditions for which are shown in Table 2. A total of 20 μL of reaction mixture was prepared with 10 μL of 2×Taq Master Mix (Beijing Solarbio Science & Technology Co., Ltd), 1 μL of template DNA, 0.5 μL of each primer (10 μM), and 8 μL of distilled water. Initial denaturation at 94°C for 3 min was followed by 34 cycles of amplification at 94°C for 20 s, annealing at specific temperatures (Table 2) for 20 s, extension at 72°C for 45 s, and a final extension step at 72°C for 5 min. The amplified PCR products were visualized on 1% agarose gel using a gel documentation system (GeneGenius Bio Imaging System; Syngene, Bangalore, India).

thumbnail
Table 2. Primers of resistance and virulence genes.

https://doi.org/10.1371/journal.pone.0268262.t002

The virulence genes screened were based on those found in humans and were as follows: bac (C-β protein), cfb (CAMP factor), cylE (β-hemolysins/cytolysin), fbsA (the fibrinogen-binding protein FbsA), fbsB (the fibrinogen-binding protein FbsB), hylB (hyaluronate lyase), α-enolase, and lmb (laminin-binding protein) [19]. The content of the reaction mixture and the amplification program were the same as those described above for the detection of resistance genes.

Results

Isolation and identification of S. agalactiae

After Gram staining, biochemical analysis, and 16S sequencing analysis, 105 bacterial isolates in 313 milk samples were identified to be S. agalactiae, with an isolation rate of 33.6%.

Serotyping of S. agalactiae

Multiplex PCR detection was performed to differentiate the 10 capsular serotypes of S. agalactiae (Ia, Ib, II–IX). Two bands of 688 bp and 272 bp appeared in all 105 isolated strains, including that all 105 isolated S. agalactiae serotypes were of type Ia.

Antimicrobial susceptibility

The strains were judged to be susceptible, intermediate, or resistant to the different antibiotics according to the regulations of the executive standard of antimicrobial susceptibility testing issued by the Clinical and Laboratory Standards Institute. Drug susceptibility testing of the isolates showed that up to 100% of isolates were susceptible to aminoglycosides (kanamycin, gentamicin, neomycin, and tobramycin) and that 70.5% were susceptible to streptomycin. All 105 isolates were resistant to the β-lactam agents (penicillin, amoxicillin, ceftazidime, and ceftriaxone), with a resistance rate of up to 98.1%. The resistance rate for piperacillin was 29.5% (Fig 2; the original data are shown in S1 Table, and the breakpoints for each antibiotic are shown in S2 Table).

thumbnail
Fig 2. Antibiotic susceptibility profiles of 105 isolates.

The first five drugs on the x-axis are aminoglycosides and the last five are β-lactams.

https://doi.org/10.1371/journal.pone.0268262.g002

Prevalence of antimicrobial resistance and virulence genes

PCR analysis was used to determine the drug resistance and virulence gene profiles of the S. agalactiae isolates. The frequencies of these genes in the 105 isolates are shown in S3 Table. Eight resistance genes for β-lactams (TEM, IMP, DHA, OXA) and aminoglycosides (aph(3’)Ia, ant(3’)I, aac(6’)Ib, aac(3’)Ib) were examined in 105 S. agalactiae isolates. Only TEM genes for β-lactams were detected in the isolated strains; the detection rate was up to 98%, and other resistance genes were not detected.

Eight virulence genes, namely lmb, cylE, α-enolase, fbsA, fbsB, cfb, hylB, and bac, were targeted for detection. The results showed 100% detection of cfb, cylE, fbsA, fbsB, hylB, and α-enolase for all 105 S. agalactiae isolates; the bac and lmb genes were not detected in these isolates.

Discussion

Bovine mastitis has a complex etiology and can be caused by a variety of pathogenic microorganisms, including bacteria, viruses, and fungi. However, many studies have shown that bacteria are still the main causative pathogens for bovine mastitis and that S. agalactiae is one of the most important [43, 44]. In this study, 313 milk samples from dairy cows with clinical mastitis were collected from several areas in Sichuan Province. A total of 105 strains of S. agalactiae were isolated from these samples, for an isolation rate of 33.6%. Our microbiological data are comparable with those reported by Zeryehun et al. (21.2%) in Ethiopia [45]. However, our isolation rates were significantly higher than those reported by Chehabi et al. (4.3%) in Denmark and Tomazi et al. (5.9%) in Brazil [46, 47].

