https://orcid.org/0000-0002-8488-3423
Figures
Abstract
Chinese hickory (Carya cathayensis Sarg.) is an economically and ecologically important nut plant in China. Dieback and basal stem necrosis have been observed in the plants since 2016, and its recent spread has significantly affected plant growth and nut production. Therefore, a survey was conducted to evaluate the disease incidence at five sites in Linan County, China. The highest incidence was recorded at the Tuankou site at up to 11.39% in 2019. The oomycete, Phytophthora cinnamomi, was isolated from symptomatic plant tissue and plantation soil using baiting and selective media-based detection methods and identified. Artificial infection with the representative P. cinnamomi ST402 isolate produced vertically elongated discolorations in the outer xylem and necrotic symptoms in C. cathayensis seedlings in a greenhouse trial. Molecular detections based on loop-mediated isothermal amplification (LAMP) specific to P. cinnamomi ST402 were conducted. Result indicated that LAMP detection showed a high coherence level with the baiting assays for P. cinnamomi detection in the field. This study provides the evidence of existence of high-pathogenic P. cinnamomi in the C. cathayensis plantation soil in China and the insights into a convenient tool developed for conducting field monitoring of this aggressive pathogen.
Citation: Tong X, Wu J, Mei L, Wang Y (2021) Detecting Phytophthora cinnamomi associated with dieback disease on Carya cathayensis using loop-mediated isothermal amplification. PLoS ONE 16(11): e0257785. https://doi.org/10.1371/journal.pone.0257785
Editor: Sagheer Atta, Ghazi University Dera Ghazi Khan, PAKISTAN
Received: September 7, 2021; Accepted: October 20, 2021; Published: November 16, 2021
Copyright: © 2021 Tong et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the paper and its Supporting information files.
Funding: Financial support for this work was provided by grants from Zhejiang Key Research and Development Program of China (2019C0203002) awarded by Wang Y. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Chinese hickory (Carya cathayensis Sarg.), belonging to the Juglandaceae family, is an economically important crop in China used for obtaining edible nuts and oil production. Currently, more than 15,000 ha of C. cathayensis are cultivated in Zhejiang Province, China, providing income to local farmers and conferring ecological protection in the mountainous areas of eastern China. Traditional cultivation practices have been replaced by monoculture and fertilization to facilitate efficient management and high yield; however, these plant management practices have resulted in several plant diseases, such as Botryosphaeria trunk canker [1,2]. In May 2016, a significant outbreak of dieback disease in C. cathayensis was recorded in several Linan County orchards that constitute China’s main production area. The hickory leaves showed gradual yellowing and wilting, resulting in defoliation and, ultimately, in plant death. Necrotic symptoms were consistently observed on the same side of the basal stem as the defoliated leaves. The disease caused large casualty of the nut crop and compromised the incomes of local farmers and the environmental security.
Dieback and basal stem canker diseases in various woody plant hosts caused by diverse oomycete Phytophthora species have been recorded in many regions worldwide [3,4]. The genus Phytophthora contains over 80 species that exhibit considerable morphological diversity [5]. Among the Phytophthora species, P. cinnamomi is one of the most aggressive species worldwide, with a broad range of woody plants as the host [6]. The oomycete can grow saprophytically and persist in soil or infected plant materials as oospores or chlamydospores for up to 6 years [3]. The motile zoospores released from the sporangia attach to and invade the roots and basal stems of susceptible hosts, thereby causing necrosis at the infection site. The hyphae form sporangia on the plant surface, resulting in the formation of amplified causal inocula, and the pathogen often causes dieback in young shoots due to interference with root-to-shoot transpiration [7].
The purpose of this study was to determine the existence of the pathogenic P. cinnamomi in the soil of diseased plants and to detect the pathogen in the field using loop-mediated isothermal amplification (LAMP); the results could provide insights into an epidemic risk profile and basic reference for the disease management of this pathogenic oomycete.
