Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Peer-reviewed

Research Article

The leucine-NH4+ uptake regulator Any1 limits growth as part of a general amino acid control response to loss of La protein by fission yeast

  • Vera Cherkasova,

    Roles Conceptualization, Formal analysis, Investigation, Methodology, Writing – original draft, Writing – review & editing

    Affiliation Kelly@DeWitt, Inc, National Library of Medicine, National Institutes of Health, Bethesda, MD, United States of America

    ⨯
  • James R. Iben,

    Roles Data curation, Formal analysis, Writing – review & editing

    Affiliation Molecular Genomics Core, Division of Intramural Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD, United States of America

    ⨯
  • Kevin J. Pridham,

    Roles Data curation, Formal analysis, Investigation

    Affiliation Fralin Biomedical Research Institute at Virginia Tech, Roanoke, VA, United States of America

    ⨯
  • Alan C. Kessler,

    Roles Formal analysis, Writing – original draft, Writing – review & editing

    Affiliation Section on Molecular and Cell Biology, Division of Intramural Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD United States of America

    ⨯
  • Richard J. Maraia

    Roles Conceptualization, Data curation, Formal analysis, Investigation, Project administration, Resources, Supervision, Writing – original draft, Writing – review & editing

    maraiar@nih.gov

    Affiliation Section on Molecular and Cell Biology, Division of Intramural Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD United States of America

    ⨯

Abstract

The sla1+ gene of Schizosachharoymces pombe encodes La protein which promotes proper processing of precursor-tRNAs. Deletion of sla1 (sla1Δ) leads to disrupted tRNA processing and sensitivity to target of rapamycin (TOR) inhibition. Consistent with this, media containing NH4+ inhibits leucine uptake and growth of sla1Δ cells. Here, transcriptome analysis reveals that genes upregulated in sla1Δ cells exhibit highly significant overalp with general amino acid control (GAAC) genes in relevant transcriptomes from other studies. Growth in NH4+ media leads to additional induced genes that are part of a core environmental stress response (CESR). The sla1Δ GAAC response adds to evidence linking tRNA homeostasis and broad signaling in S. pombe. We provide evidence that deletion of the Rrp6 subunit of the nuclear exosome selectively dampens a subset of GAAC genes in sla1Δ cells suggesting that nuclear surveillance-mediated signaling occurs in S. pombe. To study the NH4+-effects, we isolated sla1Δ spontaneous revertants (SSR) of the slow growth phenotype and found that GAAC gene expression and rapamycin hypersensitivity were also reversed. Genome sequencing identified a F32V substitution in Any1, a known negative regulator of NH4+-sensitive leucine uptake linked to TOR. We show that 3H-leucine uptake by SSR-any1-F32V cells in NH4+-media is more robust than by sla1Δ cells. Moreover, F32V may alter any1+ function in sla1Δ vs. sla1+ cells in a distinctive way. Thus deletion of La, a tRNA processing factor leads to a GAAC response involving reprogramming of amino acid metabolism, and isolation of the any1-F32V rescuing mutant provides an additional specific link.

Citation: Cherkasova V, Iben JR, Pridham KJ, Kessler AC, Maraia RJ (2021) The leucine-NH4+ uptake regulator Any1 limits growth as part of a general amino acid control response to loss of La protein by fission yeast. PLoS ONE 16(6): e0253494. https://doi.org/10.1371/journal.pone.0253494

Editor: Reiko Sugiura, Kindai University: Kinki Daigaku, JAPAN

Received: February 24, 2021; Accepted: June 4, 2021; Published: June 21, 2021

This is an open access article, free of all copyright, and may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for any lawful purpose. The work is made available under the Creative Commons CC0 public domain dedication.

Data Availability: All relevant data and reference to them are within the paper and its Supporting Information files.

Funding: I would like to note that this work was supported by the Division of Intramural Research (HD000412-31 PGD) of the Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health. The funders had no role in study design, data collection, interpretation, or decision to submit for publication.

Competing interests: The authors have declared that no competing interests exist.

Introduction

La is an abundant nuclear protein that binds the UUU-3’OH end motif produced by transcription termination by RNA polymerase III (Pol III) [reviewed in 1]. This protects the nascent transcripts from 3’ exonucleases while La functions as a molecular charperone during the multistep process of tRNA maturation prior to nuclear export [1–3]. La is essential in a range of species, but not budding and fission yeast even though aberrant nuclear pre-tRNAs accumulate in its absence [1, 3]. Yeast do not survive without La if an essential tRNA suffers a mutation that impairs the folding, processing or critical modification of its precursor [3–5].

tRNAs are expressed at 15 to 20-fold molar excess relative to ribosomes [6]. Nonetheless increases in Pol III activity result in accumulation of unprocessed and hypomodified tRNA with evidence that their processing, modification and export activities are limiting in yeast [7–9]. Environmental stressors also lead to accumulation of pre-tRNAs [9]. However even in unstressed wild type yeast, large amounts of precursor-tRNAs succumb to degradation by the nuclear exosome, believed to reflect elimination of termination flawed and/or mis-processed species [10, 11]. Aberrant pre-tRNAs are degraded by one of the multiple quality control pathways that target defective RNAs and serve to moderate gene expression and prevent disease [12]. The nuclear surveillance system that targets aberrant pre-tRNAs, begins with 3’ oligoadenylation by the Trf4 subunit of the ‘TRAMP’ complex followed by 3’-exonucleolytic digestion by the Rrp6-nuclear exosome [13–16]. As the nucleolytic attack is directed at the 3’-end, La protein competes with and protects pre-tRNAs, including modestly aberrant ones against such degradation [17–20].

Nuclear surveillance was found associated with a stress response in S. cerevisiae that activates the general amino acid control (GAAC) pathway (AAR, amino acid response in mammals) [17, 18, 21–23]. This is distinct from the classic GAAC activation pathway as it does not require the Gcn2 protein kinase. In the classic pathway, Gcn2 senses amino acid deficiency by recognizing uncharged tRNA via its tRNA synthatase-like domain [24–26] and phosphorylates serine-51 of the alpha subunit of translation initiation factor eIF2 (eIF2α). This leads to inhibition of general translation while promoting the translation of GCN4 mRNA, by a mechanism dependent on its upstream open reading frames (uORFs) [27], which encodes a master transcription factor that positively controls amino acid biosynthesis genes.

