Mitochondrial DNA and RNA isolation and mitogenome assembly

The plant tissue of a cultivated C. debaoensis tree was collected from Shenzhen Fairy Lake Botanical Garden, Shenzhen, China. No specific permission was required for collection of plant sample used in current study. The sample was identified by Zhang Shouzhou, and the voucher specimen ((No. ZhangSZ2020001) was deposited in SZG (Herbarium of Shenzhen Fairy Lake Botanical Garden, Shenzhen, China). Genomic DNA and RNA was isolated using the CTAB method with modifications described by [30]. The quality and quantity of DNA and RNA were examined using 1% Agarose gel electrophoresis and Qubit fluorometer, respectively. After extraction, 20 μg high-quality DNA were subjected to Nanopore sequencing on an ONT PromethlON 48 platform at Nextonomics (Wuhan, China). About 1 μg of high quality DNA and RNA were fragmented and used to construct paired-end NGS sequencing libraries of insert size 350 and 200 bp, respectively, according to the manufacturer’s instructions (Illumina, CA, USA), and then sequenced on an Illumina HiSeq 2000 at NextonOmics Biosciences (Wuhan, China).

The raw genomic and transcriptomic reads were trimmed and filtered for adaptors, low quality and duplicate reads using Trimmomatic (https://github.com/timflutre/trimmomatic). The long Nanopore reads were then de novo assembled using NextDenovo (https://github.com/Nextomics/NextDenovo). The raw genome assembly were polished using Illumina paired-end reads using Pilon [31] for three times. The corrected genome assembly was then searched by blast using the previously published mt genome of C. taitungensis (AP009381). One mt contig of 527,762 bp was found as a result. Sequencing depth and read coverage of this contig was checked with Illumina DNA-seq reads. The resultant mt contig was overlapped with at the two ends, yielding a circular chromosome of 413,715 bp.

The draft mitogenome of C. debaoensis was annotated as previously described by [8, 9]. Briefly, protein coding genes (PCGs) and rRNA genes were annotated by Blastn searches of the non-redundant database at National Center for Biotechnology Information (NCBI) website. The exact gene and exon/intron boundaries were manually adjusted in Geneious v10.0.2, (Biomatters, www.geneious.com) and further corroborated by aligning each gene to its orthologs from currently available annotated plant mitochondrial genomes at NCBI (www.ncbi.nlm.nih.gov/genome/organelle). The tRNA genes were identified using tRNAscan-SE 2.0 [32]. The annotated C. debaoensis mitochondrial genome assembly is deposited to CNGB Sequence Archive (CNSA) of China National GeneBank DataBase (CNGBdb) with accession number CNA0019277, and read mapping file in fastq format was submitted to GenBank under the accession number of SRR13558328. The mitogenome map (Fig 1) was drawn using OGDRAW v1.2. [33].

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. The map of mitochondrial genome of Cycas debaoensis.

Genes (along with exon numbers) shown inside and outside of the circle are transcribed in clockwise and counter-clockwise directions, respectively. Plastid derive tRNAs are indicated with a ‘-cp’ suffix.

https://doi.org/10.1371/journal.pone.0255091.g001

Repeats, tandem repeats, Bpu-like elements and plastid derive repeats

Repeats identification of C. debaoensis mt genome (≥ 50 bp) was done using ROUSFinder.py script following the procedure of Wynn & Christensen [34], and tandem repeats (TRs) were detected using Tandem Repeats Finder using default parameters [35]. Bpu-like elements and plastid homologous sequences were identified using Blastn (E-value ≤ 1e-6, word size = 7), as described by [9]. Briefly, C. taitungensis 36 Kb Bpu-like consensus sequence (AAGGTTATCCCTTTCCTGAGCGTAGCGAAGGGAAGG) described by [8] was used as a query to search the Bpu-like elements in C. debaoensis and C. taitungensis, with 7 mismatches (including gaps) to the 36 Kb Bpu-like consensus sequence (known as dominant type Bpu-like sequence hereafter) were allowed for calculations. For searching of plastid derived (cp) sequences, C. debaoensis mt genome was blasted against the available cp genomes of Cycas at NCBI. Genes with simultaneous occurrences in cp and mt genome (atp1/atpA, rpl16, rps4, rrn26/rrn23, and rrn18/rrn16) were not considered.