Materials and methods
Field survey
Five commercial C. cathayensis orchards in Tuankou, Daoshi, Longgang, Baiguo, and Qinliangfeng in Linan County, Zhejiang Province, China, were selected for the dieback and basal stem canker disease survey (Table 1). Visual disease assessments were performed in July 2018 and July 2019, in which the symptomatic plants were counted based on necrotic cankers present on the basal stem. The disease incidence was presented as the percentage symptomatic plants of the total surveyed plants. The soil pH was directly determined at five randomly selected points in each location using an HI99121 digital Direct Soil Measurement pH Meter (Hanna Instruments, Hanna, Italy).
Phytophthora isolation
The leaf baiting method was used to isolate and detect the presence of zoospore-producing pathogens in soil samples [8]. Briefly, the soil was flooded with a 60-ml aliquot of sterile water in a plastic box and baited with four rhododendron leaves that had been surface-sterilized by wiping with 70% ethanol. The loaded boxes were incubated in a growth chamber at 27°C in the dark for 1 week. Pieces were cut from the leaf lesions and placed in plates containing pimarcin-ampicillin-rifampicin-pentachloronitrobenzene cornmeal agar (PARP) [9]. The hyphal tips grown on the PARP plates were excised and transferred to V8 agar (V8A) medium containing 16 g agar, 3 g CaCO3, 100 ml Campbell’s V8 juice, and 900 ml distilled water for further investigation. The sporangia and oospores were observed under an optical microscope (Keyence, VHX-6000, Japan).
Phytophthora isolation from symptomatic plant tissue
Segments of necrotic plant tissue were surface-sterilized with 70% ethanol, placed in plates containing the PARP medium, and incubated in a growth chamber at 27°C in the dark. The hyphal tips grown on the PARP plates were excised and transferred to V8A medium-containing plates.
DNA extraction and PCR amplification
Genomic DNA (gDNA) extraction from the isolates grown on V8A medium was conducted using the Spin Column Fungal Total DNA Purification Kit (Sangon Biotech, Shanghai), and DNA concentration was determined using the NanoDrop 2000c spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). The genomic DNA was used to amplify the ITS region and COI gene using ITS4 (TCCTCCGCTTATTGATATGC)/ITS6 (GAAGGTGAAGTCGTAACAAGG) and COI-Levup (TCAWCWMGATGGCTTTTTTCAAC)/COI-Levlo (CYTCHGGRTGWCCRAAAAACCAAA) primers, respectively [10]. PCR was performed with an initial denaturation at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 55°C (ITS4/ITS6 primers) or 52°C (COI-Levup/COI-Levlo primers) for 30 s, and extension at 72°C for 1 min, followed by a final extension at 72°C for 5 min, and a final hold at 4°C.
Sequencing and phylogenetic analyses
The amplified PCR products were visualized using 1.2% agarose gel electrophoresis and sequenced (Sangon, Shanghai, China). The data on sequences were queried using the GenBank BLASTn search, and ten representative Phytophthora species sequences deposited in the CBS-KNAW culture collection, Netherlands, (http://www.wi.knaw.nl/collections/) were selected for conducting phylogenetic analyses. Pythium aphanidermatum was used as the outgroup. ITS and COI concatenated sequences were generated and aligned using the maximum parsimony method with 1,000 bootstrap replicates in the MAGE 7 software [11].
Pathogenicity assay
Three-year-old pot-grown Chinese hickory seedlings were used for pathogen inoculation. Briefly, a 2 × 2-mm2 wound was inflicted on the seedlings before inoculation. A 5-mm mycelial plug excised from the margin of a 3-day-old V8A-grown culture was placed on the wound and sealed with Parafilm. The mock samples were inoculated with sterile V8A plugs. The inoculated seedlings were incubated in a greenhouse at 25°C and 85% relative humidity. The Parafilm was removed 1 day post-inoculation (dpi). The seedlings were observed daily, and the necrotic symptoms were recorded. The pathogens were re-isolated from the inoculated tissue and identified based on morphological characteristics and phylogenetic analysis, as described above.