The isolation rate for S. agalactiae in clinical mastitis samples varies from region to region according to the local climate and breeding environment. Even in the same country, diverse prevalence rate can be found across regions. In our study, all 105 strains were of capsular type Ia. In a study by Wang et al., serotype II of S. agalactiae was the most prevalent in dairy cows in Jiangsu, China, whereas the capsular serotypes isolated from neonates and pregnant women by Rogers et al. were mainly of type III and those in our study in dairy cows were of type Ia; we consider that although serotype II was found to be more prevalent in Jiangsu, China, serotype Ia is the most common type in cattle [10, 20, 4852]. These inconsistent findings may reflect geographic and host differences in these isolates. The collected data on the distribution of serotypes in different geographical regions should serve as a basis for the development of vaccine proposals [53, 54]. Our findings were based on S. agalactiae isolates from milk samples collected in Sichuan Province and may reflect the infection status of dairy cows with mastitis throughout southwest China; however, our data cannot be considered representative of all Chinese provinces. This is a weakness of the present study. However, along with the wide study of bovine mastitis in northern China, our study could supplement and perfect the panorama of pathogens causing clinical mastitis in China dairy herds, although the samples were not geographically evenly distributed across the country. At the nationwide level, the S. agalactiae isolation rate is significantly higher in the south than in the north, indicating that prevention and control of this bacterium remains challenging in the southern regions.

Although vaccines against the common pathogens that cause bovine mastitis are available for prevention and control purposes, systemic or intramammary antibiotic therapy continues to be the mainstay of treatment for clinical mastitis [55]. Penicillin was used as the first choice for prevention and therapy of group B streptococcal (GBS); however, increased resistance of GBS to penicillin has been periodically reported since 1994 [5659]. Streptococci have been shown to be highly resistant to enrofloxacin, erythromycin, lincomycin, and penicillin [60]. In this study, we performed susceptibility testing for 10 antibiotic agents (including β-lactams and aminoglycosides) commonly used to treat clinical mastitis in dairy cows located in Sichuan Province, and found that the resistance rate in 105 isolates was up to 98.1% for β-lactams (penicillin, amoxicillin, ceftriaxone, and ceftazidime) while all isolates possessed high sensitivity to aminoglycosides (kanamycin, gentamicin, neomycin, and tobramycin). These findings are consistent with those of a study performed in Ukraine by Elias et al., who isolated S. agalactiae that possessed high resistance to β-lactam antibiotics, and those of a study in North China by Tian et al., who isolated streptococci with a resistance rate of 100% to penicillin and average sensitivity to aminoglycosides (92.86%) [61, 62]. These susceptibility results correspond to the clinical use of antibiotics in China. However, in a study performed in Slovakia, 23 S. agalactiae strains showed resistance rates of 8.7% and 30.4% to oxacillin and streptomycin, respectively, but were highly susceptible to penicillin and ceftiofur [63]. Furthermore, all streptococci in Denmark were found to be susceptible to penicillin [46]. All isolates were resistant to aminoglycosides while sensitive to β-lactam antibiotics and rifampicin in the Emilia Romagna region (Northern Italy) [64]. The inconsistency between these reports and our present findings may reflect differences in the types of antibiotics used in clinical practice across regions. The main antibiotics used to treat bovine mastitis in China are the β-lactams, although aminoglycosides may be used in the future to treat mastitis caused by Streptococcus spp.

PCR detection of resistance genes identified the TEM gene for β-lactams in all isolates; however, no other drug resistance genes were detected. In a study by Lu et al., the detection rate for genes conferring resistance to β-lactams was 100% in 10 strains of S. agalactiae resistant to penicillin [65]. Meanwhile, Yang et al. reported the detection rates for four aminoglycoside resistance genes [aph (3’)-Ia, ant (3’)-I, aac (3’)-Ib and aac (6’)-Ib] to be 0.0%, 75.0%, 0.0%, and 31.3%, respectively; overall, these values were consistent with the results of our study [66]. The combination of the data regarding the resistance genes and phenotypes indicates high resistance of S. agalactiae to β-lactams, but sensitivity to aminoglycosides, in Sichuan. Therefore, aminoglycosides may become the preferred agents for treatment of dairy cows with clinical mastitis in the future.

