Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Age-related changes in Kv4/Shal and Kv1/Shaker expression in Drosophila and a role for reactive oxygen species

  • Maximiliano J. Vallejos,

    Roles Conceptualization, Data curation, Formal analysis, Methodology

    Affiliation Department of Biomedical Sciences, Colorado State University, Fort Collins, Colorado, United States of America

    ⨯
  • Abdunaser Eadaim,

    Roles Data curation, Formal analysis, Methodology, Writing – review & editing

    Affiliation Department of Biomedical Sciences, Colorado State University, Fort Collins, Colorado, United States of America

    ⨯
  • Eu-Teum Hahm,

    Roles Data curation, Formal analysis

    Affiliation Department of Biomedical Sciences, Colorado State University, Fort Collins, Colorado, United States of America

    ⨯
  • Susan Tsunoda

    Roles Conceptualization, Funding acquisition, Investigation, Project administration, Resources, Writing – original draft, Writing – review & editing

    susan.tsunoda@colostate.edu

    Affiliation Department of Biomedical Sciences, Colorado State University, Fort Collins, Colorado, United States of America

    ⨯

Abstract

Age-related changes in ion channel expression are likely to affect neuronal signaling. Here, we examine how age affects Kv4/Shal and Kv1/Shaker K+ channel protein levels in Drosophila. We show that Kv4/Shal protein levels decline sharply from 3 days to 10 days, then more gradually from 10 to 40 days after eclosion. In contrast, Kv1/Shaker protein exhibits a transient increase at 10 days that then stabilizes and eventually declines at 40 days. We present data that begin to show a relationship between reactive oxygen species (ROS), Kv4/Shal, and locomotor performance. We show that Kv4/Shal levels are negatively affected by ROS, and that over-expression of Catalase or RNAi knock-down of the ROS-generating enzyme, Nicotinamide Adenine Dinucleotide Phosphate (NADPH) Oxidase (NOX), can attenuate the loss of Kv4/Shal protein. Finally, we compare levels of Kv4.2 and Kv4.3 in the hippocampus, olfactory bulb, cerebellum, and motor cortex of mice aged 6 weeks and 1 year. While there was no global decline in Kv4.2/4.3 that parallels what we report in Drosophila, we did find that Kv4.2/4.3 are differentially affected in various brain regions; this survey of changes may help inform mammalian studies that examine neuronal function with age.

Citation: Vallejos MJ, Eadaim A, Hahm E-T, Tsunoda S (2021) Age-related changes in Kv4/Shal and Kv1/Shaker expression in Drosophila and a role for reactive oxygen species. PLoS ONE 16(12): e0261087. https://doi.org/10.1371/journal.pone.0261087

Editor: Giuseppe Biagini, University of Modena and Reggio Emilia, ITALY

Received: July 2, 2021; Accepted: November 23, 2021; Published: December 21, 2021

Copyright: © 2021 Vallejos et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the manuscript and its S1 Raw images files.

Funding: This work was supported by the National Institute of General Medical Sciences (https://www.nigms.nih.gov/) and National Institute on Aging (https://www.nia.nih.gov/) of the National Institutes of Health (grant numbers, R01GM083335 and R03AG071917). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Aging has long been associated with a decline in cognitive and motor function, and this is a phenomenon that is conserved across species [1–6]. Changes in ion channel expression and function that occur with age are likely to compromise signaling and may be a contributing factor to the progressive loss of motor and cognitive function. Multiple ion channels and neurotransmitter receptors, which shape signaling in the nervous system, have been shown to be affected by age. For example, levels of mRNA encoding subunits of AMPA and NMDA receptors have been shown to be reduced by half in the prefrontal cortex of older adults (> 40 years) compared to younger adults [7]. In rodents, AMPA receptor subunits, including GluR1, have also been shown to be lost with age in some brain regions [8–10]. Mouse NMDA receptor subunits NR1 and NR2B mRNA and protein were shown to be reduced in the aged hippocampus [11–14]. Interestingly, with age, greater levels of stimulation are required for inducing long-term potentiation (LTP) (reviewed in [15]), and spatial memory and motor function have been correlated with levels of NMDA receptors [16, 17]. GABA receptors have also been shown to be affected by age, with altered levels of subunit mRNA and protein levels in some brain regions [18, 19].

Voltage-dependent K+ channels have been reported to be affected by age as well. Kv1.1 and Kv1.2 channel protein levels are enhanced with age in both cerebellar output neurons and cochlear nuclei of rats [20, 21], and Kv3.1 protein levels have been reported to decline with age in the posterior ventral cochlear nucleus in the rat auditory system [20]. One report has shown age-related hyperexcitability in CA3 pyramidal neurons that is due to an enhancement in the A-type K+ current, and a concurrent increase in Kv4.2 and Kv4.3 [22].

With age, the accumulation of reactive oxygen species (ROS) has been proposed as a key factor contributing to how some ion channels are affected by age. ROS have been shown to affect gene expression and proteostasis at multiple levels, from synthesis to degradation. For example, studies have suggested that increased levels of ROS cause damage to nucleic acids, and even preferentially to promotor regions of genes [7], leading to a decline in some mRNAs with age [23]. ROS also lead to protein oxidation, resulting in protein dysfunction and often aggregation [24, 25]. In processes conserved across species, the K+ channel, Kv2.1, has been shown to undergo protein oxidation by ROS, inducing oligomerization of Kv2.1 channels [26, 27] that renders them non-functional, promoting hyperexcitability, and impairing working memory [27–29].

In this study, we show that in Drosophila, Kv4/Shal protein levels decline sharply in the early life of the fly with a concurrent increase in Kv1/Shaker protein. Kv4/Shal protein levels then exhibit a continual decline to levels less than 20% by 40 days after eclosion (AE). This substantial loss in Kv4/Shal protein is interesting since Kv4/Shal channels are the most highly conserved subfamily of voltage-dependent K+ channels with 84% amino acid identity between flies and mice [30], and Kv4/Shal channels across species have been shown to modulate Hebbian and homeostatic forms of synaptic plasticity, and contribute to functions such as locomotion and cognition. All Kv4/Shal channels, from invertebrates to mammals, have been shown to encode fast transient A-type K+ currents [30–33]. In neurons, Kv4/Shal channels are localized to somato-dendritic sites, where they play important roles in modulating neural activity, regulating the integration of high-frequency trains of synaptic input [34], modulating incoming miniature excitatory post-synaptic currents (mEPSCs) [35], regulating backpropagating action potentials (bAPs) [36–38], and contributing to long-term potentiation (LTP) [35, 38, 39]. In Drosophila, Kv4/Shal channels have been shown to regulate the onset and frequency of AP firing [40], modulate mEPSCs and synaptic homeostasis [41, 42], and critically contribute to locomotor and learning/memory performance in both physiological and pathological conditions [40, 43]. We also examine how age affects locomotor performance, and how over-expression of Kv4/Shal or Kv1/Shaker affects this performance. We present evidence that the age-dependent accumulation of ROS may contribute to the decline of Kv4/Shal protein.

Materials and methods

Fly stocks

w1118 or genetic background strains were used as control lines in this study. Fly strains used include: Canton-S (Bloomington Drosophila Stock Center, Stock 64349), w1118, SK-/- (kindly provided by Dr. Patrick Dolph) [44], Df(Shaker) (kindly provided by Dr. Kyunghee Koh) [45], UAS-DNKv4 [40], UAS-Kv4/Shal [43], UAS-Kv1/Shaker (kindly provided by Dr. William Joiner), and UAS-SOD1, UAS-SOD2, UAS-Catalase, UAS-NOX-RNAi and UAS-DUOX-RNAi (all kindly provided by Dr. Matthias Landgraf), UAS-GFP-Kv4/Shal [46], and elav-GAL4, tub-GAL80ts, UAS-Dcr2 (all obtained from the Bloomington Drosophila Stock Center).

Aging drosophila.

Fly stocks were grown at 23–25°C, and male flies < 24 hours AE were collected and housed in vials (10–40 flies per vial, depending on the experiment) at 25°C, 65% humidity for the indicated number of days. Flies were transferred to fresh food every 5–7 days throughout aging periods.

Digital drop PCR

RNA isolation and reverse transcription.

Total RNA was extracted from 10 fly heads using TRIzol reagent, treated with DNase I (Thermo Scientific) to remove potential genomic DNA contamination. The integrity of the representative RNA samples was assessed using gel electrophoresis. Total RNA concentration was measured in duplicate using NanoDrop Lite Spectrophotometer (Thermo Scientific) and the purity of the samples was estimated by the OD ratios (A260/A280, ranging within 1.9–2.0). cDNA was synthesized from 700 ng of DNA-free total RNA in a 20 μl reaction volume using SuperScript II RT (Invitrogen) and Oligo (dT) as reverse transcription primers.