Other conditions known to elicit the classic GAAC response (in S. cerevisiae) that may be relevant to this report are growth media that contain amino acid imbalances [28, see 29], and when specific amino acids provide the nitrogen source [30]. Also, hypomodified tRNAs undergoing degradation by the cytoplasmic rapid tRNA decay (RTD) pathway activate the GAAC response in a Gcn2-dependent manner, which was demonstrated in S. cerevisiae and S. pombe [31].

Similar to nuclear surveillance, other mechanisms can selectively promote GCN4 mRNA translation activating a GAAC response in a Gcn2-independent manner. For example, Gcd−mutants deficient in a translation initiation factor component in which GAAC is constitutively induced [29]. Mutants in certain tRNA modification activities also induce Gcn4-dependent GAAC, independent of Gcn2 [32, 33] [see 34].

A Gcd−mutation in Trm61 of the Trm6/Trm61 tRNA methyltransferase required for modification of m1A58 leads to destabilization of pre-tRNAiMet and its nuclear surveillance-mediated decay, resulting in GAAC activation independent of Gcn2 [17, 23]. Nuclear surveillance-induced GAAC in S. cerevisiae also occurs by expression of mutant tRNA genes or factors that cause nuclear pre-tRNAs to accumulate, and in such cases can be reversed by expression of tRNA maturation factors RNase P, La protein, modification enzymes, or the tRNA nuclear exporter, Los1 [22]. Likewise, deletion of los1Δ itself activates a GAAC response, with no apparent inhibition of general translation, thus appears to be Gcn2-independent [35].

Pre-tRNA degradation by nuclear surveillance has been widely conserved [15, 36–38]. As noted above, while multiple lines of evidence indicate a signalling branch of nuclear surveillance elicits GAAC response independent of Gcn2 in S. cerevisiae, to our knowledge this has not been established in another organism.

Coregulation of amino acids, tRNAs and broader metabolism exists although with species-specificity, a germane example being the GAAC responses in S. pombe and S. cerevisiae [39–42]. 3-aminotriazol (3AT) inhibits histidine synthesis thereby causing amino acid deficiency and Gcn4 activation in S. cerevisiae [43, 44] and also in human cells with ATF4 as the human Gcn4 homolog [45] [see 29]. This response is different in S. pombe, mediated by Fil1, which is non-orthologous but functionally akin to Gcn4 including in mode of translational regulation by uORFs [46, 47]. Also, S. cerevisiae contains one protein kinase, Gcn2 that phosphorylates eIF2α serine-51, while S. pombe and humans both contain more than one [reviewed in 46]. Specifically, S. pombe Gcn2 phosphorylates eIF2α in response to amino acid depletion whereas Hri1 and Hri2 differentially do so as part of responses to nitrogen and glucose starvation, and oxidative stress [48].

3AT induces many more than the GAAC genes in S. cerevisiae including in gcn4-mutant cells [29, 43]. 3AT also induces many genes in S. pombe, the GAAC genes via Fil1 in addition to genes that comprise the “core environmental stress response” (CESR) that can also be induced by specific stressors, hydrogen peroxide, the heavy metal cadmium, DNA-alkylating agents, osmotic stress and heat shock. Transcription factors Atf1 and Pcr1, neither of which are found in S. cerevisiae induce >100 common CESR genes, with a smaller number specific to each pathway, which differ in the extent to which Atf1 (and presumably its binding partner Pcr1) is engaged [49]. Relevant here is that although 3AT induces many genes, refined genetic analyses has led to the separation of 3AT-GAAC and 3AT-CESR gene “clusters” [see 46 and below].

S. pombe lacking La protein (sla1Δ) accumulate aberrant pre-tRNAs in rich (YES) or in minimal media (EMM) that differ only in the nitrogen source proline or NH4+ but grow very slowly in NH4+ [50]. For example, sla1Δ and sla1+ grow equally well in YES whereas addition of NH4+ to YES severely inhibits sla1Δ but not sla1+ [50]. It had been known that auxotrophy for leucine is exacerbated by NH4+ in mutants that antagonize target of rapamycin (TOR) signaling such as tsc1Δ, tsc2Δ and the tor1Δ mutant itself reflecting that tor1+ promotes leucine uptake [51, 52]. The sla1Δ mutant is more deficienct in leucine uptake in NH4+ media than a tor1Δ mutant in the same genetic background and this is a principal characteristic of its slow growth in EMM-NH4+ [50]. Although leucine uptake is also impaired in sla1Δ relative to sla1+ in EMM-Pro media, it is not as severe as in EMM-NH4+ and does not limit growth relative to sla1+ [50]. Thus while proline is a very poor nitrogen source relative to NH4+ which is excellent for growth of wild type S. pombe [51, 53], that sla1Δ cells grow comparably to sla1+ in proline but much slower than sla1+ in NH4+ illustrate the effects of Sla1 [50]. Thus sla1Δ and other mutants that disrupt tRNA biogenesis, modification and/or metabolism lead to rapamycin sensitivity and appear to antagonize TOR signalling [50, 54–56] [reviewed in 39], whereas deletion of gaf1+ which encodes the nitrogen-regulated GATA transcription factor that represses tRNA production, is resistant to TOR inhibition [52, 57]. Based on knowledge of the S. cerevisiae system, deficiency of amino acid uptake, aberrant tRNA processing or both might lead to GAAC activation in sla1Δ cells, by the classic pathway or in a Gcn2-independent manner.

We analyzed transcriptomes of sla1Δ cells including by comparison to a wealth of published data on other mutants. Genes upregulated in sla1Δ grown in media without NH4+ appear to reveal a GAAC response to altered tRNA homeostasis, whereas additional distinct genes upregulated in NH4+ media reflect a CESR. Deletion of the Rrp6 subunit of the nuclear exosome decreases expression of GAAC genes by sla1Δ cells, providing evidence of a signalling component of nuclear surveillance in S. pombe. Spontaneous revertants (SSR) of sla1Δ slow growth in NH4+ were isolated in which the rapamycin hypersensitivity and GAAC expression phenotypes were also reversed. One mutant phenotype was characterized and shown to be due to a F32V mutation in Any1, an amino acid transport regulator previously linked to TOR signalng [58].