In this study, PCR showed that the cfb, cylE, fbsA, fbsB, hylB, and enolase virulence genes were present in all isolates, whereas the bac and lmb genes were not; the detection rates were the same with those reported for isolates in Argentina [67]. These virulence factors provide essential assistance for allowing pathogenic bacteria to invade the host and to be directly involved in the invasion process [68]. Notably, cylE is a pore-forming toxin involved in tissue damage and systemic dissemination of bacteria [69]. Previous studies have reported the presence of this gene in 78% of Polish strains and in 100% of Chinese strains [70, 71]. FbsA and fbsB were mainly present in type Ia and type III GBS, both major capsular types that could induce mastitis [5]. Moreover, FbsA and fbsB were prove to be closely associated with the adhesion of virulence factors [72]. HylB is regarded a dominant virulence factor in S. agalactiae, and the presence of hylB could enhance virulence when there is S. agalactiae mammary-gland invasion [73]. Cfb was widely detected in S. agalactiae; the CAMP factor produced by gene cfb could enhance the dissolution of sheep erythrocytes by S. aureus, leading to a CAMP-positive phenomenon as we found in this study [74]. Earlier molecular reports showed that in contrast to human isolates, most bovine isolates lack surface protein-encoding genes, including lmb, in line with our findings [75].

Our results could lay the foundation for mastitis prevention and control, selection of antimicrobial agents, and research regarding the mechanisms of bacterial infection in dairy cows in Sichuan Province. Our data suggest that aminoglycosides could be used to treat clinical mastitis caused by S. agalactiae in Sichuan Province. As a temporary measure, aminoglycosides could be useful in terms of clinical treatment and reduction of economic loss. However, S. agalactiae may eventually develop resistance to these antimicrobial agents and even transfer this ability to other bacteria with initial sensitivity. Therefore, use of aminoglycosides cannot be considered a long-term solution, and it is necessary to continue the search for alternative agents, such as vaccines and phage therapy. Moreover, the virulence factors detected in this study could provide basic data for vaccine preparation in southern regions, given reduced use of antibiotics and lesser efficiency of the GBS vaccines that have been produced.

Statistical analysis

The data are presented as counts and percents. The image of the susceptibility assay was generated with GraphPad Prism version 7 (GraphPad Software, San Diego, CA).

Supporting information

S1 Table. Antibiotic susceptibility profiles of 105 S. agalactiae isolates from dairy cows.

https://doi.org/10.1371/journal.pone.0268262.s001

(PDF)

S2 Table. Breakpoints for each antibiotic used in this antimicrobial susceptibility test.

https://doi.org/10.1371/journal.pone.0268262.s002

(PDF)

S3 Table. Frequency of antibiotic resistance and virulence genes in the 105 S. agalactiae isolates.

https://doi.org/10.1371/journal.pone.0268262.s003

(PDF)

Acknowledgments

We would like to thank Editage (www.editage.cn) for English language editing.