Primer design and verification.

Common sequence from multiple mRNA transcript variants (predicted in Fly Base) were used for PCR primer design. Probe finder version 2.35 and intron spanning assay (Roche) were used to find a proper probe and design primers; Primer3 software was used with the following settings: melting temperatures between 59°C and 61°C, GC content between 40 and 60% and amplicon length limited to 60–200 base pairs. The maximum self-complementarity of the primers was set at 8 and the maximum 3’ complementarity at 3. The PCR primer sets specificity were verified by Primer-Blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) using the Drosophila transcriptome. Probe 66 was used for Kv4/Shal primers (Left, GCTAACGAAAGGAGGAACG; Right, TGAACTTATTGCTGTCATTTTGC) and RPS20 primers (Left, CGACCAGGGAAATTGCTAAA; Right, CGACATGGGGCTTCTCAATA); Probe 147 was used for eIF1A primers (Left, TCG TCT GGA GGC AAT GTG; Right, GCC CTG GTT AAT CCA CAC C). Ribosomal Protein S 20 (RpS20) and Eukaryotic Initiation Factor 1 A (eIF1A) were selected as reference genes based on their stability across experimental conditions. Real-time products were extracted for sequencing and PCR efficiency was calculated from 10-fold serial dilutions of cDNA samples; PCR efficiencies were required to be between 1.9 and 2.0.

Droplet generation and PCR.

To generate droplets, the 20ul PCR reaction mix and 60ul droplet generation oil were added to wells in a DG8 Cartridge for the QX200 Droplet Generator (Bio-Rad Laboraties). After automated droplet generation, droplets were transferred to a 96-well plate. The plate was sealed with foil using the PX1 PCR Plate Sealer (Bio-Rad Laboratories), and PCR amplification was performed (C1000 Touch Thermal Cycler, Bio-Rad Laboratories). The following thermal cycling protocol was used: 95°C for 10 minutes (one cycle), 94°C for 30 seconds (40 Cycles) and then 60°C for 1 minute (40 cycles), 98°C for 1 minutes (one cycle), hold at 4°C. The ramp rate was set at 2°C/s, the sample volume at 40 mL, and the heated lid at 105°C. After PCR amplification, plates were read in the QX200 Droplet Reader (Bio-Rad Laboratories). Absolute template expression in copies per microliter were quantified using QuantaSoft software (Bio-Rad Laboratories); number of Kv4/Shal copies/ul were normalized to the number of RpS20 copies/ul from the same RNA sample.

Immunoblot analysis

Drosophila head samples.

For each sample, five adult Drosophila heads were sonicated in SDS sample buffer (50 mM Tris–HCl, ph 6.8, 10% SDS, glycerol, Dithiothreitol (DTT), bromophenol blue); N refers to the number of samples tested. Proteins were separated on a 10% acrylamide gel. Nitrocellulose blots were probed with primary antibodies overnight at room temperature: anti-Kv4/Shal 1:100; anti-dSK 1:100 was verified with the use of a dSK-/- mutant; anti-Kv1/Shaker 1:500 (Abcam, Cambridge, MA) was verified with the Kv1/Shaker Drosophila deficiency; anti-actin (Clone C4, MilliporeSigma, MA) 1:2500; anti-syntaxin 1:50 (Developmental Hybridoma Studies Bank). Anti-Kv4/Shal antibodies were generated as previously described [46, 47]. For mouse brain immunoblots, α-Kv4.2 (gift from Dr. Michael Tamkun, Colorado State University) at 1:500, α-Kv4.3 (Neuromab) at 1:500, and α-mActin (Clone AC-40, Sigma-Aldrich, St. Louis, MO) at 1:1000. Blots were incubated with peroxidase-conjugated secondary antibodies (1:2500; Jackson ImmunoResearch Laboratories) for one hour at room temperature, developed using Supersignal SignalTM West Pico PLUS (Thermo Scientific). Anti-Kv4/Shal, GFP, Kv4.2 and Kv4.3 signal densities were normalized to densities from loading control signals (anti-Actin or anti-Syntaxin) from the same lane.

Mouse brain samples and immunoblot analysis.

Tissue homogenates from noted brain regions from 10 young (6-wk old) and 10 old (8 months old, subsequently aged to 13 months) mice (C57BL/6 from Charles River Laboratories) were obtained from Dr. Robert Handa’s lab (Colorado State University), flash frozen in liquid nitrogen, then stored at -80°C. Prior to each experiment, samples were thawed on ice, protease inhibitors (100X HALT, EDTA free, ThermoFisher Scientific, Waltham, MA) were added to final 1X concentration, and tissue was homogenized using a tissue mincer electric homogenizer. To pellet connective tissue and nuclear material, homogenate was transferred to a 15mL conical vial and spun at 1000x g for 10 minutes at 4°C. Supernatant was then spun at 20,000x g for 15 minutes at 4°C to pellet membrane fraction. Supernatant was removed and pellet re-suspended in 150–300 μL buffer + 1% Triton-X100. Quantification of total protein concentration was performed using the BCA system from Pierce and a UV/Visible spectrophotometer (Model DU730, Beckman Coulter, Brea, CA). Each sample was prepared with 15 μg total protein in 2X SDS-PAGE buffer.

Data collection and statistical analysis for mouse brain comparisons.

Each experiment was performed at least 5 times. Seven young and seven old (total 14) brain extracts were run on each SDS-PAGE gel. Densitometric analysis, as described above, was performed to quantify anti- Kv4.2, Kv4.3 signals, relative to an anti-mActin loading control. A Linear Mixed Effects Model was then used to analyze the effects of age on protein levels of Kv4 proteins across multiple blots and multiple mice; “age” was used as a fixed effect, “Experimental-Immunoblot” was defined as a variable effect which represents the error across experimental procedures, “Mouse-Brain-Section” was another variable that represents the measurable differences of the same Kv4 across different mouse brains. Data was fit to this model using the Maximum Likelihood of the “lmer” function in lme4 package [48] of the R statistical software using RStudio (http://www.rstudio.com), setting REML to FALSE (this option is used when comparing different fixed effects which in this case was age). The p-values were calculated from the fixed effects t-values obtained by the “lmer” function on data as a function of age.

Software syntax for the mathematical expression:

ROS fluorescence detection

1 mM 2’,7’-dichlorodihydrofluorescein diacetate, H2DCFDA (Invitrogen, Walthman, MA) in dimethyl sulfoxide (DMSO; Sigma-Aldrich, St. Louis, MO) was made fresh for each experiment. To calibrate fluorescence gain for each experiment, 1 μL H2DCFDA stock was mixed with 1 pM, 1 nM, 1 μM, or 1 mM H2O2 (Sigma-Aldrich, St. Louis, MO) in separate wells. Samples were prepared by homogenizing 25 heads into 500 μL of sterile filtered buffer (0.4 M Tris-HCL, pH 7.4), centrifuged at 5,000 RPM in a top table centrifuge to pellet chiton. 100 μL samples were loaded into single wells (4 samples per each 500 μL extraction, with at least 5 extractions per experiment) and 1 μL 1 mM DCFDA was added to each well in 96-well plates. Fluorescence Endpoint readings were collected (Synergy H1, BioTek; Excitation 489, Emission: 525); number of extractions, technical replicates, and experimental replicates are indicated in figure legends.

Drosophila locomotor activity assay

35–40 adult males, aged at 25°C for indicated ages, in a 12.4 cm tall tube were allowed to climb upwards for 30 seconds into a second tube inverted on top of the first. The flies that successfully climbed into the second tube were given 30 seconds to climb from the bottom of the tube into a third tube. This process was continued through ten successive tubes and measured by a countercurrent distribution [49]; each fly was given a score of 0.5 for each tube that it climbed out of, similar to previous studies [40, 43]. 10 assays, with ~35–40 naïve flies, were performed for each genotype tested.