Results

We previously reported overlap between the sla1Δ upregulated genes and a set of amino acid metabolism (AAM) genes that had been informatically grouped on the basis of a short upstream sequence motif thought to represent a transcription factor binding site [50]. Statistical significance of the overlap ranged from p< 4.75e-17 to 3e-12 in different growth media [50].

sla1Δ cells upregulate a core set of genes as well as growth media-specific transcripts

As alluded to in the Introduction, S. pombe transcriptomes based on relevant biological results recently became available. Our transcriptomes analyzed here differed in abundance in sla1Δ (h- ade6-704 leu1-32 sla1Δ::ura4-) and sla1+ cells (h- ade6-704 leu1-32 ura4-) by 1.5x or more in each of both duplicate experiment samples after growth in three different media, EMM (Edinburgh minimal media) which contains NH4+ as the nitrogen source, EMM-Pro in which proline replaces NH4+, and YES (yeast extract with supplements). The analysis revealed 4, 9 and 11 down-regulated as well as 40, 60 and 64 upregulated genes in sla1Δ relative to sla1+ cells in YES, EMM-Pro and EMM-NH4+ media respectively. Thus by the number of genes whose expression increased or decreased by ≥1.5x, growth in YES had least affect (44 genes) whereas growth in EMM-NH4+ had greatest affect (75 genes) on the sla1Δ transcriptome.

The left panel of Fig 1A shows a three-way Venn graphic of the overlap of upregulated genes shared by sla1Δ cells grown in the three media. It reveals that 23 of the 40 sla1Δ genes upregulated in YES (58%), were also upregulated in both EMM-Pro and EMM-NH4+. Besides the 23 YES upregulated genes only 2 other were shared with the EMM-NH4+ set and 4 with the EMM-Pro set (Fig 1A left). Each of the two-way comparison Venn graphics include a statistical significance and representation factor (RF); a RF of >1 indicates more overlap than expected of two independent groups. Consistent with the three-way Venn, overlap of the EMM-Pro and EMM_NH4+ genes was the most highly significant, p < 3.349e-64 with a RF = 54. The EMM-Pro and YES overlap was less significant, p < 1.16e-46 but with higher RF = 62. The NH4+ and YES genes overlapped at p < 7.35e-41 with higher RF = 53.7 (Fig 1A).

thumbnail
Download:
Fig 1. Statistical significance of overlap of sla1Δ ≥1.5x transcriptomes and the representation factors (RF) (see text).

A-E) The representation factor (RF) is the number of overlapping genes divided by the expected number of overlapping genes drawn from two independent groups. RF > 1 indicates more overlap than expected of two independent groups and a RF < 1 indicates less overlap than expected. 3AT-GAAC and 3AT-CESR are from [46] in which these gene groups are referred to as clusters 3 and 2 respectively, and are considered analogous to a Gcn2-dependent GAAC response and a CESR response respectively. 3AT-Fil1 represents genes induced in response to 3AT in gcn2+ vs gcn2Δ cells [47]. Fil1/Gcn4-26 represents a core group of 26 genes directly bound by the Fil1 and Gcn4 transcriptional activators of GAAC genes in their respective genomes [47]. The sla1Δ Pro, sla1Δ YES and sla1Δ NH4+ gene sets are described in the main text, as are the sla1Δ-all and sla1Δ-com sets, and the sla1Δ-λPro, sla1Δ-λYES and sla1Δ-λNH4+ gene sets. Bold font numerals under these names indicate gene number in the set.

https://doi.org/10.1371/journal.pone.0253494.g001

The 38 upregulated genes common to the EMM-Pro and EMM-NH4+ sets, and the 23 upregulated genes in all three sets, are hereafter referred to as “sla1Δ-com” and “sla1Δ-all.” The identities of the genes in these sets are in, S1 Table. The sla1Δ-com gene set and the sla1Δ-all gene set were each subjected to gene ontology (GO) analysis using PomBase-defined GO terms [59, 60]. The 38 sla1Δ-com genes identified arginine, glutamine, and amino acid metabolic and biosynthetic processes represented by 8 distinct genes as well as two DNA-related processes (S2A Table). The DNA integration and recombination processes reflect transcripts from 8 Tf2 retrotransposon loci each counting as a gene in this analysis as well as the tlh1+ DNA recQ helicase-like gene. Tf2 retrotransposons from multiple loci are known to be upregulated in S. pombe GAAC-gene sets [46, 47] and in tor-deficient, in tsc-deficient mutants, and in mutants deficient in the retrotransposon chromatin repressor, atf1+ [61, 62].

The GO results reflect that the sla1Δ-com genes upregulated both in EMM with NH4+ or Pro include the S. cerevisiae homologs (in parantheses as designated in PomBase): aes1+ (YHI9), arg3+ (ARG3), arg5+ (CPA1), arg12+ (ARG1), asn1+ (ASN1), gdh2+ (GDH2), pas1+ (PCL5), SPAC56E4.03 (ARO8) and aca1+, involved in arginine, asparagine, glutamine, and glutamic acid metabolism (S2A Table). Six of these were upregulated in the sla1Δ-all gene set (S2A Table). GO analysis of the 23 genes in the sla1Δ-all set revealed multiple of the same processes involved in arginine, asparagine, glutamine, and glutamic acid metabolism as well as DNA processes (S2B Table). Thus, amino acid metabolic genes recognized as involved in cohesive processes are constitutively over-expressed in sla1Δ cells relative to sla1+ cells in all three growth media. Among the 15 upregulated genes shared by sla1Δ cells grown in EMM (but not YES), were arg3+, arg5+, asn1+, plus two involved in membrane transport, and others involved in related small molecule metabolism (S1 Table).

We also performed GO analysis on genes in the sla1Δ sets that do not overlap (S3A–S3C Table). The 11 genes in the YES set that do not overlap with either of the two other sets were designated as sla1Δ-λYES. The 22 and 26 genes in the sla1Δ Pro and NH4+ sets that do not overlap with eachother were designated sla1Δ-λPro and sla1Δ-λNH4. Interestingly, 3 of the 11 genes specific to sla1Δ-λYES and 16 of the 22 genes specific to sla1Δ-λPro were linked to multiple GO related metabolic processes at p <0.01 (S3A and S3B Table). By contrast, the 26 genes specific to sla1Δ-λNH4 yielded no GO terms at p <0.01 (not shown); only when the stringency was lowered to p <0.05 was a single GO term revealed (S3C Table).