LAMP primers and reaction
We used the LAMP primers and reaction conditions for P. cinnamomi targeting Pcin100006 with minor modifications [12]. The primers used in this study included the forward inner primer (FIP) (5’-CGAAGGACGAGGTGAAGGTGGACGCCCATACATCACATACG), backward inner primer (BIP) (5’-CCGCTACTGCAGACGCCGGCAACTCGGGCAAGATGACTTC), F3 (5’-GTTCTGCGCGATTTGGTTAG), and B3 (5’-GCGGATCTTCCGATCTGGTA). The LAMP reaction mixtures with pre-reaction addition of hydroxynaphthol blue (HNB) (Sigma-Aldrich, St. Louis, Missouri, USA) were optimized in preliminary tests by modifying the concentration of reagents and incubation duration. The optimal 25-μL reaction included 2.5 μL 10× ThermoPol buffer (New England Biolabs, Ipswich, Massachusetts, USA), 2.25 μL each of FIP and BIP (1.8 μM), 1 μL each of F3 and B3 (0.4 μM), 2 μL betaine (0.8 M), 3 μL each of deoxyribonucleotide triphosphate (1.2 mM) and MgSO4 (6 mM), 2 μL HNB (180 mM), 1 μL Bacillus stearothermophilus (Bst) DNA polymerase (8 U μl-1) (New England Biolabs), 2 μL DNA template, and 1 μL nuclease-free H2O. The reaction mixture was incubated in a water bath set at 64°C for 60 min, and the LAMP results were visually observed and determined by the occurrence of color changes [13]. The reactions that turned blue indicated positive results, suggesting the presence of Pcinn100006 specific to P. cinnamomi. Those that turned violet indicated negative results, suggesting the absence of P. cinnamomi.
Field detection of P. cinnamomi
An approximately 30-year-old C. cathayensis orchard in the Tuankou trial was selected for conduction of soil sampling and P. cinnamomi detection. In July 2020, soil samples at 0 to 2 cm depth in a 5-cm ring away from the basal stemof each tree were separately collected and labeled. Each soil sample was thoroughly mixed and separated into two equal subsamples. One subsample was used for DNA extraction, and the other was used for conducting leaf-baiting isolation of Phytophthora (as per methods described above). Soil DNA (sDNA) extraction from each subsample was performed directly using the Soil DNA Mini Kit (Tiangen, Beijing, China). The sDNA was diluted to a concentration of 2 ng ml-1 before addition to the LAMP reaction, which was performed in triplicate for each subsample. The ITS region and COI genes obtained from the isolates were amplified and sequenced. The aligned sequences exhibited over 99% similarity between the candidate strain and ST402, indicating that P. cinnamomi was present in the sample.
Results
Field survey of dieback and basal root rot disease in C. cathayensis
The yellowing and wilting of leaves in the surveyed C. cathayensis orchards gradually occurred in May 2017, followed by defoliation and dieback of young shoots (Fig 1A). The necrosis extended to the stem and caused the occurrence of basal stem rot and cankers (Fig 1B). In severe cases, the necrotic symptoms occurred at locations up to 1 m above the ground (Fig 1C). The disease was detected in all five survey sites and has been reportedly increasing since 2018, with the highest incidence occurring in the Tuankou trial, where it was 4.43% in July 2018, increasing to 11.39% in July 2019 (Table 1).
A: Tree dieback symptoms; B: basal stem necrotic tissue; C: stem-bark extended necrotic zone.
Phytophthora cinnamomi isolation and characterization
Fifty-eight isolates were obtained from the symptomatic plant tissues and soil samples. They were morphologically identical to those cultured on the V8A medium plates; the colonies were white, fluffy, and compact, with petaloid or chrysanthemum-like growth patterns (Fig 2A). The V8A isolate mycelia were continuous, and the solitary, caduceus, ovoid to spherical sporangia were produced in a single branch (Fig 2B). The average sporangia size was 21.9 ± 3.8 μm long and 16.2 ± 2.6 μm wide. Globose to slightly subglobose, smooth-walled gametangia were observed at the main hyphae (Fig 2C). The oospores were globose with a mean diameter of 21.6 ± 2.5 μm and were surrounded by a thick wall (Fig 2D). The isolated fungus was preliminarily identified as P. cinnamomi based on the above-mentioned morphological characteristics. Three representative isolates were randomly selected for phylogenetic analytic confirmation of the morphological identification. PCR with ITS4/ITS6 and COI-Levup/ COI-Levlo primers resulted in the formation of products of approximately 940 bp and 680 bp for the isolates studied, and all isolates shared identical partial ITS and COI sequences. The ITS and COI sequences of the ST402 isolate were selected and deposited in GenBank with the accession numbers MT675107 and MT683171, respectively. A phylogenetic tree comprising the ST402 isolate and other Phytophthora species was constructed based on the concatenated ITS and COI region sequences (Fig 3). The ST402 isolate was distinguished and grouped with P. cinnamomi; it was further identified as P. cinnamomi by phylogenetic analysis. Moreover, 23 of the 63 isolates obtained from the symptomatic plant tissues showed identical morphological features and the same ITS and COI sequences as the P. cinnamomi ST402 isolate.