References

  1. 1. Murphy JM. The genesis of bovine udder infection and mastitis; the occurrence of streptococcal infection in a cow population during a seven-year period and its relationship to age. Am J Vet Res. 1947;8(26):29–42. pmid:20284858
  2. 2. Seligsohn D, Crestani C, Gitahi N, Lejon Flodin E, Chenais E, Zadoks RN. Investigation of extramammary sources of Group B Streptococcus reveals its unusual ecology and epidemiology in camels. PloS one. 2021;16(12):e0252973–e. pmid:34860840
  3. 3. Cobo-Ángel C, Jaramillo-Jaramillo AS, Lasso-Rojas LM, Aguilar-Marin SB, Sanchez J, Rodriguez-Lecompte JC, et al. Streptococcus agalactiae is not always an obligate intramammary pathogen: Molecular epidemiology of GBS from milk, feces and environment in Colombian dairy herds. PloS one. 2018;13(12):e0208990–e. pmid:30532177
  4. 4. el Garch F, Youala M, Simjee S, Moyaert H, Klee R, Truszkowska B, et al. Antimicrobial Susceptibility of Nine Udder Pathogens Recovered from Bovine Clinical Mastitis Milk in Europe 2015–2016: VetPath results. Vet Microbiol. 2020;245:108644. pmid:32456822
  5. 5. Carvalho-Castro GA, Silva JR, Paiva LV, Custódio DAC, Moreira RO, Mian GF, et al. Molecular epidemiology of Streptococcus agalactiae isolated from mastitis in Brazilian dairy herds. Braz J Microbiol. 2017;48(3):551–9. pmid:28256391
  6. 6. Ruegg PL. A 100-Year Review: Mastitis detection, management, and prevention. J Dairy Sci. 2017;100(12):10381–97. pmid:29153171
  7. 7. Katholm J, Bennedsgaard TW, Koskinen MT, Rattenborg E. Quality of bulk tank milk samples from Danish dairy herds based on real-time polymerase chain reaction identification of mastitis pathogens. J Dairy Sci. 2012;95(10):5702–8. pmid:22921631
  8. 8. Lambertsen L, Ekelund K, Skovsted IC, Liboriussen A, Slotved HC. Characterisation of invasive group B streptococci from adults in Denmark 1999 to 2004. Eur J Clin Microbiol Infect Dis. 2010;29(9):1071–7. pmid:20676713
  9. 9. Skoff TH, Farley MM, Petit S, Craig AS, Schaffner W, Gershman K, et al. Increasing burden of invasive group B streptococcal disease in nonpregnant adults, 1990–2007. Clin Infect Dis. 2009;49(1):85–92. pmid:19480572
  10. 10. Lyhs U, Kulkas L, Katholm J, Waller KP, Saha K, Tomusk RJ, et al. Streptococcus agalactiae Serotype IV in Humans and Cattle, Northern Europe(1). Emerg Infect Dis. 2016;22(12):2097–103. pmid:27869599
  11. 11. Li H, Luo J, Wang X, Li X, Wang L, Yang F, et al. Study on the Antibiotic Resistance of Streptococcus agalactiae Causing Bovine Mastitis in China. J Tradit Chin Med. 2012;31(06):5–7.
  12. 12. Furfaro LL, Chang BJ, Payne MS. Perinatal Streptococcus agalactiae Epidemiology and Surveillance Targets. Clin Microbiol Rev. 2018;31(4):e00049–18. pmid:30111577
  13. 13. Furfaro LL, Chang BJ, Kahler CM, Payne MS. Genomic characterisation of perinatal Western Australian Streptococcus agalactiae isolates. PloS one. 2019;14(10):e0223256–e. pmid:31577825
  14. 14. Zheng J-x, Chen Z, Xu Z-c, Chen J-w, Xu G-j, Sun X, et al. In vitro evaluation of the antibacterial activities of radezolid and linezolid for Streptococcus agalactiae. Microb Pathog. 2020;139:103866. pmid:31715321
  15. 15. Percha B, Newman MEJ, Foxman B. Transmission probabilities and durations of immunity for three pathogenic group B Streptococcus serotypes. Infect Genet Evol. 2011;11(6):1407–12. pmid:21605704
  16. 16. Pinho-Ribeiro FA, Baddal B, Haarsma R, O’Seaghdha M, Yang NJ, Blake KJ, et al. Blocking Neuronal Signaling to Immune Cells Treats Streptococcal Invasive Infection. Cell. 2018;173(5):1083–97.e22. pmid:29754819