Results

Kv4/Shal and Kv1/Shaker protein levels are affected by age

To investigate if age affects Kv4/Shal protein levels, we collected newly-eclosed wild-type male flies (<24 hours old), aged them at 25°C, and assayed steady-state protein levels by immunoblot analysis. We found that Kv4/Shal protein levels dramatically declined, first by ~50% from 3 days to 10 days after eclosion (AE), then more gradually from 10 days to 40 days to levels less than 20% of those in 3-day old flies (Fig 1A). Since other K+ channels have been reported to aggregate with age [27, 50], we investigated if the decline in levels of the expected 52 kD Kv4/Shal subunit might be accompanied by a rise in levels of a higher molecular weight aggregate. When samples were prepared in an SDS sample buffer containing β-mercaptoethanol as a reducing agent, we did see higher molecular weight bands, but they did not appear to increase with age (Fig 1B), suggesting that there was no correlation with an increase in aggregated Kv4 protein. For further confirmation, we used a sample buffer containing dithiothreitol (DTT), a stronger reducing agent. We found that the high molecular weight bands were then solubilized, and that the 52 kD Kv4/Shal band still displayed a progressive age-dependent decline (Fig 1B).

thumbnail
Download:
Fig 1. Kv4/Shal protein levels decline with age, independent of Kv1/Shaker.

Representative immunoblots and quantitative analyses for Kv4/Shal, dSK, and Kv1/Shaker, relative to Actin or Syntaxin (Syn) loading controls, as indicated. (A) Representative immunoblots and quantitative analyses (N = 7) of relative Kv4/Shal levels from wild-type fly heads at indicated days after eclosion. (B) Representative immunoblots of Kv4/Shal levels from fly head homogenates in sample buffers containing either β-mercaptoethanol (top) or the stronger reducing agent, DTT (bottom). (C) Relative levels of dSK protein in wild-type heads from newly-eclosed (<24 hours; 0d) and 40 day old flies (N = 10); dSK-/- null mutant flies were used to verify the anti-dSK antibody. (D) Relative levels of Kv1/Shaker protein assayed from fly heads of wild-type flies aged as indicated (N = 11); Df(Kv1) flies were used to verify the anti-Kv1 antibody. (E) Kv4/Shal protein levels assayed from wild-type (wt) and Df(Kv1) fly heads at 3 and 14 days AE, as indicated (N = 12). (F) Kv1/Shaker protein levels assayed from elav-GAL4>>UAS-DNKv4 (DNKv4) and the UAS-DNKv4 background control (ctrl) fly heads at 3 and 14 days, as indicated (N = 18). For all immunoblots, 5 fly heads per sample, N indicates the number of samples assayed. Shown are mean values +/- SEM; *p<0.05, ** p≤0.01, *** p≤0.001, Student’s t-test.

https://doi.org/10.1371/journal.pone.0261087.g001

This progressive age-dependent decline in Kv4/Shal channel protein did not appear to be a consequence for all potassium channels, as protein levels of the Drosophila calcium-activated small conductance (SK) potassium channel, dSK, were not significantly different between 0 and 40 days (Fig 1C). Due to the scarcity of antibodies against ion channels in Drosophila, we were not able to test other ion channel proteins and cannot rule out the possibility that age may similarly affect other ion channels.

When we examined Kv1/Shaker levels with age, we found that Kv1/Shaker protein levels exhibited a significant increase from 3 days to 10 days AE that returned to basal levels from 20 to 30 days AE (Fig 1D). The transient increase in Kv1/Shaker levels between 3 and 10 days of age is concurrent with the steepest decline in Kv4/Shal levels, consistent with previous studies that have reported an inverse relationship between Kv1/Shaker and Kv4/Shal expression [51, 52]. From 30 to 40 days AE, there was, however, a ~30% decline in Kv1/Shaker protein level, similar to Kv4/Shal. One possibility is that the early decline in Kv4/Shal protein from 3 to 10 days AE is a result of the transient increase in Kv1/Shaker protein from 3 to 10 days AE and its reported reciprocal regulation of Kv4/Shal. To test if Kv1/Shaker is required for the observed decline in Kv4/Shal protein that we observed, we compared relative levels of Kv4/Shal channel protein in a Drosophila line carrying a small deficiency that completely removes the Kv1/Shaker gene (Df(Kv1)). We found, however, that total Kv4/Shal protein levels undergo an age-dependent decline in Df(Kv1) fly heads similar to wild-type (Fig 1E), suggesting that the progressive decline in Kv4/Shal protein does not depend on Kv1/Shaker expression.

Since Kv1/Shaker levels were, conversely, shown to be inversely regulated by Kv4/Shal function [51–53], we also tested whether levels of Kv1/Shaker during this time are dependent on Kv4/Shal function. We used a transgene encoding a dominant-negative Kv4/Shal subunit, DNKv4, under the control of a UAS activation sequence; we have shown that expression of UAS-DNKv4 driven with the pan-neuronal elav-GAL4 transgene results in near-abolishment of the Kv4/Shal current [42, 54]. Indeed, when Kv4/Shal function was inhibited by expression of DNKv4, we found that Kv1/Shaker expression was up-regulated by ~40% and ~30%, in both 3 day and 14 day old flies, respectively (Fig 1F). Thus, the age-related loss of Kv4/Shal channels from 3 to 10 days AE may contribute to the transient up-regulation of Kv1/Shaker expression during this time. The decline in Kv4/Shal protein from 3 to 14 days AE, however, is independent of Kv1/Shaker expression.

Age-related locomotor performance and Kv4/Shal and Kv1/Shaker expression

Our previous studies have shown that Kv4/Shal channels play an important role in repetitive firing and repetitive behaviors [40]. For example, in climbing assays, loss of Kv4/Shal function results in impaired locomotor performance. Here, we show that Kv4/Shal channel protein levels in Drosophila heads decline with age. One possibility is that this decline represents a general decline in Kv4/Shal channel protein in all neurons, including neurons in the brain that contribute indirectly to locomotion, and perhaps even neurons outside the brain that control locomotion directly (eg. motor neurons or central pattern generator neurons in the ventral nerve cord). To begin, we examined whether there is an age-dependent decline in locomotor performance in wild-type flies. Wild-type flies aged at 25°C for 3 to 60 days AE were subjected to countercurrent climbing assays in groups of 35–40 male flies per group; they were scored for their ability to climb against gravity through 10 successive tubes (see Materials and methods). Indeed, wild-type flies exhibited a progressive decline in locomotor performance with age (Fig 2A), a phenomenon conserved across species. From 3 to 10 days AE, however, there was no significant decline in motor performance (Fig 2A), suggesting that the sharp initial decline in Kv4/Shal protein and transient increase in Kv1/Shaker protein, in the brain, do not affect locomotion. Locomotor performance showed an initial decline at 30 days AE, and this decline continued to 60 days AE (Fig 2A). Since Kv4/Shal and Kv1/Shaker protein levels both showed a significant, albeit more gradual, decline after 30 days (Fig 1A), we set out to genetically restore Kv4/Shal or Kv1/Shaker levels in aging flies and examine if consequent locomotor performance was improved. We first used the elav-GAL4 transgene to drive expression of UAS-Kv4/Shal throughout the nervous system (these flies are referred to as elav-GAL4>>UAS-Kv4/Shal), and verified that elav-GAL4>>UAS-Kv4/Shal flies displayed an increase in total Kv4/Shal protein (Fig 2B). We then compared the locomotor performance of elav-GAL4>>UAS-Kv4/Shal flies to age-matched genetic background control lines. We found that over-expression of Kv4/Shal significantly improved locomotor performance not only at 30–50 days AE, but at every age, except at 60 days AE (Fig 2C). These results do not definitively show that the progressive decline in Kv4/Shal protein underlies the age-related decline in locomotor performance, as there is still an decline over time even when Kv4/Shal levels are raised. Our results do, however, suggest that the inability to maintain higher levels of Kv4/Shal with age is a likely contributor. While the decline in Kv1/Shaker protein from 30 to 40 days AE (Fig 1D) does correlate rather well with the age-related decline in locomotor performance (Fig 2A), over-expression of Kv1/Shaker did not rescue locomotor performance, but conversely, had a negative impact at every age (Fig 2D). These results suggest that the age-related decline in Kv1/Shaker observed at 40 days AE is not likely to be a significant contributing factor of the decline in locomotor function.

thumbnail
Download:
Fig 2. Age-related decline in locomotor performance improved by over-expression of Kv4/Shal.