A: seven-day-old colony on PARP medium; B: sporangia; C: gametangia; D: oospore.
Phylogenetic tree was rooted to Pythium aphanidermatum (CBS 28779) as an outgroup taxon.
Phytophthora cinnamomi exhibited high pathogenicity on Carya cathayensis seedlings
The ST402 isolate investigated in the pathogenic tests caused the occurrence of marked necrosis and bark discoloration around the wounded site at 7 dpi in the greenhouse (Fig 4A). The 3.8 ± 0.4-cm necrosis length caused by P. cinnamomi at 7 dpi extended to 5.3 ± 0.6 cm at 14 dpi (Fig 4B). However, no symptoms were observed in the mock inoculations. Re-isolations resulted in the obtainment of colony cultures identical to the morphological and phylogenetic analysis of the P. cinnamomi ST402 isolate.
A: P. cinnamomi ST402 isolate stem necrosis symptoms 7 days postinoculation; B: Box-plot diagram of P. cinnamomi ST402 isolate necrotic length in C. cathayensis stems (N = 20) 7 and 14 days postinoculation. Asterisks (*) and (**) indicate significant differences derived from two-sample comparisons at P = 0.05 and P = 0.01, respectively.
The LAMP detection is specific and sensitive to detect P. cinnamomi ST402
The LAMP reaction mixtures containing the ST402 isolate’s gDNA exhibited a color change to blue, indicating positive detection (Fig 5A). In contrast, the LAMP reaction mixtures containing gDNAs of other oomycetes or fungi, including P. cathayensis, P. infestans, Fusarium oxysporum, Pythium ultimum, and Verticillium dahlia, remained purple. Agarose gel visualization of the LAMP reaction mixture showed that only the ST402 isolate exhibited the typical ladder-like pattern. The results of the two independent repeats of each assay were identical.
A. LAMP reactions conducted for P. cinnamomi specificity and results visualized using hydroxynaphthol blue (upper column) and 1% agarose gel (lower column). M: DNA marker (DL2000, TaKaRa); Pci: P. cinnamomi ST402; Pca: P. cathayensis CP29; Pin: P. infestans; Fox: Fusarium oxysporum; Pul: Pythium ultimum; Vda: Verticillium dahliae. B. LAMP reactions performed for determining P. cinnamomi sensitivity and results visualized using hydroxynaphthol blue (upper column) and 1% agarose gel (lower column). P. cinnamomi ST402 isolate genomic DNA used as templates (20, 2, 0.2, 0.02, 0.002, and 0.0002 ng per 25 μL reaction mixture). M: DNA marker (DL2000, TaKaRa); +: positive reaction; −: negative reaction.
The LAMP reaction mixtures (25 μL) using 50, 10, 2, 0.4, and 0.08 ng gDNA of the P. cinnamomi ST402 isolate yielded positive detection results (Fig 5B). No color change was observed in the reaction mixtures using gDNA at a lower concentration (0.016 ng). In the gel visualization, ladder-like patterns were observed in all reactions; however, the patterns showed less intensity at the lowest concentration (0.016 ng). The results of the two independent repeats of each assay were identical.