Identification of genome rearrangements and DSBR protein analyses

Forty-six representative species of land plants including six gymnosperm mt genomes (excluding the highly fragmented mt-genomes of Pinacea) were selected to determine the inter-generic and inter-species genome rearrangements among gymnosperms and other major land plant groups (S1 Table). The data matrix was constructed based on the order of all PCGs, rRNA and tRNA in the genome along with their transcriptional direction, excluding foreign or non-functional pseudo genes (S1 Table). Duplicated genes and parts of trans-spliced genes were treated independently. The final data matrix was then used to identify genome rearrangements. Pairwise comparison of the mt genomes was conducted using double cut and join (DCJ) model under the likelihood criterion [36], implemented with UniMoG [37]. This program estimates the minimal rearrangement events between a pair of mt genomes. The phylogenetic tree topologies for these representative taxa were drawn from 1KP project [38], and visualized with heatmap of mt genome rearrangements using the online platform OmicShare tools (http://www.omicshare.com/tools/Home/Soft/heatmap).

Genome stability and prohibition of the recombination between repeated DNA sequences was linked to the nuclear encoded double-strand break repair (DSBR) proteins [39]. Relative expansion of these gene family members in mitochondrial genomes can explain the enhance of nuclear surveillance of DSBR protein maintaining the mt genomic structures and function. Characterization of six frequently reported DSBR proteins i.e., MSH [40], RecA [41, 42]; RecX [4], RecG [43], OSB [44], and the Whirlies [45, 46], was conducted following the steps described by [4]. Sixteen vascular plant species with majority of them from gymnosperms were selected for analyses (S2 Table). HMMER [47] was used to perform Hidden Markov Model (HMM) searches at E-value of 1e-6 and alignment length ≥ 50%, using Pfam domains of RecA (PF00154; RecA gene), RecX (PF02631; RecX gene), SSB (PF00436; OSB gene), MutS_V (PF00488; MSH gene), Whirly (PF08536; Why gene), and DEAD and Helicase_C (PF00270, PF00271; RecG gene) as query to search the annotated proteins in selected vascular plant species. The resultant protein sequences from HMMER search were then validated using the SMART [48] and Pfam [49] databases, and aligned using MAFFT under default parameters [50]. Using maximum likelihood criterion, the final alignment was used to construct the phylogeny in IQ-TREE [51] with 1,000 bootstrap replicates. The subcellular locations of DSBR proteins were predicted using TargetP 1.1 webserver [52] and their homologs were identified at the online database UniProt (https://www.uniprot.org/peptidesearch/).

RNA editing site identification

RNA editing sites were predicted for C. debaoensis protein coding genes (CDS) using the online tool PREP-Mt [53], with the default cutoff score set to 0.2. Availability of high depth RNA-seq data made it possible to calculate the empirical RNA-editing sites on protein coding genes (CDS) in C. debaoensis. As PREP-Mt predicts the nonsilent RNA editing sites, we only compare the predicted RNA-editing sites to the empirically annotated RNA-editing sites on CDS of C. debaoensis, following the methods described in [54] and [55]. Briefly, RNA-seq clean reads were mapped to the reference genome file containing the CDS of C. debaoensis using Tophat2 [56]. The accepted mapping hits in bam format were sorted using Samtools [57] and Bcftools [58]. The resultant vcf file was used to generate the snp file using a perl script (Dryad Digital Repository, accession 10.5061/dryad.nzs7h44ms). Potential genomic SNPs were then removed manually by filtering the RNA editing annotation file against the SNP sites by their positions on the genome sequence. Finally, the annotation file of RNA editing sites was manually checked against transcriptome mapping bam file in Geneious v10.0.2 to acquire exact number of RNA editing sites. The WGS read mapping file and transcriptome mapping bam file have been deposited in the Short Read Achieve (SRA) database of NCBI under the accession number of SRR13558328 and SRR13528745, respectively.