  17. 17. Pitts SI, Maruthur NM, Langley GE, Pondo T, Shutt KA, Hollick R, et al. Obesity, Diabetes, and the Risk of Invasive Group B Streptococcal Disease in Nonpregnant Adults in the United States. Open Forum Infect Dis. 2018;5(6):ofy030–ofy. pmid:29977953
  18. 18. Su Y, Liu C, Deng Y, Cheng C, Ma H, Guo Z, et al. Molecular typing of Streptococcus agalactiae isolates of serotype Ia from tilapia in southern China. FEMS Microbiol Lett. 2019;366(13). pmid:31299078
  19. 19. Kannika K, Pisuttharachai D, Srisapoome P, Wongtavatchai J, Kondo H, Hirono I, et al. Molecular serotyping, virulence gene profiling and pathogenicity of Streptococcus agalactiae isolated from tilapia farms in Thailand by multiplex PCR. J Appl Microbiol. 2017;122(6):1497–507. pmid:28295891
  20. 20. Jørgensen HJ, Nordstoga AB, Sviland S, Zadoks RN, Sølverød L, Kvitle B, et al. Streptococcus agalactiae in the Environment of Bovine Dairy Herds–Rewriting the Textbooks? Vet Microbiol. 2016;184:64–72. pmid:26854346
  21. 21. Emaneini M, khoramian B, Jabalameli F, Abani S, Dabiri H, Beigverdi R. Comparison of Virulence Factors and Capsular Types of Streptococcus agalactiae Isolated from Human and Bovine Infections. Microb Pathogenesis. 2016;91:1–4. pmid:26593104
  22. 22. Oliveira ICM, de Mattos MC, Pinto TA, Ferreira-Carvalho BT, Benchetrit LC, Whiting AA, et al. Genetic Relatedness between Group B Streptococci Originating from Bovine Mastitis and a Human Group B Streptococcus Type V Cluster Displaying an Identical Pulsed-field Gel Electrophoresis Pattern. Clin Microbiol Infec. 2006;12(9):887–93.
  23. 23. Li Y, Zeng W, Li Y, Fan W, Ma H, Fan X, et al. Structure Determination of the CAMP Factor of Streptococcus agalactiae with the Aid of an MBP Tag and Insights into Membrane-surface Attachment. Acta Crystallogr D. 2019;75. pmid:31373576
  24. 24. Beigverdi R, Jabalameli F, Mirsalehian A, Hantoushzadeh S, Shahram B, Emaneini M. Virulence Factors, Antimicrobial Susceptibility and Molecular Characterization of Streptococcus agalactiae Isolated from Pregnant Women. Acta Microbial Imm H. 2014;61:425–34. pmid:25496971
  25. 25. Tomazi T, de Souza Filho AF, Heinemann MB, Dos Santos MV. Molecular characterization and antimicrobial susceptibility pattern of Streptococcus agalactiae isolated from clinical mastitis in dairy cattle. PloS one. 2018;13(6):e0199561–e. pmid:29928042
  26. 26. Yang F, Wang Q, Wang X-r, Wang L, Li X-p, Luo J-y, et al. Genetic characterization of antimicrobial resistance in Staphylococcus aureus isolated from bovine mastitis cases in Northwest China. J Integr Agric. 2016;15(12):2842–7.
  27. 27. Mendes R, Paukner S, Doyle T, Gelone S, Flamm R, Sader H. Low Prevalence of Gram-positive Isolates Showing Elevated Lefamulin MIC Results during the Surveillance Program for 2015–2016 and Characterization of Resistance Mechanisms. Antimicrob Agents CH. 2019;63. pmid:30670418
  28. 28. Pegolo S, Tessari R, Bisutti V, Vanzin A, Giannuzzi D, Gianesella M, et al. Quarter-level analyses of the associations among subclinical intramammary infection and milk quality, udder health, and cheesemaking traits in Holstein cows. Journal of Dairy Science. 2022.
  29. 29. Maehly AC, Chance B. The assay of catalases and peroxidases. Methods Biochem Anal. 1954;1:357–424. pmid:13193536
  30. 30. Soergel DAW, Dey N, Knight R, Brenner SE. Selection of primers for optimal taxonomic classification of environmental 16S rRNA gene sequences. ISME J. 2012;6(7):1440–4. pmid:22237546