Field detection of Phytophthora cinnamomi
Fifteen soil samples from 30 C. cathayensis plants showed positive results for baiting assays conducted in July 2019 (Fig 6A). Ten of the thirty plants showed the presence of basal stem canker symptoms. All 15 positive baiting-soil samples also showed positive results for LAMP, and one LAMP-positive soil sample was obtained from an asymptomatic plant downstream of the surveyed field. The disease incidence increased in July 2020, with 18 plants exhibiting symptomatic cankers. All soil samples obtained from symptomatic plants showed positive results either in baiting assays or in LAMP-based analyses (Fig 6B). Moreover, eight soil samples obtained from asymptomatic plants showed positive results either in baiting assays or in LAMP-based analyses. These plants were mostly located downstream of the surveyed field.
Rhododendron leaf or P. cinnamomic-specific LAMP was conducted using DNA samples extracted directly from soil specimens collected from 0 to 5 cm depth around C. cathayensis basal stems in a Linan County commercial orchard in July 2019 (A) and July 2020 (B). The hollow and solid squares indicate asymptomatic and necrotic symptoms in C. cathayensis plants, respectively. The hollow and solid triangles indicate negative and positive detection by performing baiting assays as per methods described in Materials and methods. Hollow and solid ovals indicate negative and positive detection results by LAMP, respectively.
Discussion
Several nut tree crops or ornamental trees in the Juglandaceae family are sensitive to Phytophthora species. In South Europe, P. cinnamomi is frequently isolated from English walnut (Juglans regia) trees showing a sudden development of wilt and is considered an aggressive primary pathogen [14,15]. The P. caryae species isolated from streams and rivers in the United States are pathogenic to shagbark hickory (Carya ovata) [16,17]. In this study, P. cinnamomi was isolated from the necrotic tissue and the soil of diseased C. cathayensis trees with dieback and basal stem canker symptoms. The ST402 isolate was pathogenic to the host plants in the greenhouse trial. To our knowledge, this is the first report of P. cinnamomi associated with dieback and basal stem canker disease on C. cathayensis.
Phytophthora oomycetes are considered primary pathogens in woody plants worldwide [3,18]. Several species of this genus, such as P. cinnamomi, P. nicotianae, P. palmivora, and P. ramorum have very wide host ranges; other species such as P. alni and P. quercina infect a narrow range of hosts [19]. Moreover, multiple pathogenic species were found in and on the host plants. Six species, namely P. cinnamomi, P. nicotianae, P. citricola, P. citrophthora, P. cryptogea, and P. cactorum, were detected in the same ornamental crop nurseries in the United States [20]. Five species, namely P. pseudocryptogea, P. citrophthora, P. nicotianae, P. gondwanense, and P. sojae, were isolated from the rhizosphere of macadamia nut trees in Australia and their ability to cause stem canker was verified [21]. Two Phytophthora species, namely P. cryptogea and P. megasperma caused a decline in the population of wild olive in Spain [22]; furthermore, P. oleae, a new pathogen isolated from the rootlets of the same host, showed high pathogenicity, and it was speculated that the three Phytophthora species might be active in wild olive roots in different seasons [23]. The new species P. cathayensis had been obtained from the active lesions present on the collar of Chinese hickory in a previous study [24]. In this study, P. cinnamomi ST402 also exhibited aggressive pathogenicity to the host plants, indicating that the cause of dieback and basal stem canker disease in C. cathayensis in China might be due to the Phytophthora complex.
The pathogen P. cinnamomi is considered as one of the most devastating species and a major threat to natural ecosystems and biodiversity, causing extensive economic losses in agriculture, horticulture, and forestry [25,26]. More than 1,700 plant species, most of which are woody plants, are listed as susceptible to P. cinnamomi (http://nt.ars-grin.gov/fungaldatabases/, April 4, 2021). The wide host range of P. cinnamomi has contributed to its rapid spread in several countries worldwide [3]. Moreover, P. cinnamomi is known to survive for as long as 6 years in moist soil. The dormant oospores or chlamydospores in contaminated soil and plant materials facilitate its spread through transplanting and irrigation water [27]. It readily inhabits multiple ecological niches that can facilitate its rapid spread and establishment once introduced to a new location [28]. Our results provide evidence that P. cinnamomi exists and spreads in C. cathayensis plantation soil. However, its origin remains unknown, and its risk in other plants and the environment should be evaluated.
