https://orcid.org/0000-0002-9754-8464
Figures
Abstract
The present study aimed to check the sand flies’ fauna on the municipality of Lassance, Minas Gerais, Brazil and detect the presence of Leishmania DNA on the female captured and determine the risk areas of the municipality. Sand flies were collected monthly from May 2018 to April 2019 using automatic light traps for 3 consecutive nights. Eight houses were selected as sample points due its previous reports of tegumentary leishmaniasis and/or canine leishmaniasis. The sand fly’s fauna found on the present study it’s represented by several medical importance species and the most abundant species found were Lutzomyia longipalpis (77.09%) and Nyssomyia intermedia (10.06%). Leishmania infantum DNA was detected in a pool of Lu. longipalpis resulting on a 2.81% of infection rate. By the frequency of the two most abundant species on this study, we developed a risk area map and it draws attention to sample point 6 due to disparate abundance of sand flies at this site (81.81%). Statistical overview shows Lu. longipalpis as dominant species and, still, Non-Metric Multidimensional Scaling analysis reveal high similarity on fauna’s diversity on the study area. Our findings suggest that the diversity of sand flies from the municipality of Lassance may promote the circulation of Leishmania infantum parasites putting in risk the habitants and other mammal’s species. Still, our study reinforces the necessity of specific studies focused on breed sites of phlebotomine and its’ ecology to expand the knowledge about the behaviour of this group of insects applying directly to leishmaniases’ epidemiology.
Citation: Tonelli GB, Binder C, Nogueira VLC, Prado MH, Theobaldo GG, Campos AM, et al. (2021) The sand fly (Diptera: Psychodidae) fauna of the urban area of Lassance, Northeast Minas Gerais, Brazil. PLoS ONE 16(10): e0257043. https://doi.org/10.1371/journal.pone.0257043
Editor: Albert Schriefer, Universidade Federal da Bahia, BRAZIL
Received: June 10, 2021; Accepted: August 20, 2021; Published: October 13, 2021
Copyright: © 2021 Tonelli et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the manuscript.
Funding: This study was supported by Fundação de Amparo à Pesquisa do Estado de Minas Gerais (www.fapemig.br, PPM-00792-18, awarded to JF), Conselho Nacional de Desenvolvimento Científico e Tecnológico (www.cnpq.br, 303680/2020-2, awarded to JF. Additionally, this study was partially supported by the Coordination for the Improvement of Higher Education Personnel (Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - CAPES) (www.capes.gov.br, Finance Code 001, awarded to GT). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Sand flies are widely-distributed insects in the world. They include species that are highly adapted to a great diversity of environments and that are also involved in the transmission of parasites of the genus Leishmania, which infect several mammals, including humans, causing leishmaniasis. These insects are more abundant in the Neotropical region, with a greater number of species whose densities fluctuate with climatic seasons [1].
Brazil is a country with a large territorial extension, with the presence of five biomes, which explains the large number of sandfly species found in its territory [2]). The state of Minas Gerais is endemic for leishmaniasis, comprising three of these biomes (Caatinga, Atlantic Forest and Cerrado). Some studies on sand flies carried out in Minas Gerais, in urban, rural and wild areas, show a significant difference between richness and abundance between these environments, always with the prevalence of Lutzomyia longipalpis in the urban environment [3–5].
About the biomes, Cerrado is prevalent in the Brazilian state of Minas Gerais (MG), including its Northern Region, but the biome has been experiencing an increasing rate of deforestation due to disordered population growth, which can lead to a change in the epidemiology of leishmaniasis, with the migration of vectors and reservoirs to the urban environment. Leishmaniasis is known to be a disease of wild origin that puts human health at risk when contact is made with areas of its occurrence [6,7].