In conclusion, a larger number of genes were linked to nutrient transport and amino acid metabolism in sla1Δ Pro genes than the other two corresponding gene sets: 30 genes in the sla1Δ Pro set of 60 (50%), 13 genes in the YES set of 40 genes (33%), and 9 genes in the sla1Δ NH4+ set of 64 (14%) (S4–S6 Tables). Thus a significant fraction of upregulated genes in sla1Δ cells are shared in all three media and involved in biosynthesis and metabolism of the basic nitrogenous amino acids (S2B Table), while a number of other genes are upregulated to different extents. The GO analysis shows that the sla1Δ YES and EMM-Pro genes appear more similar to each other than to the EMM-NH4+ genes in their links to amino acid metabolism. This is especially notable because YES is rich media and EMM is minimal media with NH4+ considered to be an excellent nitrogen source for S. pombe growth while proline is a very poor nitrogen source by comparison [51, 53]. This issue with regard to the sla1Δ cells is addressed in a later section.

sla1Δ cells produce different GAAC-like responses in different growth media

The analyses indicate that sla1Δ cells grown in EMM-Pro or EMM-NH4+, defined media that differ only in the nitrogen source, upregulate a significant number of the same genes as well as different genes. Also, growth of sla1Δ cells is specifically sensitive to the inhibitory effects of NH4+ relative to isogenic sla1+ cells, whereas they grow equally well in EMM-Pro [50]. We examined the sla1Δ upregulated gene sets by comparing them to available sets of S. pombe stress response genes [46, 47]. Gene deletions were used to dissect S. pombe responses to 3AT and led Udagawa et al. to derive a “Cluster 3” subset of 68 upregulated genes that is considered analogous to the Gcn2-dependent GAAC response in S. cerevisiae, and a “Cluster 2” subset of 169 upregulated genes that represents the CESR [46]. Duncan et al. later identified and characterized Fil1, a S. pombe transcription factor whose mRNA responds to 3AT-induced signalling analogously to S. cerevisiae Gcn4; the translated Fil1 protein then activates S. pombe GAAC (and other) genes in a manner similar to Gcn4 (below) [47]. Duncan et al. isolated a set of 573 genes induced in response to 3AT in gcn2+ but not in gcn2Δ cells [47]. These S. pombe gene sets are referred to as 3AT-GAAC, 3AT-CESR and 3AT-Fil1 in Fig 1B and hereafter.

The sla1Δ-all set of 23 genes significantly overlapped with each of the 3AT-GAAC and 3AT-Fil1 sets, as did the sla1Δ-com set of 38 genes (Fig 1B, left and middle). In contrast to the significant overlaps with these 3AT gene response genes, there was no significant overlap of sla1Δ-com nor sla1Δ-all genes with the 3AT-CESR (Fig 1B, right). Comparison of the full upregulated gene sets of sla1Δ YES, EMM-NH4+ and EMM-Pro to the GAAC and Fil1 sets revealed significant overlaps, each with distinctive RFs (Fig 1C).

The sla1Δ gene sets were distinguished by comparison to 3AT-CESR genes. This used sla1Δ genes from each set not shared with one or both other sets (Fig 1A left, S3A–S3C Table): sla1Δ-λYES, sla1Δ-λPro and sla1Δ-λ NH4+ (Fig 1D). By comparison to the sla1Δ-λYES and the sla1Δ-λPro genes which did not exhibit significant overlap with 3AT-CESR genes (p < 0.291 & p < 0.143), the sla1Δ-λ NH4+ genes exhibited significant overlap (p < 7.628e-11) and with higher RF (Fig 1D).

By analyzing ChIP-seq data Duncan et al. defined a core group of 26 genes that are directly bound by the Fil1 and Gcn4 transcriptional activators of GAAC genes in their respective genomes [47]. Comparison to this “Fil1/Gcn4-26” data set indicates somewhat higher overlap with the sla1Δ EMM-Pro genes than with sla1Δ YES and with sla1Δ EMM-NH4+ (Fig 1E, top row). All of the sla1Δ genes in these sets that overlap with the Fil1/Gcn4-26 set are involved in amino acid biosynthesis/metabolism (S7 Table).

Fig 1 and the GO analyses results in S2–S5 Tables suggest that cells deleted of sla1+ that are grown in all three growth media exhibit constitutive upregulation of a set of GAAC response genes albeit to slightly different extents. However sla1Δ cells grown in EMM-NH4+ also upregulate a number of genes distinctive to the CESR as reflected by Fig 1D, in addition to the GAAC genes. The hsp3101+, hsp3102+, isp6+, pcr1+ and zym1+ transcripts which are known to be induced under multiple stresses [46, 49] were found in the upregulated sla1Δ cell transcripts specifically in the EMM-NH4+ set (S1 Table).

Further evidence of composite input to the GAAC response in sla1Δ cells

Sla1 is known to protect pre-tRNA from a nuclear surveillance-mediated decay pathway that includes pre-tRNA polyadenylation and is dependent on rrp6+ of the nuclear exosome [20]. Rrp6 deletion rescues a nuclear surveillance-mediated GAAC-related growth phenotype of S. cerevisiae that occurs in response to m1A58 hypomodification of pre-tRNAiMet as described above [23]. Deletion of rrp6+ significantly compromises S. pombe growth under multiple conditions, including in rich media [20, 63–65], however RRP6 deletion from S. cerevisiae has little effect on growth [66, 67] other than at 37°C [68]. Our objective for Fig 2 was to ask if nuclear surveillance may be involved in signaling GAAC gene induction in sla1Δ cells a similar way by rrp6+ deletion in S. pombe. Examination by northern blotting shows that sla1Δ cells exhibit increased levels of gdh2+ mRNA (C312.04 in ref [50]) whereas sla1+ rrp6+ (WT) cells and sla1Δ cells deleted for rrp6+ (rrp6Δ) have lower levels (Fig 2A). For this we also examined lys4+ levels (Fig 2A) because it is in the 3AT-GAAC gene set [46] the 3AT-Fil1 set and the Fil1/Gcn4-26 set [47] (LYS21/LYS20 in S. cerevisiae, S7 Table) but was not included in the sla1Δ transcriptome sets because it did not meet criteria of detection at ≥1.5x relative to sla1+ on each of the duplicate experiments; it was detected at 2.1x and 1.46x in YES media and at 2.40x and 1.43x in EMM-NH4+ (not shown), and this was consistent with our northern blot results (Fig 2B, see Y-axes). The ribosomal protein rpl8+ mRNA served as a loading control and was used for normalization of gdh2+, aca1+ and lys4+ mRNAs (Fig 2A and 2B).

thumbnail
Download:
Fig 2. Evidence that the Rrp6 subunit of the nuclear exosome contributes to GAAC gene expression in sla1Δ cells.