Furthermore, we investigated whether the editing frequencies in gymnosperm species are shaped by selection constraint on genes as suggested by Jobson and Qiu [59]. Three gymnosperm taxa included in the analysis are C. debaoensis, G. biloba and T. cuspidata. We calculate the gene-specific rates of evolution, at both synonymous (d_S) and nonsynonymous (d_N) sites estimated using CODONML implement in PAML [60]. Editing frequency (%) for each gene is calculated as{(A [number of edited sites]/B [gene length]) × 100}.

Genome size and gene content of C. debaoensis

The C. debaoensis mitogenome is assembled into a single circular molecule of 413,715 bp (CNGBdb accession: CNA0019277), a size in similar range to C. taitungensis, G. biloba and T. cuspidata with genome size of 414 Kb, 346 Kb and 414 Kb, respectively. However, W. mirabilis (978 Kb) and species of Pinaceae (P. taeda, 1.19 Mb [https://www.ncbi.nlm.nih.gov/nuccore/NC_039746.1/] P. glauca, 5.9 Mb [17]; P. abies, 4.3 Mb [16]; P. sitchensis, 5.5 Mb [18]; P. lambertiana, 3.9 Mb [19]; P. sylvestris, 986 Kb [https://www.ncbi.nlm.nih.gov/assembly/GCA_900143225.1/]; L. sibirica, 11.7 Mbp [6]) have extremely expanded mitochondrial genomes. We compare the general features of mitogenomes of representative taxa of all five major lineages of gymnosperms (Table 1). C. debaoensis mitogenome has a GC content of 46.9% (Table 1), similar to C. taitungensis that with a GC content of 46.9%, and lies within a range (i.e., < 50%) of P. taeda, early angiosperms [61], and two lycophytes species (Huperzia and Isoetes). However, GC content of G. biloba, W. mirabilis, T. cuspidata, and ferns mt genomes is found to be > 50%. Consistent with C. taitungensis, mitogenome of C. debaoensis encodes 69 unique genes, containing 40 protein coding genes, 26 tRNAs, and a same set of 3 rRNA genes (rrn5, rrn16, and rrn26) as in angiosperms (Table 1). The total gene length of Cycas is about 87.7 Kb, which accounts for 21% of the total mt genome length, including about 32 Kb (8.4% of total genome length and 36% of total gene length) of protein coding sequences. The protein exon length among observed gymnosperm species lies within the range of 29.7 Kb in W. mirabilis (29 PCGs), to 34 Kb in G. biloba (41 PCGs), which accounts for only 3% and 9.8% of the total gene length, respectively. Although, there is significant difference in the number of mitochondrial genes, the variation of noncoding DNA content is the major contributor towards large size mitogenomes of gymnosperms [7, 20]. In addition to gene content, other factors associated with mitogenome expansion include foreign sequences, size and number of repeated sequences [10, 62–65]. However, in case of gymnosperms, an ample amount of unidentified DNA denoted to the mitogenome expansion [9, 22], and the above mentioned factors have negligible contribution towards overall mitogenome length variation (Table 1).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 1. General features of mitochondrial genomes of gymnosperms.