(A) Locomotor performance scored from climbing assays performed, as described in text, on male wild-type flies aged at 25°C for indicated days. (B) Representative immunoblots and quantitative analyses for Kv4/Shal protein in heads from elav-GAL4>>UAS-Kv4 (Kv4) and the UAS-Kv4 background control (ctrl) flies aged 3 days (N = 20). (C) Locomotor performance scored from climbing assays performed on genetic background control lines, elav-GAL4 (ctrl1) and UAS-Kv4/Shal (ctrl2), and elav>>UAS-Kv4/Shal (Kv4); flies were aged at 25°C for the indicated days. (D) Locomotor performance scored from climbing assays performed on male UAS-Kv1/Shaker (ctrl) and elav-GAL4>>UAS-Kv1/Shaker (Kv1); flies were aged at 25°C for the indicated days. For all assays, 35–40 flies per group, N = 10 groups per genotype were tested for each time point, shown are mean values +/- SEM; *p<0.05, ** p≤0.01, *** p≤0.001, Student’s t-test.

https://doi.org/10.1371/journal.pone.0261087.g002

Reactive oxygen species negatively affect Kv4/Shal protein levels, and the age-dependent decline in Kv4/Shal levels are ameliorated by over-expression of catalase

Kv4/Shal protein levels showed a continual decline even after 30 days AE into the very aged fly. One possible underlying factor may be the accumulation of reactive oxygen species (ROS) with age. We first tested whether acute exposure of flies to ROS could affect Kv4/Shal protein levels. We incubated groups of 30–35 wild-type flies (2–3 days AE) in scintillation vials containing a piece of filter paper saturated with 100 μL of either water or 30% (8.82 M) H2O2. After 4 hours, flies were transferred to regular food vials for recovery. We found that in flies exposed to H2O2, Kv4/Shal levels were lowered by ~20% (Fig 3A), suggesting that Kv4/Shal protein levels are potentially susceptible to ROS.

thumbnail
Download:
Fig 3. Kv4/Shal protein levels reduced by ROS and ameliorated by over-expression of catalase in older flies.

(A) Acute exposure to hydrogen peroxide (H2O2) leads to decreased Kv4/Shal protein levels. Top, cartoon depicting incubation of Drosophila in a closed scintillation vial with a paper filter containing 100 μL H2O2, followed by recovery in regular food vial at room temperature. Bottom, Representative immunoblots and quantitative analyses of Kv4/Shal protein levels, normalized to an anti-Actin loading control, in wild-type flies incubated with either water (ctrl) or H2O2 for 4 hours followed by 24 hours recovery (N = 15). (B-C) Representative immunoblots and quantitative analyses of relative Kv4/Shal protein levels, normalized to an anti-Actin loading control, in heads from UAS-SOD1 (Left, ctrl), elav-GAL4>>UAS-SOD1 (Left, SOD1), UAS-SOD2 (Middle, ctrl), elav-GAL4>>UAS-SOD2 (Middle, SOD2), UAS-Catalase (Right, ctrl), elav-GAL4>>UAS-Catalase (Right, Cat) flies aged at 25°C for either 20 days (B) or 40 days (C). N = 18 samples/genotype and condition. For all immunoblots, 5 heads/sample, N represents the number of samples. Shown are mean values +/- SEM; *p<0.05, ** p≤0.01, *** p≤0.001, Student’s t-test.

https://doi.org/10.1371/journal.pone.0261087.g003

To reduce ROS in the aging fly, we over-expressed enzymes well known to reduce ROS in vivo. Superoxide dismutase (SOD) 1 and 2, and Catalase actively participate in down-regulating the toxic accumulation of ROS in aging cells. SOD converts superoxide anions to H2O2, while Catalase converts H2O2 to H2O and O2. We tested whether overexpression of SOD1, SOD2, or Catalase would exacerbate or ameliorate the loss Kv4/Shal protein with age. We used elav-GAL4 to over-express UAS-SOD1, UAS-SOD2, or UAS-Catalase in neurons, then assayed levels of Kv4/Shal protein in 20-day old and 40-day old flies. At 20 days AE, no significant change in Kv4/Shal protein levels were observed with over-expression of any of these enzymes compared to age-matched background control lines (Fig 3B). At 40 days AE, no significant difference in Kv4/Shal levels was observed with either over-expression of SOD1 or SOD2. Over-expression of Catalase, however, significantly increased levels of Kv4/Shal by ~30 and ~60% when compared to elav-GAL4 and UAS-Catalase background control lines, respectively (Fig 3C). The effect of Catalase, but not SOD1/2, suggests that Kv4/Shal may be more susceptible to H2O2 than superoxide anions.

Because Catalase expression attenuated the loss of Kv4/Shal protein at 40 days AE, we tested if in vivo levels of ROS are enhanced at 40 days, and if over-expression of Catalase does indeed decrease levels of ROS. We used 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA), a ROS sensitive DCFDA compound, to detect ROS in fly head homogenates by spectrofluorimetry. Wild-type flies showed a small but significant increase in detectable ROS at 40 days AE compared to 3 days AE (Fig 4A); this small but significant increase in ROS is similar to the previously reported increase ROS at 50 days [6]. We then assayed for ROS levels in elav-GAL4>>UAS-Catalase flies at 40 days AE, and found that ROS levels were indeed reduced by ~20% and ~50% when compared to elav-GAL4 and UAS-Catalase background controls, respectively (Fig 4B). Together, our data suggest that at 40 days AE, ROS levels are normally elevated, and that over-expression of Catalase results in a reduction in ROS as well as an increase in Kv4/Shal protein. Since over-expression of Catalase raises Kv4/Shal levels, we tested if over-expression of Catalase would also result in improved locomotor performance. We performed climbing assays on 40-day old elav-GAL4>>UAS-Catalase and background control lines. We found that, indeed, locomotor performance was improved by ~32% when Catalase was over-expressed (Fig 4C). To further investigate the possibility that ROS may contribute to the age-dependent decline in Kv4/Shal protein and locomotor dysfunction, we tested if the ROS-generating enzyme, Nicotinamide Adenine Dinucleotide Phosphate (NADPH) Oxidase (NOX), might also affect levels of Kv4/Shal protein. There is only a single NOX gene in the Drosophila genome and we used a UAS-NOX-RNAi transgene to knockdown expression of NOX. This UAS-NOX-RNAi line has been reported to knock-down NOX expression ~60% [55], has been extensively used in the field [56–59], and has been shown to result in blocking a rise in ROS levels when induced in various tissues by various means [56, 59, 60]. We used elav-GAL4,UAS-Dcr2 to drive expression of UAS-NOX-RNAi to knockdown expression of NOX in the nervous system. We then measured levels of Kv4/Shal protein in 40 day old flies. We found that knockdown of NOX resulted in ~40% more Kv4/Shal protein, compared to age-matched control lines (Fig 4D). Our results suggest that decreasing ROS levels in the aging fly, by either over-expressing Catalase or inhibiting expression of NOX, attenuates the loss of Kv4/Shal protein.

thumbnail
Download:
Fig 4. 40-day old flies exhibit elevated ROS levels that contribute to impaired locomotion and reduced Kv4/Shal levels.

(A) ROS detected using H2DCFDA, a ROS sensitive DCFDA compound, in fly head homogenates by spectrofluorimetry from wild-type flies aged 3 or 40 days at 25°C. 25 heads/extraction, 5 extractions per experiment with 4 technical replicates each; total of 3 experiments were performed. (B) ROS similarly detected, as in (A), in fly head homogenates from elav-GAL4 (ctrl1), elav-GAL4>>UAS-Catalase (Cat), and UAS-Catalase (ctrl2) at 40 days AE. 25 heads/extraction, 5 extractions per experiment with 4 technical replicates each; total of 3 experiments were performed. (C) Locomotor performance scored from climbing assays performed on male UAS-Catalase (ctrl) and elav-GAL4>>UAS-Catalase (Cat) flies at 40 days AE; 35–40 flies/group, N = 10 groups for each genotype. (D) Representative immunoblots and quantitative analysis for Kv4/Shal relative to anti-Actin as a loading control in heads from 40-day old UAS-NOX-RNAi (ctrl) and elav-GAL4>>UAS-NOX-RNAi (NOX-RNAi) flies; N = 26. For all immunoblots, 5 heads/sample, N represents the number of samples. Shown are mean values +/- SEM; *p<0.05, ** p≤0.01, *** p≤0.001, Student’s t-test.

https://doi.org/10.1371/journal.pone.0261087.g004

Age-dependent decline in Kv4/Shal mRNA

One possibility is that ROS somehow, directly or indirectly, affect levels of Kv4/Shal protein. In some cases, ROS have been shown to oxidize protein residues, thereby affecting protein stability, aggregation, and/or degradation. If Kv4/Shal protein is directly affected by ROS, we reasoned that Kv4/Shal protein expressed from a transgene would also be affected by age. We used elav-GAL4 to drive expression of UAS-GFP-Kv4/Shal pan-neuronally, collected newly-eclosed flies and aged them at 25°C. We then compared steady-state GFP-Kv4/Shal protein levels at 3, 14, and 25 days AE. In contrast to endogenous Kv4/Shal levels, we found no significant decline in GFP-Kv4/Shal protein levels from 3 to 25 days (Fig 5A), suggesting that the age-dependent decline in Kv4/Shal protein does not occur as a result of the protein being targeted for degradation.

thumbnail
Download:
Fig 5. Age-related decline in Kv4/Shal mRNA, but not GFP-Kv4/Shal protein.