A) Northern blot analysis of RNA from cells grown exponentially in rich medium (YES) (left) or Edinburgh minimal medium (EMM) containing NH4+ (right). Total RNA, 5 and 10 μg of each sample were separated on a 1% denaturing agarose gel, transferred to a GeneScreen Plus nylon membrane, and subjected to sequential hybridization with 32P-labelled probes for mRNAs ghd2+, aca1+, lys4+ and rpl8+ the latter of which serves as a quantitative normalization control, as indicated. A photo of the ethidium bromide stained agarose gel prior to transfer is shown as the bottom panel with the 18S and 26S rRNA bands indicated. B) Quantitation of the ghd2+, aca1+ and lys4+ bands relative to the rpl8+ mRNA that encodes ribosomal protein L8. Values represented by each bar indicate two separate RNA sample loadings per experiment (technical duplicates), relative to WT which was set to 1. C) The quantitative data reported for ghd2+ and aca1+ mRNA levels in both panels of B were used to derive p-values using a basic T-test of statistical significance of the differences indicated. D) Cells were grown in liquid medium and serial dilutions were spotted to the indicated plates and incubated at 32°C for 2 to 6 days. Strains: yAS99 (WT); yAS113 (sla1Δ); yYH7a (rrp6Δ); CY1670 (sla1Δ rrp6Δ).

https://doi.org/10.1371/journal.pone.0253494.g002

As nothern blotting is not as direct nor standardized an approach for mRNA quantification as is gene array methodology, some comments are noteworthy. First, visual inspection of Fig 2A confirms that the gdh2+ and aca1+ GAAC mRNAs examined, are reproducibly and robustly upregulated in sla1Δ relative to sla1+ WT cells. Second, because quantification of these mRNAs in Fig 2B uses rpl8+ for normalization and reports levels relative to WT, it is important to note that actual signal intensity of probe detection on the blot panels depicted in Fig 2A were indeed nearly 4-fold and 3-fold higher for gdh2+ and aca1+ mRNAs in sla1Δ cells in EMM-NH4+ media as compared to sla1Δ cells in YES.

The analysis showed that aca1+, gdh2+ and lys4+ levels were lower in the sla1Δ rrp6Δ double mutant than in sla1Δ indicating that deletion of rrp6+ suppressed their expression (Fig 2A and 2B). Finally, the cumulative quantitative northern blot data were tested for statistical sigificance (Fig 2C). Most relevant this showed that the differences between sla1Δ cells and sla1Δ rrp6Δ cells in normalized mRNA levels for aca1+ and gdh2+ were significant (p = 0.0089) supporting the visual evidence that deletion of rrp6+ from sla1Δ suppresses activation of aca1+ and gdh2+ GAAC gene expression.

The sla1Δ cells grow comparably to sla1+ in YES but slower than sla1+ in EMM-NH4+ [50] (Fig 2C). The effects of rrp6+ deletion relative to sla1Δ was media-dependent. The rrp6Δ cells exhibited reduced growth relative to WT and sla1Δ on YES while they grew better than sla1Δ on EMM-NH4+ (Fig 2C). Growth of the sla1Δ rrp6Δ double mutant was poor relative to either of the single mutants on YES, and was markedly worse than the rrp6Δ single mutant on EMM-NH4+ (Fig 2C). Thus, the results were clear that while rrp6+ deletion could rescue upregulated GAAC gene expression in sla1Δ rrp6Δ cells, it could not rescue the growth deficiency associated with sla1Δ cells.

Rrp6 deletion rescues a nuclear surveillance phenotype of S. cerevisiae, that is due to degradation of a single pre-tRNAiMet species owing to its unique sensitivity to m1A58 hypomodification in the trm6-504 mutant [23]. Fig 2 shows that suppression of GAAC gene upregulation in sla1Δ rrp6Δ cells is apparently uncoupled from the slow growth phenotype of sla1Δ rrp6Δ. As sla1Δ cells slow their growth specifically in NH4+ media we attempted to uncover negative regulators of this phenotype.

Isolation of sla1Δ spontaneous revertants (SSR) of slow growth in NH4+ media

sla1Δ cells plated on EMM-NH4+ led to the appearance of very rare relatively fast growing colonies that were reproducibly surrounded by smaller sattelite colonies (Fig 3A). After plating 125,000 cells, a rare colony arose and satellite colonies appeared thereafter as in Fig 3B. The fast growth colonies isolated after a single plating were named sla1Δ spontaneous revertants (SSRs) followed by a number. These were streaked and single colony derivatives of each were screened by comparing their growth to WT, sla1Δ and small sattelite colonies, by serial dilution spotting on YES, EMM-NH4+ and EMM-Pro. Additional analyses are shown in Fig 3C.

thumbnail
Download:
Fig 3. Characterization of spontaneous sla1Δ slow growth revertants (SSRs).

A) Results of plating sla1Δ cells (yAS113) on EMM-NH4+. B) 250,000 sla1Δ cells plated and photographed after incubation for 7, 10 and 12 days. C) WT (yAS99) sla1Δ (yAS113), and a leu1+ transformant of yAS113, sla1Δ leu1+, is shown alongside SSR4, SSR5 and SSR6 in the three sets. Rapamycin was used at 50 ng/ml. D) Northern blot of 5 and 10 μg total RNA from the strains indicated above the lanes grown in EMM-NH4+ probed for ghd2+, aca1+, lys4+ and rpl8+ mRNAs as in Fig 2. Numbers under the panels indicate the average of duplicate quantification measurements of the bands relative to rpl8+ which serves as quantitative normalization relative to WT which was set to 1 as in Fig 2.

https://doi.org/10.1371/journal.pone.0253494.g003

Fig 3C shows that SSRs 4, 5 and 6 share a similar pattern of media and rapamycin sensitivities that is distinct from both the WT and sla1Δ strains. As noted, auxotrophy for leucine in the presence of NH4+ in the media elicits sensitivity to rapamycin (Rap) in S. pombe mutants in which TOR signalling is antagonized [51, 69]. Use of leu1-32 auxotrophs as "WT" S. pombe strains is not uncommon ([70], e.g., strain FY1862 in [71–73] and SPG17 in [74, 75]). As reported, deletion of sla1+ from the leucine auxotrophs yAS99 and SPG17, greatly exacerbates the NH4+ dependent Rap sensitivity [50]. Reintegration of leu1+ at its native locus as in sla1Δ leu1+, suppressed the slow growth in EMM-NH4+ and led to increased growth in EMM-NH4+ +Rap relative to the leu1-32 sla1+ WT strain yAS99 (Fig 3C). Notably however, sla1Δ leu1+ did not show growth advantage over yAS99 in EMM-Pro+Rap.