https://doi.org/10.1371/journal.pone.0255091.t001

Evolution of intron content of Cycas and across land plants

The evolution of intron content is conservative with comparison of the two Cycas mitochondrial genomes. Twenty-six group II introns disrupt 10 protein coding genes (ccmFC, cox2, nad1, nad2, nad4, nad5, nad7, rpl2, rps3, rps10) in mt-genomes in both Cycas species (Table 1), including 21 cis-spliced (adding up to 51 Kb and 12.3% of total genome length) and 5 trans-spliced introns (i.e., nad1i394, nad1i669, nad2i542, nad5i1455, and nad5i1477). The early diverging Pinus and Cycas mt genomes retain ancestral intron content of seed plants (26 introns). However, in addition to five shared trans-spliced introns, eight more introns are shifted from cis- to trans- spliced in P. taeda, Picea abies and Picea glauca mt-genomes (Fig 2). Intron content of G. biloba (30 Kb; 11%) only differs from Cycas owing to the loss of one intron (rps10i235) in it (Table 1). The intron content is greatly declined in subsequent lineages, e.g., T. cuspidata and W. mirabilis maintain 15 and 10 introns, respectively (Fig 2). Most of the seed plant mitochondrial introns are first evolved in ferns as Psilotum and Ophioglosum share 23 and 19 introns with seed plants, respectively. However, trans-splicing of nad1i394, nad1i669, nad2i542, nad5i1455, and nad5i1477 introns predominantly occurs in gymnosperms and angiosperms (Fig 2). Liverworts lack all of these group II introns, except nad2i709. However, hornworts and mosses share 10 group II introns with seed plants (Fig 2). Mitochondrial intron content is highly conserved within major lineages of land plants, though varies greatly among them. Overall, intron loss and trans-splicing is most prevalent in gymnosperms in comparison to other land plants. The gradual intron losses from early diverging lineages to the derived ones in gymnosperms may be related to retro-processing events for the introns removed at 3’ ends, or selective pressure to retain the introns at near to 3’ and 5’ ends [20].

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. Distribution pattern of 26 ancestral seed plant introns among land plants.

+, trans,—and Ψ indicates presence of an intron, trans-splicing intron, missing gene and pseudogenization, respectively. Phylogenetic tree is inferred from 1KP project [38].

https://doi.org/10.1371/journal.pone.0255091.g002

Repeats, tandem repeats and Bpu-like elements

Mitochondrial genome of C. debaoensis appears to have 1,569 repeated sequences of longer than 50 bp, adds up to 51.7 Kb in length, i.e., 12.5% of the total mt genome length (Table 1). C. taitungensis contains 1,522 repeated sequences of a total of 54.3 Kb in length, which accounts for about 13% of the total genome. Interestingly, no large repeats (> 1 Kb) are found in C. debaoensis, compared to C. taitungensis having 2 large repeats. Both species share numerous repeats of intermediate (100–900 bp) and short length (< 100 bp). The repeated sequence proportion of gymnosperms covers about 9–14% of the total mt genome length, except for W. mirabilis with only 5% of repetitive sequence in its mt genome (Table 1). The proportion of repetitive sequences varies greatly among major land plant groups. The earliest land plants have few (mosses), to an average of 4.5% (liverworts) of repeated sequences in their mt-genomes [4, 24]. On the other hand, ferns (Psilotum about 57% of genome; Ophioglossum about 40% of genome) and also angiosperm species such as Nymphaea (49%) have the most repeat-rich mitogenomes [7, 22].

Repeat insertion events are considered contributing significantly to intron size expansion [7, 66]. Comparing the length of 26 cis-spliced introns found in Cycas with four gymnosperms (G. biloba, P. taeda, T. cuspidata, and W. mirabilis) and other vascular plant representatives reveals that ferns (Ophioglossum, Psilotum), Cycas, and P. taeda have introns of relatively longer in length along with abundant repeated sequences, as compared to lycophytes and angiosperms (Table 2). Intron lengths of cox2i691, nad2i1282, nad4i1399, nad4i976 and nad7i676 are > 1000 bp longer, and of rpl2i917 was > 500 bp longer in Cycas than in any of their gymnosperm counterparts (Table 2). Whereas, ccmFci829, rps10i235 and rps3i257 are > 1000 bp longer in P. taeda than all other observed taxa (Table 2). These elongated introns appear to have abundant repeated sequences, which are responsible for longer introns in Cycas and P. taeda mt genomes. Moreover, C. debaoensis mt genome contain 23 Kb (5.7% of total genome length) of tandem repeat sequences (TRs), which is comparable to C. taitungensis having 22 Kb (5.3%) of tandem repeats (Table 1). Despite the considerable disparity among TRs proportion in gymnosperms, their impact on overall genome size expansion is trivial.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 2. Intron size variations among vascular plant mitogenomes.