(A) Representative immunoblots and quantitative analysis of GPF-Kv4/Shal expression from wild-type flies aged 3, 14, and 25 days, normalized to an anti-Actin loading control (N = 43–44). No significant downward trend was observed with age. (B) Digital droplet quantitative PCR was performed for relative Kv4/Shal levels, normalized to levels of the RpS20 reference gene, from wild-type flies aged 3, 10, and 40 days. For immunoblot analysis, 5 heads/sample, N represents the number of samples. Shown are mean values +/- SEM; *p<0.05, ** p≤0.01, *** p≤0.001, Student’s t-test.

https://doi.org/10.1371/journal.pone.0261087.g005

ROS have also been reported to affect gene expression by damaging nucleic acids. To examine if mRNA levels of Kv4/Shal were affected with age, we performed Digital Droplet PCR to quantify mRNA levels in wild-type heads at 3, 10, and 40 days AE. We found that the number of copies of Kv4/Shal mRNA was progressively reduced, by ~30% at 10 days and ~60% at 40 days, relative to levels at 3 days AE (Fig 5B). These results suggest that the age-dependent decline in total Kv4/Shal protein is at least partially due to a progressive decline in Kv4/Shal mRNA. Future studies will need to examine whether there is any specificity to this effect.

Mouse Kv4.2 and Kv4.3 are differentially affected by age in select brain regions

Kv4/Shal channels are highly conserved, with 84% amino acid identity between Drosophila and mouse/human (eg. sequence alignment with mouse Kv4.1 (NP_032449.1), Kv4.2 (NP_062671.1), Kv4.3 (NP_001034436), or human Kv4.2 (NP_036413.1); [30]). As such, we set out to examine if age also affects levels of Kv4 channel proteins in the mouse brain. We measured steady-state levels of Kv4.2 and Kv4.3 in different brain regions, including the hippocampus, olfactory bulb, cerebellum, and motor cortex, where they have been shown to play important roles in neuronal signaling [61–65]. We examined these brain regions in 14 mice: seven at 6 weeks of age and seven at 13 months of age. Anti-Kv4.2 and Kv4.3 signals relative to a loading control protein were normalized to the young samples, then compared across multiple immunoblots using Linear Mixed Model (LMM) statistical analysis to account for multiple mice at two different ages, across multiple blots. We found that Kv4.2 and Kv4.3 were differentially affected by age in various brain regions. For example, from 6 weeks to 13 months, Kv4.3 exhibited a ~30–50% increase in the hippocampus, cerebellum, and motor cortex, while Kv4.2 exhibited a ~20% reduction in the hippocampus (Fig 6). While there was no unified down-regulation of Kv4.2/4.3 with age that paralleled what we report in Drosophila, such a survey of changes in Kv4.2 and Kv4.3 in the mouse brain, to our knowledge, has not been reported previously and may be informative for future studies examining their contribution to changes in cognitive and motor function that occur with age.

thumbnail
Download:
Fig 6. Differential effects of age on mouse Kv4.2 and Kv4.3 in various brain regions.

Representative immunoblots and quantitative analysis, as described in the text, for Kv4.2 and Kv4.3 protein in tissue homogenates from seven 6-wk old mice and seven 13-month old mice; tissue homogenates are from the (A) hippocampus (hippo), (B) olfactory bulb (olf bulb), (C) cerebellum (cereb), and (D) motor cortex (motor cx). Black bars represent 6-week (6wk) old mice and grey bars represent 13-month (1yr) old mice. 15 μg total protein per sample was loaded into each SDS-PAGE well (N = 35 samples, across 5 blots, for each brain at each age). Top graphs, shown are mean values +/- SEM across 7 brains; Bottom graphs, shown are mean values +/- SEM from individual brains; *p<0.05, ** p≤0.01, Linear Mixed Model statistical analysis (see Materials and methods).

https://doi.org/10.1371/journal.pone.0261087.g006

Discussion

Physiological effects associated with aging and age-related diseases, such as a decline in motor and cognitive function, are undoubtedly due to a multitude of factors. Here, we report that in Drosophila, Kv4/Shal levels sharply decline from 3 to 10 days AE, then continue a more gradual and progressive decline from 10 to 40 days AE. In contrast, Kv1/Shaker protein exhibits a transient increase at 10 days AE, that then remains relatively stable until an eventual decline at 40 days AE. It should be noted that 40 days AE is still considered middle-aged in a lifespan of laboratory raised flies that can reach 80 days [66]. As such, these changes in Kv4/Shal and Kv1/Shaker levels in the young to middle-aged fly are likely to have physiologically relevant functional consequences. For example, Kv4/Shal studies in Drosophila have shown that loss of Kv4/Shal channels leads to increased neuronal excitability with faster response times to action potential (AP) firing, increased AP firing rates, enhanced synaptic currents, and altered synaptic plasticity mechanisms [41, 42, 54]. Behaviorally, loss of Kv4/Shal function leads to loss of normal coordination in repetitive behaviors, such as locomotion and grooming, significantly reduced performance in olfactory-associative learning tasks, and a shortened lifespan [54].

In this study, we show an age-dependent deterioration in locomotor performance. Interestingly, genetic over-expression of Kv4/Shal, but not Kv1/Shaker, improved locomotor performance. This relationship, however, is complicated and much remains to be understood. For example, the sharpest decline in Kv4/Shal protein occurs from 3 to 10 days AE, yet there was no deterioration in locomotor performance until 30 days AE. It is possible that locomotor performance is quite robust and is only affected after Kv4/Shal protein levels decline below some threshold. At 40 days AE, Kv1/Shaker levels are also significantly reduced, and perhaps the combinatorial loss of both channel proteins adversely affects performance. Also interesting is the finding that even though over-expression of Kv1/Shaker appeared to negatively affect locomotion, the transient increase in Kv1/Shaker at 10 days does not seem to change locomotor performance. Future studies will need to address why locomotor performance at younger ages (3–10 days) remains stable in the face of changing Kv1/Shaker and Kv4/Shal levels. It is also possible that changes in Kv1 and Kv4 protein levels are entirely different in the ventral nerve cord, where motor neurons and central pattern generator neurons are localized and contribute most directly to locomotion, and future studies may reveal differential, neuron-specific, effects of age on channel expression levels.

In a previous study, we reported that Kv4/Shal channel levels also progressive decline in a Drosophila model of Alzheimer’s Disease (AD) [43]. Mammalian AD models have similarly suggested a decrement in Kv4 currents/channels [67, 68]. Loss of Kv4/Shal protein in the Drosophila AD model led to neuronal hyperexcitability that contributed to a decline in cognitive and motor function, as well as neuronal degeneration, when compared to age-matched background lines [43]. Early increases in neuronal excitability have been observed in other AD models as well [69–76], and early hyperactivity has been suggested to contribute to downstream synaptic silencing [77] and neurodegeneration [78, 79]. It is intriguing that Kv4/Shal channel levels are also affected by age in wild-type flies, as reported here. One speculation is that age-affected proteins, such as Kv4/Shal, are especially susceptible in backgrounds prone to AD, and perhaps other age-related neurodegenerative diseases.

Understanding the mechanism(s) underlying the age-dependent loss of Kv4/Shal protein may give important insight into not only how Kv4/Shal protein is targeted under normal aging conditions, but also how it becomes a target in AD and perhaps other neuropathological conditions. We show that protein levels of GFP-Kv4/Shal expressed from a transgene are stable and not affected by age. Additionally, we show that there is an age-dependent decline in Kv4/Shal mRNA levels. These data suggest that relevant age-dependent pathway(s) may be affecting Kv4/Shal expression prior to protein translation. Future studies will need to investigate this possibility.