The slow growth of sla1Δ in EMM-NH4+ and EMM-NH4++Rap was reversed in the SSRs with a pattern that suggests suppression of leucine auxotrophy although not as completely as by restoring leu1+. The SSRs grew much better than sla1Δ and similarly to WT in all media except EMM-Pro+Rap (Fig 3C). The relative slow growth of the SSRs in EMM-Pro+Rap as compared to EMM-NH4++Rap may likely reflect the differential effects of these nitrogen sources on the regulation of amino acid permeases [51]. This comparative analysis reveals that the SSRs are distinct relative to WT and sla1Δ. A northern blot in Fig 3D shows that mRNAs from representative GAAC genes gdh2+ aca1+ and lys4+ in sla1Δ cells, are robustly suppressed in the SSRs as seen in WT.

Sequence identification of SSR mutations

We previously used whole genome sequencing to identify mutations in spontaneous mutants that exhibited a phenotype after one plating [76]. Genome sequencing of SSR4, SSR5 and SSR6 was performed using the parent sla1Δ strain whole genome sequence as a reference genome. Single nucleotide polymorphisms (SNPs), insertions, deletions and copy number were scrutinized as described [76]. For SSR5, two gene-associated SNPs were identified: one that changes a UUC to a GUC codon (F32V) in a gene named any1+ (arrestin in nutrient response in yeast-1, SPBC18H10.20c) that was reported to control amino acid uptake [58, 77], and another in the 3’ UTR of eki1+ (SPAC13G7.12c) a choline/ethanolamine kinase. For SSR6, a four base pair deletion was identified on chr II:3487055–3487059 that would interfere with a transcription start site for zfs1+ (SPBC1718.07c) annotated as selectively active during nitrogen starvation [78]. zfs1+ is known to regulate the G1 cyclin puc1+ in response to nitrogen depletion or inhibition of TOR signaling [79]. No high confidence mutations could be found in SSR4.

With 16 promoters and many more transcription start sites, zfs1+ has more promoters than the great majority of S. pombe genes [80] and was not examined further. We focused on the any1-F32V missense mutation in SSR5. any1+ encodes an arrestin-related endocytic adaptor that regulates trafficking of amino acid plasma membrane permeases aat1+ (leucine and other aa uptake, GAP1 in S. cerevisiae) and cat1+ (arginine/lysine uptake, CAN1 and others in S. cerevisiae); any1+ is known to suppress defects in amino acid uptake due to mislocalization of plasma membrane permeases associated with nutritional stress [58, 77]. Any1 binds more stably to its E3 ubiquitin ligase partner Pub1 (Rsp5 in S. cerevisiae) in states of hypofunction and limits Aat1 function at the plamsma membrane [77]. Moreover, proper TOR activity is required for Aat1 trafficking to the plasma membrane during nutrient stress [81]. These results are consistent with the SSR5 phenotype and the possibility that any1-F32V has decreased ability to limit Aat1 leucine uptake function in EMM-NH4+ media.

any1-deletion suppresses slow growth of sla1Δ in EMM-NH4+

Deletion of any1+ from WT yAS99 and from sla1Δ reduced their growth in YES, but had little effect on WT growth in EMM-NH4+ and rescued the growth deficiency of sla1Δ in EMM-NH4+ (Fig 4A). Thus, growth of any1Δ is differentially sensitive to YES and EMM-NH4+, whereas sla1Δ cells exhibit the opposite sensitivity. Most important, deletion of any1+ largely rescued the slow growth of sla1Δ on EMM-NH4+, while the strains grew comparably on EMM-Pro (Fig 4A). These data are consistent with any1+ as the target gene whose mutation is responsible for the SSR5 growth phenotype and the idea that any1-F32V is a reduced function allele in these cells.

thumbnail
Download:
Fig 4. Any1-F32V is a mutant allele that selectively suppresses slow growth of sla1Δ.

Cells grown in liquid medium were serially diluted and spotted onto the indicated plates and incubated at 32°C or 37°C as indicated, for 2d (panel A) to 6d (panels B & C). When comparing a strain in different panels note colony size (as well as cell density) as an independent indicator of relative growth, for example any1Δ vs. sla1Δ in panel 4°C YES. The strains are as follows. A) yAS99 (WT); yAS113 (sla1Δ); CY1698 (any1Δ); CY1697 (sla1Δ any1Δ). B) yAS99 (WT); yAS113 (sla1Δ); CY1665 (SSR5); CY1697 (sla1Δ any1Δ); CY1711 (sla1Δ any1Δ +any1-F32V); CY1710 (sla1Δ any1Δ +any1+). C) yAS99 (WT); yAS113 (sla1Δ); CY1698 (any1Δ); CY1712 (any1Δ +any1+); CY1713 (any1Δ +any1-F32V); 1 & 2 show two different isolates.

https://doi.org/10.1371/journal.pone.0253494.g004

Validation of any1-F32V as a hypofunctional allele that suppresses sla1Δ slow growth in EMM-NH4+

In order to assess potential effect of the F32V mutation, we integrated any1+ and any1-F32V into the sla1Δ any1Δ double mutant and examined growth along with WT, sla1Δ, SSR5, and any1Δ sla1Δ (Fig 4B). Providing sla1Δ any1Δ with the any1+ allele or the any1-F32V allele rescued growth on YES (sla1Δ any1Δ +any1+, and sla1Δ any1Δ +any1-F32V) (Fig 4B). This provided evidence that any1-F32V is not a null allele and more importantly showed that it confers growth advantage to sla1Δ on EMM-NH4+ media while the WT any1+ does not (Fig 4B, sla1Δ any1Δ +any1+, and sla1Δ any1Δ +any1-F32V). This validated the any1-F32V allele mutation as largely responsible for reversing the slow growth of sla1Δ on EMM-NH4+.