https://doi.org/10.1371/journal.pone.0255091.t002

C. taitungensis mitogenome contained abundant short interspersed repetitive elements known as Bpu-like sequences/elements [8]. These mobile elements are characterized by having two conserved terminal direct repeats (AAGG) and a recognition site for the restriction endonuclease, known as Bpu10I (CCTGAAGC; nt 15–21). We retrieve 486 variants of Bpu-like elements in C. debaoensis using the dominant type Bpu-like sequence as a query. Among these variants, 251 Bpu-like sequences show 100% identity to the dominant 36 bp Bpu-like sequence. Another 41 sequences are 100% identical to the dominant Bpu-like sequence, but with reduced sequence length of 29–35 bp (S3 Table). Using the same parameters, C. taitungensis is found to have 504 variants of Bpu-like elements, 309 of them are 100% identical to the dominant type 36 bp Bpu-like sequence (S3 Table). Moreover, another 36 Bpu-like elements of 30–35 bp are 100% identical to the dominant type Bpu-like sequence. Bpu-like insertion sites for C. debaoensis and C. taitungensis are mostly found to be orthologous (S3 Table). Using the same parameters, we blast the Bpu-like-elements against the G. biloba, T. cuspidata, W. mirabilis and P. taeda mt genomes. G. biloba is found to have 19 Bpu-like sequence with only one (35 bp) of them showing 100% identity to the dominant type of Bpu-like elements in Cycas (Table 1). All the other Ginkgo Bpu-like variants are differed from the dominant Cycas Bpu-like sequence at position 9 (C to A), 17 (T to C) and 28 (A to G), but have conserved terminal repeats (position 1–4 and 33–36) and Bpu10I endonuclease recognition site (position 15–21) similar to Cycas. Using this Ginkgo Bpu-like consensus sequence (AAGGTTATACCTTTCCCGAGCGTAGCGGAGGGAAGG), nearly 100 variants of Bpu-like elements are identified in G. biloba [9]. Bpu-like elements are missing in other gymnosperm mitogenomes (Table 1). These results confirm the expansion of Bpu-like elements only in Cycas and G. biloba. Based on the most recent phylogenetic reconstruction of cycad [67], C. taitungensis belonged to the earliest diverging Clade I (Sections Panzhihuaenses and Asiorientales), and C. debaoensis was classified to be part of partially supported clade II (The core Stangerioides clade). Comparing the two Cycas mt genomes, Bpu-like elements appears to be static in Cycas evolution, possibly since the divergence between cycads and ginkgo, which might imply some functional significance.

Genome structural evolution across land plants, and repeat-triggered recombinations in Cycas

We explore the inter-species and inter-generic mitogenome rearrangement across the major land plant groups along with the number of repeats, and then plotted the results beside a phylogenetic gradient of land plants. It is generally believed that repeated sequences (≥ 50 bp) within the mitochondrial genome create opportunities for intragenomic recombination [23, 40, 68]. Such events involve a crossing-over via homologous recombination between repeated sequences inside a circular genome [39], and result in a novel genome structure. Inter-species and inter-generic rearrangements within bryophytes are not much prominent due to their relatively conserved mitogenomes with fewer number of repeats. Mosses with fewer repeated sequences required 2–4 and 6 inter- and infra-generic rearrangements, respectively. Liverworts with repeated sequences of intermediate abundance among bryophytes, have nearly static mitogenomes. Hornworts appeared to have more number of repeats than mosses and liverworts. Only one inter-specific translocation event occurred among two Anthoceros species, and a maximum of 3 inter-generic rearrangements among the observed taxa (Fig 3; S4 Table). Hence, the relationship between number of repeats and genomic rearrangements is not fully supported in bryophytes. However, in angiosperms, inter-specific rearrangements are reported in all of the observed taxa with fairly large number of repeats (Fig 3). Angiosperms require 11 rearrangements on average to get collinear gene order at infra-generic level. Surprisingly, despite having large number of repeats (>1500), mitogenomes of C. debaoensis and C. taitungensis share exactly a same gene order. Whereas, 34, 44, 32, and 34 rearrangements are required by Cycas mt genomes to get complete collinearity with that of the G. biloba, P. taeda, T. cuspidata, and W. mirabilis, respectively (Fig 3; S4 Table). In pairwise comparison, gymnosperm mitogenome require a minimum of 27 (between P. taeda and W. mirabilis) to a maximum of 44 (between P. taeda and Cycas) rearrangements to get the same gene order. Any two gymnosperm mitogenome varies by 31 rearrangements on average (Fig 3; S4 Table). The strict collinearity among the gene order along with the identical set of genomic content in Cycas mt genomes confirm their structural stability, lack of recombination, and support the hypothesis that repeats may not be sufficient for recombination to occur within the mt genomes [4].