The municipality of Lassance, in the Northern Region of Minas Gerais, is in an endemic area of leishmaniasis where 19 cases of America tegumentary leishmaniasis (ATL) and two cases of visceral leishmaniasis (VL) were reported between 2010 and 2019 [8]. Studies carried out in both rural and wild environments of this municipality obtained data on phlebotomine fauna, including the detection of Leishmania sp. and the description of a new species [9–14]. Several cases of canine leishmaniasis have been recently observed in the area (unpublished data), yet no monitoring with regard to the vectors of leishmaniasis is being carried out in the local urban area of Lassance.
Thus, the present study aimed to survey the sand fly fauna in the urban area of Lassance, MG, and investigate the presence of Leishmania DNA in the collected sand flies. The results will enable us to indicate to health authorities of the municipality the areas of highest risk.
Methods
Study area
The study area is located in the Northern Region of the state of Minas Gerais (17 ° 53 ’13 "S, 44 ° 34’ 40" W) (Fig 1), on the banks of Rio das Velhas. Lassance encompasses an area of 3214 km2 and has 6,554 human inhabitants. Local economic activities involve agriculture, fishing and livestock.
The municipality of Lassance is situated in the microregion of Pirapora. It is situated in an area of flat relief, predominantly occupied by the Cerrado biome, and has 81% afforestation on its public streets [15] (Fig 2). Lassance has historical and scientific significance as the place where Chagas disease was discovered in 1907 by Carlos Ribeiro Justiniano Chagas, a young sanitary doctor from the Oswaldo Cruz Institute who was brought there to control malaria in the northern village of Minas [16].
Sand fly sampling
Eight sampling points were selected throughout the urban area of Lassance (Fig 3) according to information obtained by the local municipal health department about residences involved in canine and/or human cases of leishmaniasis. An HP-type light trap was used at each sampling point with a sampling effort of 72 hours per month from May 2018 to April 2019. Climatic data (average temperature and rainfall) for the sampling period were acquired from the National Institute of Meteorology (NIMET). The sampling points were characterized according to the presence or absence of factors that may contribute to the presence of sand flies, as shown in Table 1.
Red dots with numbers (1–8) identify the sampling points.
Collected sand flies were stored in tubes containing 70% alcohol. In the laboratory, the flies were separated by sex, prepared in Berlese liquid and mounted on microscope slides with a coverslip. The entire body of male individuals was mounted while only the head and the last two abdominal segments were mounted for females with the remainder of the body being separated for molecular analysis. The insects were identified following the classification of Galati [17] and the genera abbreviations followed Marcondes [18].
Molecular detection of Leishmania DNA
Total DNA was extracted using a Gentra Puregene KIT (Qiagen, USA), following the manufacturer’s protocol, from females individually or in pools for samples larger than 10 individuals of the same species from the same sampling point during the same collection period. A 300–350 bp fragment of the intergenic region of Leishmania DNA (Internal Transcribed Spacer q—ITS1) was amplified using the primers LITSR 5´ CTGGATCATTTTCCGATG 3´ and L5.8S 5´ TGATACCACTTATCGCACTT 3´. The amplified samples were visually analysed by electrophoresis with a 2% agarose gel. To identify Leishmania species for positive samples, the amplified product was digested using the enzyme HAEIII (10U/μL), following the manufacturer’s recommendations (New England Biolabs, Ipswich, MA, USA). Restriction patterns were analysed on a 4% agarose gel stained with 5μL of ethidium bromide (10U/μL), in comparison with the following reference strains of Leishmania spp.: Le. amazonensis (IFLA/BR/67/PH8), Le. braziliensis (MHOM/BR/75/M2903), Le. infantum (MHOM/BR/74/PP75) and Le. guyanensis (MHOM/BR/75/M4147).
Determination of risk areas
The two most abundant species were distributed according to occurrence percentage per sampling point and the result plotted on a map of the municipality to delimit points with the highest concentration of vectors and delimit risk areas.
Statistical interpretation
Equitability of the sand fly population among the different sampling points, and thus the environments they represent, of the study area was determined by the Pielou Index (J) based on the abundance of each species.