Accurate pathogen detection has critical implications for disease management, disease-free certification, and quarantine. Particularly, mapping of the incidence and distribution of P. cinnamomi in plantation soils may offer valuable information for limiting its spread [29]. Currently, Phytophthora can be detected using a variety of techniques, including direct isolation on Phytophthora-selective media [9], baiting, and isolation onto selective media [30], immunodetection assay [31], and molecular detection based on specific DNA sequences [8,32]. Touchdown nested multiplex PCR targeting ITS sequences was used to detect the presence of P. cinnamomi in chestnut grove soils [33]. Conventional methods, including direct isolation from the diseased material, or indirect baiting using known host plants, are labor-intensive and time-consuming [34]. In contrast, molecular genetic methods are relatively more sensitive and time-effective, thereby allowing for a higher throughput. In this study, the combination of rhododendron leaf baiting and LAMP assay was performed in the field to detect the presence of P. cinnamomi in plantation soil samples from C. cathayensis. Our results revealed the route of transmission of the pathogen in the field, and this revelation could contribute to disease management and the early detection of the pathogen in plantation soils of asymptomatic trees, which might facilitate timely disease prevention.
LAMP is based on the principle of autocycling strand displacement DNA synthesis performed by Bst DNA polymerase to detect a specific DNA sequence [35]. This technique is performed using four to six primers that recognize six to eight regions of the target DNA with an extremely high specificity. The technique can be performed under isothermal conditions ranging from 60 °C to 65 °C; it produces a substantial quantity of DNA, thus facilitating detection by DNA dyes, such as SYBR Green I [36]. Importantly, the PCR thermocycler equipment is not required because the temperature is not cycled during the amplification process. LAMP technology has been successfully applied to detect plant pathogenic fungi [37], oomycetes [38], bacteria [39], and nematodes [40]. Recently, the LAMP assay targeting Pcinn100006 showed highly specific results for P. cinnamomi [12]. The Pcinn100006 loci were also located in the P. cinnamomi ST402 genome (Wang et al, unpublished data). The results of LAMP assays conducted in the present study verified its high specificity and sensitivity in P. cinnamomi detection. Moreover, in this study, the LAMP assay was practically utilized to detect P. cinnamomi in C. cathayensis plantation soil.
Conclusion
The present study revealed that P. cinnamomi isolated from necrotic tissue and diseased C. cathayensis plantation soil exhibited high virulence. To our knowledge, P. cinnamomi associated with dieback and basal stem canker of C. cathayensis was determined for the first time. The molecular detection of P. cinnamomi based on LAMP provided the route of transmission of the aggressive pathogen in the field, and may contribute to an early diagnosis of the disease and may help prevent its spread.
Supporting information
S1 Table. GenBank accession numbers of taxa used in phylogenetic analyses.
https://doi.org/10.1371/journal.pone.0257785.s001
(DOCX)
Acknowledgments
We thank Dr. Carmen Morales-Rodríguez (DIBAF, University of Tuscia, Italy) and Dr. Andrea Vinnini (DIBAF, University of Tuscia, Italy) for their technical assistances and critical review.
References
- 1. Xu S, Yao J, Wu F, Mei L, Wang Y (2018) Evaluation of Paenibacillus polymyxa carboxymethylcellulose/poly (vinyl alcohol) formulation for control of Carya cathayensis canker caused by Botryosphaeria dothidea. Forest Pathology 48: e12464.
- 2. Yao J, Mei L, Jiang H, Hu G, Wang Y (2019) Evaluation of Carya cathayensis resistance to Botryosphaeria trunk canker using grafting on pecan. Scientia Horticulturae 248: 184–188.
- 3. Hardham AR, Blackman LM (2018) Phytophthora cinnamomi: Phytophthora cinnamomi. Molecular Plant Pathology 19: 260–285. pmid:28519717
- 4. Jung T, Orlikowski L, Henricot B, Abad-Campos P, Aday AG, et al. (2016) Widespread Phytophthora infestations in European nurseries put forest, semi-natural and horticultural ecosystems at high risk of Phytophthora diseases. Forest Pathology 46: 134–163.