We also suggest a possible role for ROS, which are well known to accumulate both with age and AD. ROS have been shown to have a multitude of effects on proteins as well as nucleic acids [25, 80–82]. At 40 days AE, we found that ROS levels were elevated by a small but significant amount in fly heads, similar to a previous report [6]. At this age, we also found that over-expression of Catalase or down-regulation of NOX was sufficient to raise protein levels of Kv4/Shal. Surprisingly, over-expression of SOD1/2 did not. One possibility is that there was not high enough expression of SOD1/2. Another possibility is that H2O2 in particular, is a key contributor to the reduction in Kv4/Shal expression and since Catalase is known to catalyze H2O2 into water and oxygen, over-expression of Catalase was the only enzyme that attenuated the loss of Kv4/Shal protein. Consistent with the hypothesis that Kv4/Shal is sensitive to H2O2, we also show that acute exposure of young flies to H2O2 was sufficient to reduce Kv4/Shal protein levels. It is not clear, however, that this decline occurs by the same pathway as during aging. Another complication is that Kv4/Shal levels decline the most dramatically from 3 to 10 days AE, when ROS levels are not significantly elevated. One possibility is that ROS are a contributing mechanism only to the later more gradual decline in Kv4/Shal observed, while the earlier decline in Kv4/Shal is mediated by a different mechanism. Another, not mutually exclusive, possibility is that local microdomains of elevated ROS levels may function in a more targeted mechanism of regulation; more sophisticated approaches are needed to investigate this possibility. It also remains unclear whether the effect of ROS is specific to Kv4/Shal channel expression or if ROS also affects the expression of other ion channels during aging. Future studies should also investigate whether ROS-mediated mechanisms are physiologically employed to regulate Kv4/Shal channel expression in young neurons/flies.

In this study, we also take a first-pass survey at whether Kv4.2 and Kv4.3 protein levels are affected in different regions of the aging murine brain. From 6 weeks to 13 months, we found that Kv4.2 and Kv4.3 levels exhibit age-dependent up- and down-regulation in various regions of the brain. Interestingly, Kv4.2 only exhibited an age-related decline in the hippocampus. In contrast, Kv4.3 exhibited only age-dependent increases that were observed in multiple brain regions, including the hippocampus, cerebellum, and motor cortex. Finer dissection of these brain regions will reveal more precisely where these differential regulatory events occur; for example, a previous report has suggested that Kv4.2 and Kv4.3 are up-regulated in CA3 pyramidal neurons of the hippocampus [22].

In this study, we examined Kv4/Shal protein levels from whole Drosophila heads, in which large neuronal populations include the Kenyon cells of the mushroom bodies, neurons of the optic lobe, and photoreceptor cells. It is unclear whether the decline in Kv4/Shal protein we observed occurs similarly across all of these populations, or preferentially in particular neuronal populations. Future studies may reveal age-dependent changes in Kv4/Shal and Kv1/Shaker expression that are specific to particular brain structures, and results from such studies would greatly aid in identifying the functional consequences of age-related changes.

Supporting information

S1 Raw images. Uncropped blot images for the indicated figures.

https://doi.org/10.1371/journal.pone.0261087.s001

(DOCX)

Acknowledgments

We thank Drs. Patrick Dolph, William Joiner, Kyunghee Koh, and Mattias Landgraf for fly lines and reagents. We also thank Drs. Mario G. Oyola and Robert J. Handa for their assistance in processing the mouse tissue.