Similarity analysis of the occurrence and relative abundance of sand flies among the different sampling points were determined by Non-Metric Multidimensional Scaling (NMDS) using a dissimilarity matrix calculated according using Jaccard (with species presence/absence data) and Bray-Curtis (with species relative abundance data) indexes.
Statistical analyses were performed using the Vegan package in R software 3.2.4 (R Development Core Team 2016).
Results
A total of 1,611 sand flies of 15 species and eight genera were captured in the urban area of Lassance. The most abundant species were Lu. longipalpis and Ny. intermedia with 77.09% and 10.06% of all sand fly collected, respectively. The most successful sampling points were point 6 (81.81%) followed by point 4 (11.67%) (Table 2).
The months with the greatest sampling success for collected sand flies were May 2018 (12.97%), November 2018 (16.39%) and January 2019 (31.72%). The months with the lowest average temperatures were May 2018 (av. 23.3°C), June 2018 (av. 23.3°C) and July 2018 (av. 22.9°C) and those with the highest were January 2019 (av. 28.9°C) and February 2019 (av. 27.8°C). The lowest averages for relative humidity were August 2018 (av. 57.7%) and September 2018 (av. 54.8%) while the highest were for November 2018 (av. 75.4%), December 2018 (av. 69%) and February 2019 (av. 69.4%) (Fig 4).
A total of 427 female sand flies were subjected to molecular analysis, with 12 samples testing positive for PCR of ITS1, for an infection rate of 2.10% (9/427). All positive samples were submitted to RFLP by HAEIII digestion. We found the Le. infantum profile for a Lu. longipalpis sample from sampling point 6. Most of the positive samples came from sampling point 6 (n = 4; 44,44%), with the others coming from sampling points 8 (n = 3; 33,33%) and 4 (n = 2; 22,22%) (Table 3).
We used the frequencies of Lu. longipalpis and Ny. intermedia among sampling points to generate a map of risk areas. Frequency bars represent the frequency of the species at the specific sampling point per all sand flies captured in the study (Fig 5).
The study area had low equitability (J ’ = 0.34), with dissimilar species abundances among the different sampling points and Lu. longipalpis being the dominant species. Similarity analysis of sampling points by NMDS based on occurrence and relative abundance of sand fly species per trap explained 74% and 92% of the variation in the data with stress values of 0.08 and 0.06, respectively. These explanation percentages and stress values are considered good, since they reveal a high probability that the similarity analysis reflects the reality of the studied environments. NMDS revealed a strong tendency for similarity in the composition and relative abundance of sand fly species among the different sampling points in the urban area of Lassance, which suggests that all these environments are favourable for the maintenance of sand fly species communities in the study area (Fig 6).
A) Plot for NMDS of occurrence data. B) Plot for NMDS of relative abundance data.
Discussion
The diversity of sand fly species found in the present study demonstrates that these insects are adapted to environments with different levels of anthropic interference. The study area has characteristics of both peri-urban and rural areas, with more than 70% of the area being the Cerrado biome [15].
Furthermore, all sampling points possess factors (green areas and animal presence) that favour the presence of sand flies. All the sampling points were quite similar with regard to characterization as green areas, with the exception of point 6, which is the only one with grass, and point 8, the only one lacking bushes. Even so, it is believed that these variables do not interfere, positively or negatively, with the sampling of sand flies. All sampling points had at least one domestic animal present. The importance of the presence of domestic animals and the level of urbanization in a given area are already known to act on the maintenance and urbanization of diseases such as leishmaniasis in several regions of Brazil [19–23].
The composition of the sand fly fauna in the region of Lassance has been previously analysed with results similar to those of the present study [9,11]. However, no data have been presented regarding the sand fly fauna in the urban area of the city, where a high rate of cases is observed of canine leishmaniasis has been observed (unpublished data). Still, considering that the city of Lassance is an area of transition between urban and rural areas, the diversity of sand flies observed corroborates other studies in the Northern Region of the state of Minas Gerais [20,24,25]. Sampling data revealed the presence of putative vectors, such as Lu. longipalpis, Ev. cortelezzii, Ev. sallesi, Ny. intermedia and Ny. neivai [26–33], which is of concern because outbreaks of leishmaniasis may arise from this scenario.