- 5. Martin FN, Abed ZG, Baldi Y, Ivors K (2012) Identification and detection of Phytophthora: reviewing our progress, identifying our needs. Plant Disease 96: 1080–1103. pmid:30727075
- 6. Burgess TI, Scott JK, Mcdougall KL, Stukely MJC, Crane C, et al. (2017) Current and projected global distribution of Phytophthora cinnamomi, one of the world’s worst plant pathogens. Global Change Biology 23: 1661–1674. pmid:27596590
- 7. Oβwald W, Fleischmann F, Rigling D, Coelho AC, Cravador A, et al. (2014) Strategies of attack and defence in woody plant-Phytophthora interactions. Forest Pathology 44: 169–190.
- 8. Sena K, Dreaden TJ, Crocker E, Barton C (2018) Detection of Phytophthora cinnamomi in forest soils by PCR on DNA extracted from leaf disc baits. Plant Health Progress 19: 193–200.
- 9. Jeffers SN, Martin SB (1986) Comparison of two media selective for Phytophthora and Pythium species. Plant Disease 70: 1038–1043.
- 10. Robideau GP, De Cock AW, Coffey MD, Voglmayr H, Brouwer H, et al. (2011) DNA barcoding of oomycetes with cytochrome c oxidase subunit I and internal transcribed spacer. Molecular Ecology Resources 11: 1002–1011. pmid:21689384
- 11. Kumar S, Stecher G, Tamura K (2016) MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33: 1870–1874. pmid:27004904
- 12. Dai TT, Yang X, Hu T, Li ZY, Xu Y, et al. (2019) A novel LAMP assay for the detection of Phytophthora cinnamomi utilizing a new target gene identified from genome sequences. Plant Disease 103: 3101–3107. pmid:31613192
- 13. Goto M, Honda E, Ogura A, Nomoto A, Hanaki K (2009) Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxyl naphthol blue. BioTechniques 46: 167–172. pmid:19317660
- 14. Vettraino AM, Belisario A, Maccaroni M, Vannini A (2003) Evaluation of root damage to English walnut caused by five Phytophthora species. Plant Pathology 52: 491–495.
- 15. Vitale S, Scotton M, Vettraino AM, Vannini A, Haegi A, et al. (2019) Characterization of Phytophthora cinnamomi from common walnut in Southern Europe environment. Forest Pathology 49: e12477.
- 16. Brazee NJ, Wick RL, Hulvey JP (2016) Phytophthora species recovered from the Connecticut River Valley in Massachusetts, USA. Mycologia 108: 6–19. pmid:26553775
- 17. Brazee NJ, Yang X, Hong CX (2017) Phytophthora caryae sp. nov., a new species recovered from streams and rivers in the eastern United States. Plant Pathology 66: 805–817.
- 18. Schwingle BW, Blanchette RA (2008) Host range investigations of new, undescribed, and common Phytophthora spp. isolated from ornamental nurseries in Minnesota. Plant Disease 92: 642–647. pmid:30769635
- 19. Le Fevre R, O’Boyle B, Moscou MJ, Schornack S (2016) Colonization of barley by the broad-host hemibiotrophic pathogen Phytophthora palmivora uncovers a leaf development-dependent involvement of Mlo. Molecular Plant-Microbe Interactions 29: 385–395. pmid:26927001
- 20. Ferguson AJ, Jeffers SN (1999) Detecting multiple species of Phytophthora in container mixes from ornamental crop nurseries. Plant Disease 83: 8. pmid:30841137
- 21. Jeff-Ego OS, Drenth A, Topp B, Henderson J, Akinsanmi OA (2020) Prevalence of Phytophthora species in macadamia orchards in Australia and their ability to cause stem canker. Plant Pathology 69: 1270–1280.
- 22. González M, Perez-Sierra A, Serrano MS, Sanchez ME (2017) Two Phytophthora species causing decline of wild olive (Olea europaea subsp europaea var. sylvestris). Plant Pathology 66: 941–948.
- 23. González M, Perez-Sierra A, Sanchez ME (2019) Phytophthora oleae, a new root pathogen of wild olives. Plant Pathology 68: 901–907.