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. Heat map of mitochondrial gene order rearrangements in pairwise comparison of 46 representative taxa of major land plant groups along with phylogenetic tree based on the 1KP project [38].

The number of repeats detected for each species are listed beside the tree.

https://doi.org/10.1371/journal.pone.0255091.g003

Genomic rearrangements in mt genomes presumably accompany by cis- to trans-spliced intron transitions. Bryophytes have fewer or no rearrangements in each major group, and lacks the trans-spliced introns in their mitogenomes (Figs 2 and 3). However, Sleginella moellendorffii (lycophyte) has extensively rearranged mitochondrial genome and with four trans-spliced introns [13]. Conversely, angiosperm mitogenomes with numerous trans-spliced introns show extensive DNA rearrangement (Figs 2 and 3). Among gymnosperms, our analyses of genomic rearrangements indicate that P. taeda with highest number of trans-spliced intron (13 trans-spliced introns) need 44 and 42 rearrangements to get collinearity with early diverging Cycas and G. biloba. Furthermore, Picea mt genomes are also appeared to be highly recombinogenic [22] along with extensive trans-splicing events. Thus, the occurrence of trans-splicing with recombinogenic mitogenomes in gymnosperms suggests that shifts from cis- to trans-splicing in plant mitochondria is mainly caused by genomic rearrangements [21].

Nuclear surveillance of mt genome stability of Cycas

The overall stability in gene content and genome structure in Cycas mt genomes is significant. The structural stability of mt genomes is related to the nuclear encoded DSBR genes, which hinders the homologous recombinations, by monitoring the accuracy of mitochondrial genome repair [39]. Six frequently reported DSBR genes include the RecA, OSB, MSH, RecX, Why, and RecG [4, 40, 43–45]. We have screened the exemplars of the major vascular plant groups along with seven representatives from major gymnosperm lineages (S2 Table) for these genes and gene families, and analyze their copy numbers in gymnosperms. Phylogenetic reconstruction of six DSBR genes reveals relatively higher expansion of three DSBR protein families (RecA, OSB, and RecG) in C. debaoensis nuclear genome (S1 Fig). Similar set of DSBR proteins are found to be expanded in liverworts, causing their compact mt genomes [4]. These DSBR proteins also show considerable expansion in G. biloba and P. taeda as compared to other land plant representatives, which suggests possible existence of mt genome stability within these two groups. G. biloba also found to have limited repeat mediated recombinational activity [9], which indicates that these nuclear encoded proteins perform a certain level of recombination surveillance, controlling homologous recombination within the mitogenome. Although subcellular localization and in vivo function of some of these DSBR proteins needs further investigation, the notable expansion of these protein families among compact mt genomes such as in liverworts [4] and Cycas (present study) cannot be completely neglected.