The most abundant species in the study, Lu. longipalpis (77.09%) and Ny. intermedia (10.06%), have great medical importance in the transmission of the etiological agents of visceral and integumentary forms of leishmaniasis and may be involved in the circulation of the parasite in the study area. Lutzomyia longipalpis was found distributed among all sampling points and accounted for more than half of all sand flies captured. The sampling point with the greatest capture of Lu. longipalpis was point 6, this place corresponded to 81.8% of all sand flies collected and also 92.0% of all Lu. longipalpis. This considerable abundance from the same sampling point supports the hypothesis of the existence of local factors that favour such a large number of specimens of Lu. longipalpis. However, when comparing the characteristics of sampling point 6, and its location in the study area, to the other sampling points, we could not identify any differential characteristic that could explain such an abundance.
Still, the dominance of Lu. longipalpis in the study area probably explains the low value for the equitability index (J ’ = 0.34), since the great abundance of only one species tends to impact the uniformity of the others. The strong tendency for similarity among the phlebotomine communities of the sampling points may be due to the great dispersion capacity that these insects possess allowing them to reach the different sampling points in the urban area of Lassance, since most species of sand flies were found in all of them at the same relative abundances.
During October 2018, point 6 was under renovation with the dismantling of a chicken coop housing no chickens. Only one specimen Lu. longipalpis was collected at point 6 during this period, evidencing the amplified relationship between the presence of chickens and sand fly abundance, as has already been reported in other studies [33–36]. However, three other points (5, 7 and 8) had the presence of chicken coops, yet the number of sand flies collected was much lower than for point 6. Field studies aiming to better interpret the preferred places of sand flies are needed to achieve a better understanding of the ecology of these organisms. We note that the months with greatest sampling success were followed by periods of higher levels of relative humidity, suggesting a positive relationship between air humidity and sand fly abundance After drier periods, there was a decrease in sampling success. The relationship between relative air humidity and sand fly abundance was also discussed by Teodoro et al [37] and Macedo et al [38]. We observed no relationship between temperature and sand fly abundance, and believe that it did not interfere with sampling success because of the limited variation between the warmest and coldest periods (only av. 5°C).
Due to limited DNA during the process of individual extraction and of amplified product, only for one sample of those testing positive for PCR of ITS1 was it possible to observe restriction patterns following HAE III digestion. On this occasion, Le. Infantum DNA was detected in a sample from Lu. longipalpis. In addition, 9 samples tested positive for the detection of Leishmania DNA by the ITS1 target. The greater number of positive samples from sampling point 6 probably reflects the greater abundance sampled at the site. Infection of Lu. longipalpis by Leishmania is already well explained in the literature [26,39,40]. The relationship between the species Ny. intermedia and Leishmania is also well known in the scientific community, with this species being involved in the spread of cutaneous leishmaniasis [27,28,33,41]. The cortelezzi complex may also be involved in the transmission of the parasites Le. infantum and Le. braziliensis, however only in one study, also carried out in the region of Lassance, was found promastigotes forms in the mid gut of one species of this complex [30]. The infection rate of 2.10% found in the present study corroborates the molecular detection of Leishmania in sand flies mentioned in the work of Tonelli et al. [42]. With respect to Sc. sordellii, this species has already been found with DNA from Leishmania [43,44], however these reports should be viewed with caution as the genus Sciopemyia feeds on cold-blooded animals [45,46].
We separated the occurrences of Lu. longipalpis and Ny. intermedia among the sampling points and distributes on the map of Lassance, thus creating a distribution of risk areas in the study area. The area of sampling point 6 has the highest risk of transmission of leishmaniasis given the sampled abundance of Lu. longipalpis (65.13%) and Ny. intermedia (6.73%), and because Le. infantum was detected there. In the other regions, the species in question are distributed in approximately 0.6% for Lu. longipalpis and 0.09% for Ny. intermedia.