It was previously reported that slow growth of sla1Δ cells reflect two deficiencies, low plating efficiency and slow proliferation, and that deletion of certain genes, pub1+ (sla1Δ pub1Δ) suppresses one much more than the other (proliferation, small colony size) [50]. By limiting growth to relatively short times, Fig 4A suggests that a function of any1+ is to support efficient growth in YES. Thus, we could assess the degree to which any1-F32V might be generally hypofunctional by assessing to what degree if any it could restore growth of the any1Δ strain on YES. On plates in Fig 4C which were allowed to grow for longer time than in panel A, the any1Δ strain was complemented with a chromosomal copy of either any1+ or any1-F32V. Both alleles rescued the slow growth of any1Δ on YES and on the other media, including YES at 37°C (Fig 4C). Thus any1+ and any1-F32V were indistinguishable for function in restoring growth in YES media and in EMM-NH4+ in the presence of sla1+ (Fig 4C, any1Δ +any1+ vs. any1Δ +any1-F32V) whereas any1-F32V differentially conferred growth advantage to sla1Δ in EMM-NH4+ but any1+ is defective for this activity in sla1Δ cells (Fig 4B, sla1Δ any1Δ +any1+ vs. sla1Δ any1Δ +any1-F32V). By this assay in Fig 4C, the ability to restore growth in YES, any1-F32V does not appear to be a simple hypomorphic allele. The cumulative data suggest that F32V is a distinctive mutation that alters any1+ function in sla1Δ cells to enhance growth in otherwise restrictive EMM-NH4+ media.

Effects of any1+ and any1-F32V on GAAC gene expression

We performed northern blotting including examination of any1+ mRNA expression. The third panel of Fig 5 shows that any1+ mRNA was comparable in WT, sla1Δ and SSR5 (lanes 1–6), as expected for the F32V mutation acting via Any1 protein as opposed to affecting mRNA levels. This is supported by comparison to the rpl8+ panel used as a loading control.

thumbnail
Download:
Fig 5. Evidence that any1-F32V may selectively suppress aca1+ gene expression in sla1Δ cells.

A northern blot of 5 and 10 μg of total RNA from cells grown in EMM-NH4+, as in Fig 2. The strains are as described in Fig 4. The quantification values indicated under the lanes of the gdh2+ and aca1+ panels were derived from two biological experiments each containing measurements of two separate RNA sample loadings calibrated by the loading control rpl8+ mRNA in each lane and reported as relative units (RU). The lower panel shows the ethidium stained agarose gel prior to transfer.

https://doi.org/10.1371/journal.pone.0253494.g005

Probing for gdh2+ mRNA showed that any1Δ cells express gdh2+ mRNA levels comparable to WT and SSR5, substantially lower than in sla1Δ (Fig 5, lanes 1–8). Quantification of the gdh2+ and aca1+ mRNA levels are shown under the lanes of those panels. Also important, deletion of any1+ from sla1Δ as in sla1Δ any1Δ, suppressed gdh2+ and aca1+ mRNA levels (compare lanes 3–4, 9–10).

We next examined effects of integrating any1+ and any1-F32V into the any1Δ strain and the double mutant sla1Δ any1Δ (Fig 5, lanes 11–18). Both alleles restored any1+ mRNA to the any1Δ and sla1Δ any1Δ strains at comparable levels (compare lanes 7–10 with 11–18 of lower three panels). The any1-F32V allele in lanes 17–18 failed to suppress gdh2+ and aca1+ levels to that in SSR5 (lanes 5–6). However, examination of the blots suggested that any1-F32V suppressed aca1+ expression more than it suppressed gdh2+ (lanes 15–18). Thus although any1-F32V failed to recapitulate suppression observed in SSR5, it appeared to suppress aca1+ more than gdh2+. More specifically, the any1-F32V allele appeared to lead to lower aca1+ levels than the any1+ allele after integration into sla1Δ any1Δ (lanes 15–16 vs. 17–18), whereas gdh2+ levels appeared more similar (lanes 15–16 vs. 17–18). However, more convincing is that integration of neither any1-F32V nor any1+ could recapitulate the suppression of gdh2+ and aca1+ observed in SSR5. We note that although any1+ and any1-F32V are associated with distinct functional activities in sla1Δ and SSR respectively, it is possible that aca1+/gdh2+ mRNA levels were not recapitulated by re-integtation into the disrupted any1+ locus of the any1Δ sla1Δ mutant because the correct regulatory control regions were not properly re-established.

Are the observations regarding the apparent differences in aca1+ mRNA levels that were observed by inspection of Fig 5 relevent to growth in EMM-NH4+? Fig 4B shows that while sla1Δ vs. sla1Δ any1Δ +any1+ show comparable poor growth, whereas sla1Δ any1Δ +any1-F32V is intermediate, not as good as SSR5 but clearly better than sla1Δ any1Δ +any1+. This suggests that any1-F32V is a positive growth determinant in sla1Δ-SSR5 in EMM-NH4+, distinguished from any1+.

SSR5 (any1-F32V) exhibits increased leucine uptake in EMM-NH4+ compared to sla1Δ cells

As noted, deficiency of leucine uptake in NH4+ media is likely the key basis of the slow growth of sla1Δ cells [50]. We therefore compared 3H-leucine uptake by sla1Δ, SSR5, any1Δ and related strains using the same assay as before [50, 51]. The data were consistent with previous results [50, 51] and showed that deficiency of leucine uptake of sla1Δ was clearly reversed in SSR5 (Fig 6). Moreover, any1Δ cells as well as sla1Δ any1Δ and SSR5 cells exhibited greater uptake than WT cells. The data fit with any1+ as a negative regulator of leucine uptake in the presence of NH4+ in sla1Δ cells [58, 82], and with any1-F32V as relieving this negative influence.

thumbnail
Download:
Fig 6. SSR5 (sla1Δ any1-F32V) and any1Δ cells exhibit elevated leucine uptake relative to sla1Δ.