  31. 31. Imperi M, Pataracchia M, Alfarone G, Baldassarri L, Orefici G, Creti R. A Multiplex PCR Assay for the Direct Identification of the Capsular Type (Ia to IX) of Streptococcus agalactiae. J Microbiol Meth. 2009;80:212–4. pmid:19958797
  32. 32. Lv J, Hou L, Yang H, Zhao Y, Zhang J, Gao B, et al. Extended Spectrum β - lactamase Gene Testing and Distribution in Multidrug Resistant Acinetobacter baumannii (Chinese). Journal of Chinese Practical Diagnosis and Therapy. 2010;24(09):932–4.
  33. 33. Han J, Han Z. Drug Resistance and Genotyping of Streptococcus pneumoniae in Children (Chinese). Journal of Clinical Medical Literature 2018;5(35):195–6.
  34. 34. Shi Y, Li C. Update on Study of Resistance Genes of Streptococcus pneumoniae to β-lactam and Macrolide Antibiotics. International Journal of Respiration. 2009(17):1062–4.
  35. 35. Gao Y, Feng X, Li L, Zhao H, Diao Y, Liu S, et al. Research Progress on the Vaccine of Dairy Mastitis for Prevention and Cure. Journal of Hebei Normal University of Science & Technology. 2011;25(01):73–6.
  36. 36. Yuan M, Yuan Y, Liu M, Chen H. Detection on Aminoglycoside Antibiotic-Resistant Genes of Staphylococcus aureus. Modern Preventive Medicine. 2013;40(09):1718–20+23.
  37. 37. Huang B, Chen C, Tang X, Lan K. Detection of Antimicrobial-resistant Genes of Klebsiella pneumoniae Resistant to Quinolones and Aminoglycoside and Drug Resistant Mechanism. Chinese Journal of Nosocomiology. 2011;21(01):5–7.
  38. 38. Du L, Zhou X, Zhao H, Lv T, Cui J, Li S, et al. Isolation, Identification and Characterization of Streptococcus agalactiae of Bovine Origin in North China. Microbiology China. 2016;43(3):567–74.
  39. 39. Xu Z, Zhang B, Zhong W, Chen X, Li D, Wang H, et al. The Distribution of Virulence Factors in Streptococcus agalactiae and Its Relationship to Antimicrobial Resistance and MLST. Journal of Parasitic Biology. 2018;13(11):1216–20.
  40. 40. Godoy DT, Carvalho-Castro GA, Leal CAG, Pereira UP, Leite RC, Figueiredo HCP. Genetic Diversity and New Genotyping Scheme for Fish Pathogenic Streptococcus agalactiae. Lett Appl Microbiol. 2013;57(6):476–83. pmid:23889675
  41. 41. Corrêa ABdA, Oliveira ICMd, Pinto TdCA, Mattos MCd, Benchetrit LC. Pulsed-field Gel Electrophoresis, Virulence Determinants and Antimicrobial Susceptibility Profiles of Type Ia Group B Streptococci Isolated from Humans in Brazil. Mem I Oswaldo Cruz. 2009;104(4):599–603. pmid:19722083
  42. 42. Zhang L, Wang H, Yang G, Dong X. Research Advance of Alpha-enolase. Chinese Journal of Clinical Laboratory Management(Electronic Edition). 2016;4(2):91–4.
  43. 43. Almeida A, Alves-Barroco C, Sauvage E, Bexiga R, Albuquerque P, Tavares F, et al. Persistence of a dominant bovine lineage of group B Streptococcus reveals genomic signatures of host adaptation. Environ Microbiol. 2016;18(11):4216–29. pmid:27696631
  44. 44. Yang Y, Liu Y, Ding Y, Yi L, Ma Z, Fan H, et al. Molecular characterization of Streptococcus agalactiae isolated from bovine mastitis in Eastern China. PloS one. 2013;8(7):e67755–e. pmid:23874442
  45. 45. Zeryehun T, Aya T, Bayecha R. Study on Prevalence, Bacterial Pathogens and Associated Risk Factors of Bovine Mastitis in Small Holder Dairy Farms in and Around Addis Ababa, Ethiopia. J Anim Plant SCI-PAK. 2013;23:50–5.
  46. 46. Chehabi CN, Nonnemann B, Astrup LB, Farre M, Pedersen K. In Vitro Antimicrobial Resistance of Causative Agents to Clinical Mastitis in Danish Dairy Cows. Foodborne Pathog Dis. 2019;16(8):562–72. pmid:31059284