The present study represents the first phlebotomine faunal survey carried out in the municipality of Lassance, Minas Gerais. The results obtained demonstrate the circulation of the parasite Le. infantum, of vector species and of species with potential for playing a role in the epidemiology of leishmaniasis in Lassance. The strong predominance of Lu. longipalpis draws attention to the high risk of transmission and dissemination of new cases of visceral leishmaniasis at the site. Finally, the present study demonstrates the need to conduct more in-depth studies in the field in order to elucidate pertinent questions regarding the preferred places and possible characteristics of the environment that influence sand fly abundance.
References
- 1. Akhoundi M, Kuhls K, Cannet A, Votýpka J, Marty P, Delaunay P, et al. A Historical Overview of the Classification, Evolution, and Dispersion of Leishmania Parasites and Sandflies. PLoS Negl Trop Dis. 2016; 10(3): e0004349. pmid:26937644
- 2.
Shimabukuro PHF, Andrade AJ, Galati EAB 2021. Phlebotominae in Catálogo Taxonômico da Fauna do Brasil. PNUD. <http://fauna.jbrj.gov.br/fauna/faunadobrasil/3297>. Accessed on: 09 Jun 2021.
- 3. Campos AM, Maia RdA, Capucci D, Paglia AP, Andrade Filho JD (2020) Species composition of sand flies (Diptera: Psychodidae) in caves of Quadrilátero Ferrıífero, state of Minas Gerais, Brazil. PLoS ONE 15(3): e0220268. pmid:32155153
- 4. Tanure A, Rêgo FD, Tonelli GB, Campos AM, Shimabukuro PHF, Gontijo CMF, et al. (2020). Diversity of phlebotomine sand flies and molecular detection of trypanosomatids in Brumadinho, Minas Gerais, Brazil. PLoS ONE 15(6): e0234445. pmid:32579586
- 5. Cardoso MS, Bento GA, de Almeida LV, de Castro JC, Reis-Cunha JL, Barbosa VdA, et al. (2019) Detection of multiple circulating Leishmania species in Lutzomyia longipalpis in the city of Governador Valadares, southeastern Brazil. PLoS ONE 14(2): e0211831. pmid:30721272
- 6. Forattini OP, Rabello EX, Serra OP, Cotrim MD, Galati EAB, Barata JMS. Transmission of cutaneous leishmaniasis in the State of S. Paulo, Brazil. Rev Saúde Públ. 1976; 10:31–43.
- 7.
Sherlock IA. Importância Médico-Veterinária: A importância dos flebotomíneos. In Rangel EF & Lainson R, editores. Flebotomíneos do Brasil. Rio de Janeiro: Editora Fiocruz 2003; 15–21.
- 8.
Secretaria de Vigilância em Saúde. Departamento de Vigilância Epidemiológica. Sistema de Informação de Agravos de Notificação—SINAN. Brasília: Editora do Ministério da Saúde, 2021.
- 9. Saraiva L, Carvalho GML, Sanguinette CC, Carvalho DAA, Falcão AL, Andrade Filho JD. Sandflies (Diptera: Psychodidae: Phlebotominae) collected on the banks of the Velhas River in the state of Minas Gerais, Brazil. Mem Inst Oswaldo Cruz, Rio de Janeiro. 2008, Vol. 103(8): 843–846. pmid:19148428
- 10. Saraiva L, Carvalho GM, Gontijo CM, Quaresma PF, Lima AC, Falcão AL, Andrade Filho JD 2009. Natural infection of Lutzomyia neivai and Lutzomyia sallesi (Diptera: Psychodidae) by Leishmania infantum chagasi in Brazil. J Med Entomol. 2009, 46: 1159–1163. pmid:19769049
- 11. Saraiva L, Carvalho GML, Sanguinette CC, Carvalho DAA, Andrade Filho JD. Biogeographical aspects of the occurrence of Nyssomyia neivai and Nyssomyia intermedia (Diptera: Psychodidae) in a sympatric area of the Brazilian savannah. Mem Inst Oswaldo Cruz, Rio de Janeiro. 2012, Vol. 107(7): 867–872.