Plastid derived sequences

The C. debaoensis mitogenome possesses 22 plastid derived insertions ranging from 62 bp to 2,707 bp (Table 3) encompassing the total length of 16 Kb, which accounts for 3.8% of total mt genome length. These plastid-derived sequences are similar to C. taitungensis plastid insertions with slight variation in length (i.e., 17 Kb; 4%). These plastid insertions include three functional tRNAs trnHGUG, trnMCAU (2 copies), trnSGGA, and nonfunctional fragments of seven protein coding genes. In other gymnosperms, plastid derived sequences have very little (< 1%) to no (in T. cuspidata) contribution towards the genome length. Plastid insertion are less common among early diverging land plant groups, such as bryophytes [4], lycophytes [69], and ferns [7]. In contrast, angiosperms typically have higher proportion of plastid derived sequences, their earliest diverging groups contain 13 Kb (Nymphaea) to 138 Kb (Amborella) of plastid insertions [10, 66]. In monocots, plastid derived sequences range from 22 Kb in Oryza [70] to 24 Kb in Zea [71]. Eudicots appeared to have relatively fewer plastid DNA sequences such as with 4.4 Kb in Arabidopsis [72], 2.1 Kb in Vigna [64], and 7.7 Kb in Beta [73]. The relative proportion of plastid derived sequences to the whole genome length in early diverging angiosperms and monocots is similar to Cycas (3 to 6%), however, eudicots contain low percentage (< 2%) of plastid derived sequences similar to derived lineages of gymnosperms [9, 20, 66]. Overall, this pattern highlighted that the origin of plastid derived sequences in plant mitochondrion most likely to be appeared in ancestors of vascular plants, expand in early diverging lineages and begin to decline laterally in more derived groups.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 3. Plastid insertions in the mitochondrial genome of Cycas debaoensis.

https://doi.org/10.1371/journal.pone.0255091.t003

RNA editing in Cycas

Using in silico prediction method, a total of 1,181 non-silent RNA editing sites are discovered in proteins coding genes of C. debaoensis. However, RNA-seq reads mapping identify only 358 RNA-editing sites, and 267 editing sites are shared between the predicted and empirically annotated editing sites, all of them are C- to -U editing (Fig 4A; S5 Table), indicating high discrepancy between predicted and empirical editing sites. RNA editing sites appear with highest chance at 2^nd codon position with 190 editing sites followed by 77 editing sites positioned at 1^st codon. As only non-silent editing sites are predicted with PREP-Mt, we manually check 87 unique empirically detected editing sites to identify the number of silent mutations. Thirty-three silent editing sites are recovered, with 31 of them occur at 3^rd codon positions (S6 Table). Overall, we confirm 300 editing sites in protein coding genes of C. debaoensis with editing site abundance of 10.3%, 63.3% and 26.3% at 1^st 2^nd and 3^rd codon position, respectively. Amino acid changes from non-silent editing events mainly involved Pro → Leu (70), Ser → Leu (65), and Ser → Phe (34), which results in increase of hydrophobicity of these amino acids (Fig 4B). In total, 89% of editing events of amino acid conversion are from hydrophilic → hydrophobic (Fig 4C), which is important for stabilization and functionalization of protein structures [74], and protein-protein interfaces [75]. Furthermore, we found that membrane-bounded and soluble protein coding genes have experienced similar selective pressures as there is no clear pattern among editing efficiency and gene substitution rates (d_N and d_S vs. editing efficiency %) of three observed gymnosperm taxa (S7 Table). Empirical data regarding abundance of RNA-editing sites in gymnosperm is limited [20]. Future studies with expanded taxon sampling covering major gymnosperm lineages need to be conducted to study the phylogenetic distribution and broad impact of selection based evolution of RNA editing in gymnosperms.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. RNA-editing in Cycas debaoensis.

A) Comparison of the number of predicted (PREP-Mt) vs. empirically observed (transcriptome) non-silent RNA editing events. B) No. of RNA editing sites with the amino acid conversion statistics. Number of editing events contributed to amino acid change mention on each bar. Blue and orange color represent the 1^st and 2^nd codon position responsible for amino acid conversion, respectively. C) Codon alteration proportions according to the hydrophobic and hydrophilic properties of the resulting amino acids.

https://doi.org/10.1371/journal.pone.0255091.g004