  47. 47. Tomazi T, Ferreira GC, Orsi AM, Gonçalves JL, Ospina PA, Nydam DV, et al. Association of Herd-level Risk Factors and Incidence Rate of Clinical Mastitis in 20 Brazilian Dairy Herds. Prev Vet Med. 2018;161:9–18. pmid:30466663
  48. 48. Wang D, Yang F, Li X, Luo J, Liu L, Zhang Z, et al. Isolation, Identification and Drug Resistance Detection of the Pathogenic Bacteria Causing Dairy Cow Mastitis in Suzhou and Capsular Polysaccharide Typing Test of the Pathogens. Chinese Journal of Preventive Veterinary Medicine. 2018;40(08):680–6.
  49. 49. Rogers L, Gaddy J, Manning S, Aronoff D. Variation in Macrophage Phagocytosis of Streptococcus agalactiae Does Not Reflect Bacterial Capsular Serotype, Multilocus Sequence Type, or Association with Invasive Infection. Pathogens & immunity. 2018;3:63–71. pmid:29930990
  50. 50. Botelho ACN, Ferreira AFM, Fracalanzza SEL, Teixeira LM, Pinto TCA. A Perspective on the Potential Zoonotic Role of Streptococcus agalactiae: Searching for a Missing Link in Alternative Transmission Routes. Front Microbiol. 2018;9:608. pmid:29643850
  51. 51. Ippolito DL, James WA, Tinnemore D, Huang RR, Dehart MJ, Williams J, et al. Group B Streptococcus Serotype Prevalence in Reproductive-age Women at a Tertiary Care Military Medical Center Relative to Global Serotype Distribution. BMC Infect Dis. 2010;10:336. pmid:21106080
  52. 52. Zadoks RN, Middleton JR, McDougall S, Katholm J, Schukken YH. Molecular Epidemiology of Mastitis Pathogens of Dairy Cattle and Comparative Relevance to Humans. J Mammary Gland Biol. 2011;16(4):357–72. pmid:21968538
  53. 53. Le Doare K, Faal A, Jaiteh M, Sarfo F, Taylor S, Warburton F, et al. Association between functional antibody against Group B Streptococcus and maternal and infant colonization in a Gambian cohort. Vaccine. 2017;35(22):2970–8. pmid:28449969
  54. 54. do Nascimento CS, Dos Santos NFB, Ferreira RCC, Taddei CR. Streptococcus agalactiae in pregnant women in Brazil: prevalence, serotypes, and antibiotic resistance. Braz J Microbiol. 2019;50(4):943–52. pmid:31432465
  55. 55. Contreras Bravo G, Guterbock W, R J, Sears P. Comparison of Systemic and Intramammary Dry Cow Treatments. Revista MVZ Córdoba. 2013;18:3259–64.
  56. 56. Dhanoa A, Karunakaran R, Puthucheary SD. Serotype distribution and antibiotic susceptibility of group B streptococci in pregnant women. Epidemiol Infect. 2010;138(7):979–81. pmid:19889253
  57. 57. Karunakaran R, Raja NS, Hafeez A, Puthucheary SD. Group B Streptococcus infection: epidemiology, serotypes, and antimicrobial susceptibility of selected isolates in the population beyond infancy (excluding females with genital tract- and pregnancy-related isolates) at the University Malaya Medical Centre, Kuala Lumpur. Jpn J Infect Dis. 2009;62(3):192–4. pmid:19468178
  58. 58. Longtin J, Vermeiren C, Shahinas D, Tamber GS, McGeer A, Low DE, et al. Novel mutations in a patient isolate of Streptococcus agalactiae with reduced penicillin susceptibility emerging after long-term oral suppressive therapy. Antimicrob Agents Chemother. 2011;55(6):2983–5. pmid:21383092
  59. 59. Seki T, Kimura K, Reid ME, Miyazaki A, Banno H, Jin W, et al. Arakawa Y. High isolation rate of MDR group B streptococci with reduced penicillin susceptibility in Japan. Journal of Antimicrobial Chemotherapy. 2015;70(10):2725–8.
  60. 60. Guo Y, Xu C, Qiu P, Liu Y, Zhang D, Liu S, et al. Susceptibility Test on Streptococcus Isolated from Dairy Cow with Subclinical Mastitis. Animal Husbandry & Veterinary Medicine. 2018;50(06):118–21.