- 12. Carvalho GML, Brazil RP, Sanguinette CC, Andrade Filho JD. Description of Evandromyia spelunca, a new phlebotomine species of the cortelezzii complex, from a cave in Minas Gerais State, Brazil (Diptera: Psychodidae: Phlebotominae). Parasites & Vectors, 2011, v. 4, p. 158.
- 13. Carvalho GMdL, Brazil RP, Saraiva L, Quaresma PF, Botelho HA, Ramos MCdNF, et al. Hourly Activity and Natural Infection of Sandflies (Diptera: Psychodidae) Captured from the Aphotic Zone of a Cave, Minas Gerais State, Brazil. PLoS ONE, 2012, 7(12): e52254. pmid:23284957
- 14. Carvalho GML, Brazil RP, Rego FD, Ramos MCNF, Zenóbio APLA, Andrade Filho JD. Molecular detection of Leishmania DNA in wild-caught phlebotomine sand flies (Diptera: Psychodidae) from a cave in the state of Minas Gerais, Brazil. Journal of Medical Entomology, 54(1), 2017, 196–203. pmid:28082647
- 15.
INSTITUTO BRASILEIRO DE GEOGRAFIA E ESTATÍSTICA. Lassance, 2019. < https://cidades.ibge.gov.br/brasil/mg/lassance/panorama >. Access in: 09 Jan 2021.
- 16. Chagas Carlos. Descoberta do Tripanozoma cruzi e verificação da Tripanozomiase Americana. Memórias do Instituto Oswaldo Cruz. 1922. p. 67–76.
- 17.
Galati EAB. Phlebotominae (Diptera, Psychodidae): Classification, morphology and terminology of adults and identification of American Taxa. Brazilian Sand Flies: Biology, Taxonomy, Medical Importance and Control. Springer International Publishing. 2018, pp. 9–212.
- 18. Marcondes CB. A proposal of generic and subgeneric abbreviations for phlebotomine sandflies (Diptera: Psychodidae: Phlebotominae) of the world. Entomol News,. 2007; 118: 351–356.
- 19. Luz ZMP, Pimenta DN, Cabral ALLV, Fiúza VOP, Rabello A. A urbanização das leishmanioses e a baixa resolutividade diagnóstica em municípios da Região Metropolitana de Belo Horizonte. Revista da Sociedade Brasileira de Medicina Tropical 2001, 34: 249–254. pmid:11460210
- 20. Monteiro EM, Silva JCF, Costa RT, Costa DC, Barata RA, Paula EV, et al. Leishmaniose visceral: estudo de flebotomíneos e infecção canina em Montes Claros, Minas Gerais. Revista da Sociedade Brasileira de Medicina Tropical, 2005, 38(2):147–152. pmid:15821789
- 21. Costa CHN. Characterization and speculations on the urbanization of visceral leishmaniasis in Brazil Cad. Saúde Pública, Rio de Janeiro, 2008, 24(12):2959–2963.
- 22. Albuquerque PLMM, Silva GB Júnior, Freire CCF, Oliveira SBC, Almeida DM, Silva HF, et al. Urbanization of visceral leishmaniasis (kala-azar) in Fortaleza, Ceará, Brazil. Rev Panam Salud Publica. 2009; 26(4):330–3. pmid:20107681
- 23. Lacerda AFA, Oliveira DS, Salomão JVF, Oliveira LGR, Monte-Alegre A, Santos JYG, et al. Clinical, epidemiological and transmission cycle aspects of leishmaniasis urbanization in Barreiras, Bahia, Brazil, Spatial and Spatio-temporal Epidemiology, Volume 36, 2021, 100395, ISSN 1877-5845, pmid:33509434
- 24. Rêgo FD, Shimabukuro PHF, Quaresma PF, Coelho IR, Tonelli GB, Silva KMS, et al. Ecological aspects of the Phlebotominae fauna (Diptera: Psychodidae) in the Xakriabá Indigenous Reserve. Brazil Parasit Vectors. 2014;7:220. pmid:24886717
- 25. Sanguinette CC, Silva DF, Stumpp RGAV, Rego FD, Tonelli GB, Tanure A, et al. Comparison of the phlebotomine (Diptera: Psychodidae) fauna of urban, transitional, and wild areas in northern Minas Gerais, Brazil. Parasites & Vectors, 2015, 8:428.