- 24. Morales-Rodriguez C, Wang Y, Martignoni D, Vannini A (2021) Phytophthora cathayensis sp. nov., a new species pathogenic to Chinese Hickory (Carya cathayensis) in southeast China. Fungal Systematics and Evolution 7: 99–111. pmid:34124619
- 25. Hansen EM, Reeser PW, Sutton W (2012) Phytophthora beyond agriculture. Annual Review of Phytopathology 50: 359–378. pmid:22681450
- 26. Ramírez-Gil JG, Morales-Osorio JG (2020) Integrated proposal for management of root rot caused by Phytophthora cinnamomi in avocado cv. Hass crops. Crop Protection 137: 105271.
- 27. Bienapfl JC, Balci Y (2014) Movement of Phytophthora spp. in Maryland’s Nursery Trade. Plant Disease 98: 134–144. pmid:30708606
- 28. Bose T, Wingfield MJ, Roux J, Vivas M, Burgess TI (2021) Phytophthora species associated with roots of native and non-native trees in natural and managed forests. Microbial Ecology 81: 12. pmid:32740757
- 29. Burgess TI, Lopez-Villamor A, Paap T, Williams B, Belhaj R, et al. (2021) Towards a best practice methodology for the detection of Phytophthora species in soils. Plant Pathology 70: 604–614.
- 30. Ghimire SR, Richardson PA, Moorman GW, Lea-Cox JD, Ross DS, et al. (2009) An in-situ baiting bioassay for detecting Phytophthora species in irrigation runoff containment basins. Plant Pathology 58: 577–583.
- 31. Cahill D, Hardham A (1994) Exploitation of zoospore taxis in the development of a novel dipstick immunoassay for the specific detection of Phytophthora cinnamomi. Phytopathology 84: 8.
- 32. Kunadiya MB, Dunstan WD, White D, Hardy GES, Grigg AH, et al. (2019) A qPCR assay for the detection of Phytophthora cinnamomi including an mRNA protocol designed to establish propagule viability in environmental samples. Plant Disease 103: 2443–2450. pmid:31313641
- 33. Langrell SR, Morel O, Robin C (2011) Touchdown nested multiplex PCR detection of Phytophthora cinnamomi and P. cambivora from French and English chestnut grove soils. Fungal Biology 115: 672–682. pmid:21724173
- 34. Davison E, Tay F (2005) How many soil samples are needed to show that Phytophthora is absent from sites in the southwest of Western Australia? Australasian Plant Pathology 34: 293–297.
- 35. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, et al. (2000) Loop-mediated isothermal amplification of DNA. BioTechniques 28: E63. pmid:10871386
- 36. Wong YP, Othman S, Lau YL, Radu S, Chee HY (2018) Loop-mediated isothermal amplification (LAMP): a versatile technique for detection of micro-organisms. Journal of Applied Microbiology 124: 626–643. pmid:29165905
- 37. Ayukawa Y, Komatsu K, Kashiwa T, Akai K, Yamada M, et al. (2016) Detection and differentiation of Fusarium oxysporum f. sp lycopersici race 1 using loop-mediated isothermal amplification with three primer sets. Letters in Applied Microbiology 63: 202–209. pmid:27248357
- 38. Fukuta S, Takahashi R, Kuroyanagi S, Miyake N, Nagai H, et al. (2013) Detection of Pythium aphanidermatum in tomato using loop-mediated isothermal amplification (LAMP) with species-specific primers. European Journal of Plant Pathology 136: 689–701.
- 39. Moradi A, Nasiri J, Abdollahi H, Almasi M (2012) Development and evaluation of a loop-mediated isothermal amplification assay for detection of Erwinia amylovora based on chromosomal DNA. European Journal of Plant Pathology 133: 609–620.
- 40. Niu JH, Jian H, Guo QX, Chen CL, Wang XY, et al. (2012) Evaluation of loop-mediated isothermal amplification (LAMP) assays based on 5S rDNA-IGS2 regions for detecting Meloidogyne enterolobii. Plant Pathology 61: 809–819.