  61. 61. Tian X, Zhen T, Yu Z, Sun P, Wang J, Han R, et al. Study on Streptococcus Resistant Phenotypes and Resistance Genes in Dairy Cow Mastitis in Four Provinces in North China. Heilongjiang Animal Science and Veterinary Medicine. 2019(01):1–7.
  62. 62. Elias L, Balasubramanyam AS, Ayshpur OY, Mushtuk IU, Sheremet NO, Gumeniuk VV, et al. Antimicrobial Susceptibility of Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli Isolated from Mastitic Dairy Cattle in Ukraine. Antibiotics-Basel. 2020;9(8):469. pmid:32752205
  63. 63. Zigo F, Vasiľ M, Elečkov J, Zigová M, Farkašová Z. Mastitis Pathogens Isolated from Samples of Milk in Dairy Cows and Their Resistance against Antimicrobial Agents. J Food ENG. 2017;7.
  64. 64. Carra E, Russo S, Micheli A, Garbarino C, Ricchi M, Bergamini F, et al. Evidence of Common Isolates of Streptococcus agalactiae in Bovines and Humans in Emilia Romagna Region (Northern Italy). Front Microbiol. 2021;12:673126. pmid:34177854
  65. 65. Lu L, Zhu Y, Yan X, Gong L, Sun W, Yang J, et al. Detection of Drug Resistance and Resistance Genes in Streptococcus agalactiae. Chinese Journal of Veterinary Medicine. 2018;54(07):64–8+73.
  66. 66. Yang M, Wei M, Luo F, Shanmei L, Huang L, Li M, et al. Resistance and Related Genes Detection of Tilapia Streptococcus agalactiae Against Aminoglycosides. Southwest China Journal of Agricultural Sciences. 2018;31(11):2438–44.
  67. 67. Hernandez L, Bottini E, Cadona J, Cacciato C, Monteavaro C, Bustamante A, et al. Multidrug Resistance and Molecular Characterization of Streptococcus agalactiae Isolates From Dairy Cattle With Mastitis. Front Cell Infect Mi. 2021;11:647324. pmid:33996629
  68. 68. Sridharan U, Ragunathan P, Spellerberg B, Ponnuraj K. Molecular Dynamics Simulation of Metal Free Structure of Lmb, a Laminin Binding Adhesin of Streptococcus agalactiae: Metal Removal and Its Structural Implications. J Biomol Struct Dyn. 2018;37:1–23. pmid:29297251
  69. 69. Reiss A, Braun JS, Jäger K, Freyer D, Laube G, Bührer C, et al. Bacterial Pore-forming Cytolysins Induce Neuronal Damage in a Rat Model of Neonatal Meningitis. J Infect Dis. 2011;203(3):393–400. pmid:21186256
  70. 70. Kaczorek E, Małaczewska J, Wójcik R, Siwicki AK. Biofilm Production and Other Virulence Factors in Streptococcus spp. Isolated from Clinical Cases of Bovine Mastitis in Poland. BMC Vet Res. 2017;13(1):398. pmid:29282118
  71. 71. Pang M, Sun L, He T, Bao H, Zhang L, Zhou Y, et al. Molecular and Virulence Characterization of Highly Prevalent Streptococcus agalactiae Circulated in Bovine Dairy Herds. Vet Res. 2017;48(1):65. pmid:29037262
  72. 72. Pickering AC, Vitry P, Prystopiuk V, Garcia B, Höök M, Schoenebeck J, et al. Host-specialized fibrinogen-binding by a bacterial surface protein promotes biofilm formation and innate immune evasion. PLoS Pathog. 2019;15(6):e1007816. pmid:31216354
  73. 73. Wu F, Xiong B, Tong J, Jiang L. Advances on Virulence Factors of Streptococcus agalactiae of Dairy Cows Mastitis. Acta Veterinaria Et Zootechnica Sinica. 2020;51(12):2954–63.
  74. 74. Podbielski A, Blankenstein O, Lütticken R. Molecular characterization of the cfb gene encoding group B streptococcal CAMP-factor. Med Microbiol Immunol. 1994;183(5):239–56. pmid:7715536
  75. 75. Franken C, Haase G, Brandt C, Weber-Heynemann J, Martin S, Lämmler C, et al. Horizontal Gene Transfer and Host Specificity of Beta-haemolytic Streptococci: the Role of a Putative Composite Transposon Containing ScpB and Lmb. Mol Microbiol. 2001;41(4):925–35. pmid:11532154