- 26. Ryan L, Silveira FT, Lainson R, Shaw JJ. Leishmanial infections in Lutzomyia longipalpis and Lu. antunesi (Diptera: Psychodidae) on the island of Marajó, Pará State, Brazil. Transactions of The Royal Society of Tropical Medicine and Hygiene, 1984, 78, 547–548. pmid:6485061
- 27. Gontijo CMF, Silva ES, Fuccio MB, Sousa MCA, Pacheco RS, Dias ES, et al. Epidemiological studies of an outbreak of cutaneous leishmaniasis in the Rio Jequitinhonha Valley, Minas Gerais, Brazil. Acta Tropca. 2002, Vol 81, Issue 2, Pages 143–150. pmid:11801221
- 28. Pita-Pereira D, Alves CR, Souza MB, Brazil RP, Bertho AL, Barbosa AF, et al. Identification of naturally infected Lutzomyia intermedia and Lutzomyia migonei with Leishmania (Viannia) braziliensis in Rio de Janeiro (Brazil) revealed by a PCR multiplex non-isotopic hybridisation assay. Transactions of the Royal Society of Tropical Medicine and Hygiene, 2005, 99, 905–913. pmid:16143358
- 29. Carvalho GM, Andrade Filho JD, Falcao AL, Rocha Lima AC, Gontijo CM. Naturally infected Lutzomyia sand flies in a Leishmania-endemic area of Brazil. Vector Borne Zoonotic Dis, 2008, 8: 407–414. pmid:18429695
- 30. Marcondes CB, Bittencourt IA, Stoco PH, Eger I, Grisard EC, Steindel M. Natural infection of Nyssomyia neivai (Pinto, 1926) (Diptera: Psychodidae, Phlebotominae) by Leishmania (Viannia) spp. in Brazil. Transactions of The Royal Society of Tropical Medicine and Hygiene, 2009, Vol 103, Issue 11, 1093–1097. pmid:19178921
- 31. Saraiva L, Carvalho GM, Gontijo CM, Quaresma PF, Lima AC, Falcão AL, Andrade Filho JD. Natural infection of Lutzomyia neivai and Lutzomyia sallesi (Diptera: Psychodidae) by Leishmania infantum chagasi in Brazil. J Med Entomol, 2009, 46: 1159–1163. pmid:19769049
- 32. Souza CM, Soares RPP, Andrade Filho JD, Xavier DC, Saraiva L, Fonseca AL, et al. Phlebotomine sand flies (Diptera: Psychodidae) and Leishmania infection in Gafanhoto Park, Divinópolis, Brazil. Journal of Medical Entomology. 2010, v. 47, n. 6, p. 1212–1219. pmid:21175074
- 33. Rêgo FD, Rugani JMN, Shimabukuro PHF, Tonelli GB, Quaresma PF, Gontijo CMF. Molecular Detection of Leishmania in Phlebotomine Sand Flies (Diptera: Psychodidae) from a Cutaneous Leishmaniasis Focus at Xakriabá Indigenous Reserve, Brazil. PLoS ONE, 2015, 10(4): e0122038. pmid:25853254
- 34. Feliciangeli MD. Natural breeding places of phlebotomine sandflies. Med Vet Entomol, 2004, 18: 71–80. pmid:15009450
- 35. Oliveira AG, Galati EA, Fernandes CE, Dorval ME, Brazil RP. Ecological aspects of phlebotomines (Diptera: Psychodidae) in endemic area of visceral leishmaniasis, Campo Grande, state of Mato Grosso do Sul, Brazil. J Med Entomol, 2012, 49: 43–50. pmid:22308770
- 36. Casanova C, Andrighetti MT, Sampaio SM, Marcoris ML, Colla-Jacques FE, Prado AP. Larval breeding sites of Lutzomyia longipalpis (Diptera: Psychodidae) in visceral leishmaniasis endemic urban areas in southeastern Brazil. PLoS Negl Trop Dis, 2013, 7: e2443. pmid:24069494
- 37. Teodoro U, Filho VLS, Lima EM, Spinosa RP, Barbosa OC, Ferreira MEMC, et al. Flebotomíneos em área de transmissão de leishmaniose tegumentar na região norte do Estado do Paraná—Brasil: Variação Sazonal e Atividade Noturna. Ver. Saúde Pública, 1993, 27(3): 190–4.