References

  1. 1. Ingram DK. Age-related decline in physical activity: generalization to nonhumans. Med Sci Sports Exerc. 2000;32(9):1623–9. Epub 2000/09/20. pmid:10994915.
  2. 2. Liu J, Zhang B, Lei H, Feng Z, Liu J, Hsu AL, et al. Functional aging in the nervous system contributes to age-dependent motor activity decline in C. elegans. Cell Metab. 2013;18(3):392–402. Epub 2013/09/10. pmid:24011074.
  3. 3. Jones MA, Grotewiel M. Drosophila as a model for age-related impairment in locomotor and other behaviors. Exp Gerontol. 2011;46(5):320–5. Epub 2010/08/31. pmid:20800672.
  4. 4. Iliadi KG, Boulianne GL. Age-related behavioral changes in Drosophila. Ann N Y Acad Sci. 2010;1197:9–18. Epub 2010/06/12. pmid:20536827.
  5. 5. Horiuchi J, Saitoe M. Can flies shed light on our own age-related memory impairment? Ageing Res Rev. 2005;4(1):83–101. Epub 2004/12/28. pmid:15619472.
  6. 6. Haddadi M, Jahromi SR, Sagar BK, Patil RK, Shivanandappa T, Ramesh SR. Brain aging, memory impairment and oxidative stress: a study in Drosophila melanogaster. Behav Brain Res. 2014;259:60–9. pmid:24183945.
  7. 7. Lu T, Pan Y, Kao SY, Li C, Kohane I, Chan J, et al. Gene regulation and DNA damage in the ageing human brain. Nature. 2004;429(6994):883–91. Epub 2004/06/11. pmid:15190254.
  8. 8. Bahr BA, Godshall AC, Hall RA, Lynch G. Mouse telencephalon exhibits an age-related decrease in glutamate (AMPA) receptors but no change in nerve terminal markers. Brain Res. 1992;589(2):320–6. Epub 1992/09/04. pmid:1327416.
  9. 9. Nicoletti VG, Condorelli DF, Dell’Albani P, Ragusa N, Giuffrida Stella AM. AMPA-selective glutamate receptor subunits in the rat hippocampus during aging. J Neurosci Res. 1995;40(2):220–4. Epub 1995/02/01. pmid:7538168.
  10. 10. Magnusson KR, Cotman CW. Age-related changes in excitatory amino acid receptors in two mouse strains. Neurobiology of aging. 1993;14(3):197–206. Epub 1993/05/01. pmid:8391661.
  11. 11. Magnusson KR, Nelson SE, Young AB. Age-related changes in the protein expression of subunits of the NMDA receptor. Brain Res Mol Brain Res. 2002;99(1):40–5. Epub 2002/03/01. pmid:11869807.
  12. 12. Clayton DA, Browning MD. Deficits in the expression of the NR2B subunit in the hippocampus of aged Fisher 344 rats. Neurobiology of aging. 2001;22(1):165–8. Epub 2001/02/13. pmid:11164294.
  13. 13. Clayton DA, Mesches MH, Alvarez E, Bickford PC, Browning MD. A hippocampal NR2B deficit can mimic age-related changes in long-term potentiation and spatial learning in the Fischer 344 rat. J Neurosci. 2002;22(9):3628–37. Epub 2002/04/30. pmid:11978838.
  14. 14. Wenk GL, Walker LC, Price DL, Cork LC. Loss of NMDA, but not GABA-A, binding in the brains of aged rats and monkeys. Neurobiology of aging. 1991;12(2):93–8. Epub 1991/03/01. pmid:1646968.
  15. 15. Henley JM, Wilkinson KA. AMPA receptor trafficking and the mechanisms underlying synaptic plasticity and cognitive aging. Dialogues Clin Neurosci. 2013;15(1):11–27. Epub 2013/04/12. pmid:23576886.
  16. 16. Adams MM, Smith TD, Moga D, Gallagher M, Wang Y, Wolfe BB, et al. Hippocampal dependent learning ability correlates with N-methyl-D-aspartate (NMDA) receptor levels in CA3 neurons of young and aged rats. J Comp Neurol. 2001;432(2):230–43. Epub 2001/03/10. pmid:11241388.
  17. 17. Ossowska K, Wolfarth S, Schulze G, Wardas J, Pietraszek M, Lorenc-Koci E, et al. Decline in motor functions in aging is related to the loss of NMDA receptors. Brain Res. 2001;907(1–2):71–83. Epub 2001/06/30. pmid:11430887.
  18. 18. Gutierrez A, Khan ZU, Miralles CP, De Blas AL. Altered expression of gamma 2L and gamma 2S GABAA receptor subunits in the aging rat brain. Brain Res Mol Brain Res. 1996;35(1–2):91–102. Epub 1996/01/01. pmid:8717344.
  19. 19. Gutierrez A, Khan ZU, Miralles CP, Mehta AK, Ruano D, Araujo F, et al. GABAA receptor subunit expression changes in the rat cerebellum and cerebral cortex during aging. Brain Res Mol Brain Res. 1997;45(1):59–70. Epub 1997/04/01. pmid:9105671.
  20. 20. Jung DK, Lee SY, Kim D, Joo KM, Cha CI, Yang HS, et al. Age-related changes in the distribution of Kv1.1 and Kv3.1 in rat cochlear nuclei. Neurological research. 2005;27(4):436–40. Epub 2005/06/14. pmid:15949244.
  21. 21. Chung YH, Shin CM, Kim MJ, Lee BK, Cha CI. Age-related changes in the distribution of Kv1.1 and Kv1.2 channel subunits in the rat cerebellum. Brain Res. 2001;897(1–2):193–8. Epub 2001/04/03. pmid:11282376.
  22. 22. Simkin D, Hattori S, Ybarra N, Musial TF, Buss EW, Richter H, et al. Aging-Related Hyperexcitability in CA3 Pyramidal Neurons Is Mediated by Enhanced A-Type K+ Channel Function and Expression. J Neurosci. 2015;35(38):13206–18. Epub 2015/09/25. pmid:26400949.
  23. 23. Lee CK, Weindruch R, Prolla TA. Gene-expression profile of the ageing brain in mice. Nat Genet. 2000;25(3):294–7. Epub 2000/07/11. pmid:10888876.
  24. 24. Carney JM, Starke-Reed PE, Oliver CN, Landum RW, Cheng MS, Wu JF, et al. Reversal of age-related increase in brain protein oxidation, decrease in enzyme activity, and loss in temporal and spatial memory by chronic administration of the spin-trapping compound N-tert-butyl-alpha-phenylnitrone. Proc Natl Acad Sci U S A. 1991;88(9):3633–6. Epub 1991/05/01. pmid:1673789
  25. 25. Stadtman ER, Berlett BS. Reactive oxygen-mediated protein oxidation in aging and disease. Chem Res Toxicol. 1997;10(5):485–94. Epub 1997/05/01. pmid:9168245
  26. 26. Wei Y, Shin MR, Sesti F. Oxidation of KCNB1 channels in the human brain and in mouse model of Alzheimer’s disease. Cell Death Dis. 2018;9(8):820. Epub 2018/07/28. pmid:30050035.
  27. 27. Cotella D, Hernandez-Enriquez B, Wu X, Li R, Pan Z, Leveille J, et al. Toxic role of K+ channel oxidation in mammalian brain. J Neurosci. 2012;32(12):4133–44. Epub 2012/03/24. pmid:22442077.
  28. 28. Frazzini V, Guarnieri S, Bomba M, Navarra R, Morabito C, Mariggio MA, et al. Altered Kv2.1 functioning promotes increased excitability in hippocampal neurons of an Alzheimer’s disease mouse model. Cell Death Dis. 2016;7:e2100. Epub 2016/02/20. pmid:26890139.
  29. 29. Yu W, Zhang H, Shin MR, Sesti F. Oxidation of KCNB1 potassium channels in the murine brain during aging is associated with cognitive impairment. Biochem Biophys Res Commun. 2019;512(4):665–9. Epub 2019/03/30. pmid:30922570.
  30. 30. Pak MD, Baker K, Covarrubias M, Butler A, Ratcliffe A, Salkoff L. mShal, a subfamily of A-type K+ channel cloned from mammalian brain. Proc Natl Acad Sci U S A. 1991;88(10):4386–90. pmid:2034678
  31. 31. Jegla T, Salkoff L. A novel subunit for shal K+ channels radically alters activation and inactivation. J Neurosci. 1997;17(1):32–44. pmid:8987734.
  32. 32. Tsunoda S, Salkoff L. Genetic analysis of Drosophila neurons: Shal, Shaw, and Shab encode most embryonic potassium currents. Journal of Neuroscience. 1995a;15(3):1741–54.
  33. 33. Fawcett GL, Santi CM, Butler A, Harris T, Covarrubias M, Salkoff L. Mutant analysis of the Shal (Kv4) voltage-gated fast transient K+ channel in Caenorhabditis elegans. J Biol Chem. 2006;281(41):30725–35. pmid:16899454.
  34. 34. Ramakers GM, Storm JF. A postsynaptic transient K(+) current modulated by arachidonic acid regulates synaptic integration and threshold for LTP induction in hippocampal pyramidal cells. Proc Natl Acad Sci U S A. 2002;99(15):10144–9. pmid:12114547.
  35. 35. Kim J, Jung SC, Clemens AM, Petralia RS, Hoffman DA. Regulation of dendritic excitability by activity-dependent trafficking of the A-type K+ channel subunit Kv4.2 in hippocampal neurons. Neuron. 2007;54(6):933–47. pmid:17582333.
  36. 36. Kim J, Wei DS, Hoffman DA. Kv4 potassium channel subunits control action potential repolarization and frequency-dependent broadening in rat hippocampal CA1 pyramidal neurones. J Physiol. 2005;569(Pt 1):41–57. pmid:16141270.
  37. 37. Cai X, Liang CW, Muralidharan S, Kao JP, Tang CM, Thompson SM. Unique roles of SK and Kv4.2 potassium channels in dendritic integration. Neuron. 2004;44(2):351–64. pmid:15473972.
  38. 38. Chen X, Yuan LL, Zhao C, Birnbaum SG, Frick A, Jung WE, et al. Deletion of Kv4.2 gene eliminates dendritic A-type K+ current and enhances induction of long-term potentiation in hippocampal CA1 pyramidal neurons. J Neurosci. 2006;26(47):12143–51. pmid:17122039.
  39. 39. Jung SC, Hoffman DA. Biphasic somatic A-type K channel downregulation mediates intrinsic plasticity in hippocampal CA1 pyramidal neurons. PLoS One. 2009;4(8):e6549. pmid:19662093.
  40. 40. Ping Y, Waro G, Licursi A, Smith S, Vo-Ba DA, Tsunoda S. Shal/K(v)4 channels are required for maintaining excitability during repetitive firing and normal locomotion in Drosophila. PLoS One. 2011a;6(1):e16043. pmid:21264215.
  41. 41. Eadaim A, Hahm ET, Justice ED, Tsunoda S. Cholinergic Synaptic Homeostasis Is Tuned by an NFAT-Mediated alpha7 nAChR-Kv4/Shal Coupled Regulatory System. Cell reports. 2020;32(10):108119. Epub 2020/09/10. pmid:32905767.