- 38. Macedo ITF, Bevilaqua CML, Morais NB, Sousa LC, Linhares FE, Amóra SS, et al. Sazonalidade de flebotomíneos em área endêmica de leishmaniose visceral no município de Sobral, Ceará, Brasil. Ciência Animal, 2008, 18(2):67–74.
- 39. Guimarães-e-Silva AS, Silva SdO, Ribeiro da Silva RC, Pinheiro VCS, Rebêlo JMM, Melo MN. Leishmania infection and blood food sources of phlebotomines in an area of Brazil endemic for visceral and tegumentary leishmaniasis. PLoS ONE, 2017, 12(8): e0179052. pmid:28837565
- 40. Rego FD, Soares RP. Lutzomyia longipalpis: an update on this sand fly vector. An Acad Bras Cienc. 2021, 93(3): e20200254 pmid:33950136
- 41. Saraiva L, Andrade Filho JD, Silva SO, Andrade ASR, Melo MN. The molecular detection of different Leishmania species within sand flies from a cutaneous and visceral leishmaniasis sympatric area in Southeastern Brazil. Memórias do Instituto Oswaldo Cruz, Rio de Janeiro, 2010, Vol. 105(8): 1033–1039. pmid:21225201
- 42. Tonelli GB, Tanure A, Rêgo FD, Carvalho GMDL, Simões TC, Andrade Filho JD. Aspects of the ecology of phlebotomine sand flies (Diptera: Psychodidae) in the Private Natural Heritage Reserve Sanctuary Caraça. PLoS One, 2017, 12(6), e0178628. pmid:28570640
- 43. Da-Silva YY, Sales KGS, Miranda DEO, Figueredo LA, Brandão-Filho SP, Dantas-Torres F. Detection of Leishmania DNA in Sand Flies (Diptera: Psychodidae) From a Cutaneous Leishmaniasis Outbreak Area in Northeastern Brazil. J Med Entomol. 57. 2020; 529–533. pmid:31693145
- 44. Guimarães VC, Costa PL, Silva FJ, Melo FL Melo, Dantas-Torres F, Rodrigues EH, et al. Molecular detection of Leishmania in phlebotomine sand flies in a cutaneous and visceral leishmaniasis endemic area in northeastern Brazil. Rev Inst Med Trop. 2014; 56: 357–360.
- 45. Tesh RB, Chaniotis BN, Aronson MD, Johnson KM. Natural host preferences of Panamanian phlebotomine sandflies as determined by precipitin test. Am J Trop. Med Hyg 1971; 20: 150–156. pmid:5567741
- 46. Costa JCR, Marchi GH, Santos CS, Andrade MCM, Chaves SP Junior, Silva MAN, et al. First molecular evidence of frogs as a food source for sand flies (Diptera: Phlebotominae) in Brazilian caves. Parasitol Res. 2021; 120: 1571–1582. pmid:33852067