  42. 42. Ping Y, Tsunoda S. Inactivity-induced increase in nAChRs upregulates Shal K(+) channels to stabilize synaptic potentials. Nat Neurosci. 2011;15(1):90–7. Epub 2011/11/15. pmid:22081160.
  43. 43. Ping Y, Hahm ET, Waro G, Song Q, Vo-Ba DA, Licursi A, et al. Linking abeta42-induced hyperexcitability to neurodegeneration, learning and motor deficits, and a shorter lifespan in an Alzheimer’s model. PLoS genetics. 2015;11(3):e1005025. pmid:25774758.
  44. 44. Abou Tayoun AN, Li X, Chu B, Hardie RC, Juusola M, Dolph PJ. The Drosophila SK channel (dSK) contributes to photoreceptor performance by mediating sensitivity control at the first visual network. J Neurosci. 2011;31(39):13897–910. Epub 2011/10/01. pmid:21957252.
  45. 45. Wu MN, Joiner WJ, Dean T, Yue Z, Smith CJ, Chen D, et al. SLEEPLESS, a Ly-6/neurotoxin family member, regulates the levels, localization and activity of Shaker. Nat Neurosci. 2010;13(1):69–75. Epub 2009/12/17. pmid:20010822.
  46. 46. Diao F, Chaufty J, Waro G, Tsunoda S. SIDL Interacts with the Dendritic Targeting Motif of Shal (Kv4) K+ Channels in Drosophila. Molecular and Cellular Neuroscience. 2010;45(1):75–83. pmid:20550966
  47. 47. Diao F, Waro G, Tsunoda S. Fast inactivation of Shal (K(v)4) K+ channels is regulated by the novel interactor SKIP3 in Drosophila neurons. Mol Cell Neurosci. 2009;42(1):33–44. pmid:19463952.
  48. 48. Bates D, Maechler M, Bolker B, Walker S. Fitting Linear Mixed-Effects Models Using lme4. J Stat Softw. 2015;67:1–48.
  49. 49. Benzer S. Behavioral mutants of Drosophila isolated by countercurrent distribution. Proceedings of the National Academy of Sciences of the United States of America. 1967;58:1112–9. pmid:16578662
  50. 50. Cai SQ, Sesti F. Oxidation of a potassium channel causes progressive sensory function loss during aging. Nat Neurosci. 2009;12(5):611–7. Epub 2009/03/31. pmid:19330004.
  51. 51. Bergquist S, Dickman DK, Davis GW. A hierarchy of cell intrinsic and target-derived homeostatic signaling. Neuron. 2010;66(2):220–34. pmid:20434999.
  52. 52. Parrish JZ, Kim CC, Tang L, Bergquist S, Wang T, Derisi JL, et al. Kruppel mediates the selective rebalancing of ion channel expression. Neuron. 2014;82(3):537–44. Epub 2014/05/09. pmid:24811378.
  53. 53. Kulik Y, Jones R, Moughamian AJ, Whippen J, Davis GW. Dual separable feedback systems govern firing rate homeostasis. Elife. 2019;8. Epub 2019/04/12. pmid:30973325.
  54. 54. Ping Y, Waro G, Licursi A, Smith S, Vo-Ba DA, Tsunoda S. Shal/K(v)4 channels are required for maintaining excitability during repetitive firing and normal locomotion in Drosophila. PLoS One. 2011;6(1):e16043. Epub 2011/01/26. pmid:21264215.
  55. 55. Ha EM, Oh CT, Bae YS, Lee WJ. A direct role for dual oxidase in Drosophila gut immunity. Science. 2005;310(5749):847–50. Epub 2005/11/08. pmid:16272120.
  56. 56. Li W, Young JF, Sun J. NADPH oxidase-generated reactive oxygen species in mature follicles are essential for Drosophila ovulation. Proc Natl Acad Sci U S A. 2018;115(30):7765–70. Epub 2018/07/11. pmid:29987037.
  57. 57. Tzou FY, Su TY, Lin WS, Kuo HC, Yu YL, Yeh YH, et al. Dihydroceramide desaturase regulates the compartmentalization of Rac1 for neuronal oxidative stress. Cell reports. 2021;35(2):108972. Epub 2021/04/15. pmid:33852856.
  58. 58. Lang S, Hilsabeck TA, Wilson KA, Sharma A, Bose N, Brackman DJ, et al. A conserved role of the insulin-like signaling pathway in diet-dependent uric acid pathologies in Drosophila melanogaster. PLoS genetics. 2019;15(8):e1008318. Epub 2019/08/16. pmid:31415568.
  59. 59. Patel PH, Penalva C, Kardorff M, Roca M, Pavlovic B, Thiel A, et al. Damage sensing by a Nox-Ask1-MKK3-p38 signaling pathway mediates regeneration in the adult Drosophila midgut. Nat Commun. 2019;10(1):4365. Epub 2019/09/27. pmid:31554796.
  60. 60. Iatsenko I, Boquete JP, Lemaitre B. Microbiota-Derived Lactate Activates Production of Reactive Oxygen Species by the Intestinal NADPH Oxidase Nox and Shortens Drosophila Lifespan. Immunity. 2018;49(5):929–42 e5. Epub 2018/11/18. pmid:30446385.
  61. 61. Shibata R, Nakahira K, Shibasaki K, Wakazono Y, Imoto K, Ikenaka K. A-type K+ current mediated by the Kv4 channel regulates the generation of action potential in developing cerebellar granule cells. J Neurosci. 2000;20(11):4145–55. Epub 2000/05/20. pmid:10818150.
  62. 62. Shibata R, Wakazono Y, Nakahira K, Trimmer JS, Ikenaka K. Expression of Kv3.1 and Kv4.2 genes in developing cerebellar granule cells. Dev Neurosci. 1999;21(2):87–93. Epub 1999/08/18. pmid:10449980.
  63. 63. Serodio P, Rudy B. Differential expression of Kv4 K+ channel subunits mediating subthreshold transient K+ (A-type) currents in rat brain. J Neurophysiol. 1998;79(2):1081–91. Epub 1998/04/18. pmid:9463463.
  64. 64. Lugo JN, Brewster AL, Spencer CM, Anderson AE. Kv4.2 knockout mice have hippocampal-dependent learning and memory deficits. Learn Mem. 2012;19(5):182–9. Epub 2012/04/17. pmid:22505720.
  65. 65. Schoppa NE, Westbrook GL. Regulation of synaptic timing in the olfactory bulb by an A-type potassium current. Nat Neurosci. 1999;2(12):1106–13. Epub 1999/11/26. pmid:10570488.
  66. 66. Gaitanidis A, Dimitriadou A, Dowse H, Sanyal S, Duch C, Consoulas C. Longitudinal assessment of health-span and pre-death morbidity in wild type Drosophila. Aging (Albany NY). 2019;11(6):1850–73. Epub 2019/03/30. pmid:30923256.
  67. 67. Scala F, Fusco S, Ripoli C, Piacentini R, Li Puma DD, Spinelli M, et al. Intraneuronal Abeta accumulation induces hippocampal neuron hyperexcitability through A-type K(+) current inhibition mediated by activation of caspases and GSK-3. Neurobiology of aging. 2015;36(2):886–900. pmid:25541422.
  68. 68. Hall AM, Throesch BT, Buckingham SC, Markwardt SJ, Peng Y, Wang Q, et al. Tau-dependent Kv4.2 depletion and dendritic hyperexcitability in a mouse model of Alzheimer’s disease. J Neurosci. 2015;35(15):6221–30. pmid:25878292.
  69. 69. Palop JJ, Chin J, Roberson ED, Wang J, Thwin MT, Bien-Ly N, et al. Aberrant excitatory neuronal activity and compensatory remodeling of inhibitory hippocampal circuits in mouse models of Alzheimer’s disease. Neuron. 2007;55(5):697–711. Epub 2007/09/06. pmid:17785178.
  70. 70. Busche MA, Chen X, Henning HA, Reichwald J, Staufenbiel M, Sakmann B, et al. Critical role of soluble amyloid-beta for early hippocampal hyperactivity in a mouse model of Alzheimer’s disease. Proc Natl Acad Sci U S A. 2012;109(22):8740–5. Epub 2012/05/18. pmid:22592800.
  71. 71. Busche MA, Eichhoff G, Adelsberger H, Abramowski D, Wiederhold KH, Haass C, et al. Clusters of hyperactive neurons near amyloid plaques in a mouse model of Alzheimer’s disease. Science. 2008;321(5896):1686–9. Epub 2008/09/20. pmid:18802001.
  72. 72. Kuchibhotla KV, Goldman ST, Lattarulo CR, Wu HY, Hyman BT, Bacskai BJ. Abeta plaques lead to aberrant regulation of calcium homeostasis in vivo resulting in structural and functional disruption of neuronal networks. Neuron. 2008;59(2):214–25. Epub 2008/08/01. pmid:18667150.
  73. 73. Minkeviciene R, Rheims S, Dobszay MB, Zilberter M, Hartikainen J, Fulop L, et al. Amyloid beta-induced neuronal hyperexcitability triggers progressive epilepsy. J Neurosci. 2009;29(11):3453–62. Epub 2009/03/20. pmid:19295151.
  74. 74. Hartley DM, Walsh DM, Ye CP, Diehl T, Vasquez S, Vassilev PM, et al. Protofibrillar intermediates of amyloid beta-protein induce acute electrophysiological changes and progressive neurotoxicity in cortical neurons. J Neurosci. 1999;19(20):8876–84. Epub 1999/10/12. pmid:10516307.
  75. 75. Brown JT, Chin J, Leiser SC, Pangalos MN, Randall AD. Altered intrinsic neuronal excitability and reduced Na+ currents in a mouse model of Alzheimer’s disease. Neurobiology of aging. 2011;32(11):2109 e1–14. Epub 2011/07/29. pmid:21794952.
  76. 76. Davis KE, Fox S, Gigg J. Increased hippocampal excitability in the 3xTgAD mouse model for Alzheimer’s disease in vivo. PLoS One. 2014;9(3):e91203. pmid:24621690.
  77. 77. Hahm ET, Nagaraja RY, Waro G, Tsunoda S. Cholinergic Homeostatic Synaptic Plasticity Drives the Progression of Abeta-Induced Changes in Neural Activity. Cell reports. 2018;24(2):342–54. pmid:29996096.
  78. 78. Small DH. Do acetylcholinesterase inhibitors boost synaptic scaling in Alzheimer’s disease? Trends Neurosci. 2004;27(5):245–9. pmid:15111005.
  79. 79. Small DH. Network dysfunction in Alzheimer’s disease: does synaptic scaling drive disease progression? Trends Mol Med. 2008;14(3):103–8. pmid:18262842.
  80. 80. Holmes GE, Bernstein C, Bernstein H. Oxidative and other DNA damages as the basis of aging: a review. Mutat Res. 1992;275(3–6):305–15. Epub 1992/09/01. pmid:1383772.
  81. 81. Gaubatz JW. Molecular Basis of Aging (CRC Press). 1995:71–135.
    • 82. Macieira-Coelho A. Molecular Basis of Aging (CRC Press). 1995:21–69.