A) Cells were grown in EMM-NH4+, transferred to fresh EMM-NH4+ media with 3H-leucine, and assayed for 3H-leucine uptake at the time points indicated. The R2 values for each of the trendlines representing the claculated slopes of the rates of leucine incorporation are indicated to the right. Strains: yAS99 (WT); yAS113 (sla1Δ); CY1665 (SSR5); CY1697 (sla1Δ any1Δ); CY1698 (any1Δ). B) Multiple regression/correlation analysis was used to derive p-values from the 3H-leucine uptake data (see methods).

https://doi.org/10.1371/journal.pone.0253494.g006

Discussion

A principal feature of yeast that lack La protein is aberrant pre-tRNA processing [9, 20, 83–88]. Deletion of sla1+ from different WT laboratory strains leads to hypersensitivity to rapamycin which reverts to rapamycin resistance upon reintroduction of sla1+ [50]. Separately, sla1Δ and sla1+ cells grow comparably to each other in YES and comparably to each other in EMM-Pro, whereas sla1Δ grows much slower than sla1+ in EMM-NH4+ [50]. The first objective of this study was to compare the sla1Δ ≥1.5x transcriptomes in the three media, and to other relevant transcriptomes. Growth of sla1Δ in YES, EMM-Pro and EMM-NH4+ leads to 40, 60 and 64 upregulated genes at ≥1.5x relative to sla1+ cells. Such comparisons and GO analyses reveals that all three sla1Δ transcriptomes share 23 genes (‘sla1Δ-all’) of which 18 overlap with the “cluster 3” 3AT-GAAC transcriptome [46] and 20 of which overlap with the 3AT-Fil1 transcriptome [47] (Fig 1A, 1B; S1, S2B Tables). Further analysis shows that the sla1Δ EMM-Pro and EMM-YES transcriptomes are 55–60% aligned with the 3AT-GAAC response and 2–3% with the 3AT-CESR, whereas <50% of the EMM-NH4+ transcriptome aligned with the 3AT-GAAC response and 17% with the CESR (Fig 1C and 1D). Although the NH4+ transcriptome is set apart from the other two, the genes specific to it reflect stress but do not satisfactorily explain the slow growth (below).

Programmed genetic responses in S. pombe and S. cerevisiae that include the GAAC (following exposure to 3AT) are complex, include several hundred genes in various functional groups, and reflect multiple transcription factor ‘activities’ [29, 43]. In S. cerevisiae, activation of GAAC genes can be triggered by uncharged tRNA following inhibition of amino acid synthesis [29, 89], imbalances of amino acids in the growth media and in particular when serving as the nitrogen source [28, 30], mischarged tRNAs [41], hypomodified m1A58 pre-tRNAiMet [17, 18, 23], hypomodifications of the tRNA body that lead to rapid tRNA decay [31], tRNA anticodon hypomodifications that impair mRNA decoding [32], nuclear unprocessed aberrant pre-tRNAs that trigger nuclear surveillance [21, 22], and deletion of LOS1, loss of which leads to accumulation of intron-containing nuclear pre-tRNAs [35, 90].

Differential and composite GAAC stress responses in sla1Δ cells in EMM-Pro and NH4+

Our analyses indicate that sla1Δ cells grown in EMM-YES and -Pro constitutively express a core genetic program that is in accord with the GAAC response more than any other response characterized in S. pombe [30, 46, 47, 49, 57, 91], the hallmark feature of which is upregulation of genes involved in amino acid biosynthesis and metabolism. To further analyze the gcn2+ and fil1+ dependent 3AT response in S. pombe, to segregate it from other components of the response and relate it to the classic 3AT response in S. cerevisiae, Duncan et al. identified a core set of 26 orthologous genes strongly enriched in amino acid biosynthesis functions, that are bound by the Gcn4 and Fil1 transcription factors [47]. It is highly significant (p< 7.186e-9) that 7 of these Fil/Gcn4-26 genes are in the sla1Δ EMM-Pro set of constitutively upregulated genes (Fig 1E), arg5+ (CPA1), arg12+ (ARG1), asn1+ (ASN1), his4+ (HIS7), pas1+ (PCL5), aes1+ (YH19), and snz1+ (SNZ1), involved in amino acid metabolism. This is perhaps more significant considering that only 15 of the Fil/Gcn4-26 genes are in the 3AT-Fil1 set of 573 genes, and that only 5 of the Fil/Gcn4-26 genes are in the 3AT-GAAC set of 68 genes (S7 Table).

The overlap of the Gcn4/Fil1-26 core genes with the sla1Δ EMM-Pro set is more highly significant (p < 7.186e-9) than their overlap with the sla1Δ EMM-NH4+ set (9.4e-6) and with 24.7 vs. 16.7 RFs (Fig 1E). This is consistent with the idea that the sla1Δ EMM-Pro transcriptome reflects a basal core constituitive GAAC response to the absence of La whereas the NH4+ transcriptome reflects an additional stress response.

As part of the response to 3AT, Fil1 appears to activate pcr1+ and atf1+ and other factors that contribute to expression of CESR genes [47]. Prior to discovery of fil1+, the two transcriptomes were segregated using gcn2Δ and other mutants, into 3AT-CESR and 3AT-GAAC genes (Fig 1), referred to as Cluster 2 and Cluster 3 respectively in [46]. Although it is beyond the scope of the present study, future work shall assay Fil1, Gaf1 and Atf1 expression in sla1Δ vs. sla1+ in various media.

A case for nuclear surveillance signaling as one component of the GAAC response in sla1Δ cells

The GAAC response is activated by uORF-dependent translation of GCN4 mRNA in S. cerevisiae either by the classic Gcn2-dependent pathway or by alternate paths independent of Gcn2 and phosphorylation of Ser-51 of eIF2α. Nuclear surveillance is triggered by accumulation of nuclear unprocessed aberrant pre-tRNA and activates a Gcn2-independent pathway of the GAAC response in S. cerevisiae [17, 18, 21–23] and can be rescued, reversed or prevented by expression of nuclear tRNA maturation factors including La protein and the tRNA nuclear exporter, Los1 [17, 22].

Nuclear pre-tRNA processing is constitutively perturbed in sla1Δ cells. It may be argued that this could lead to overall lower levels of some tRNAs. A number of mature tRNAs accumulate at lower levels in sla1Δ relative to WT cells in EMM-NH4+, some as low as 65% [5]. Hypoacylation was documented for tRNALeu, tRNALys and tRNASer, at 0.80–0.86 levels in sla1Δ cells relative to WT, whereas all others were at ≥0.97 in EMM-NH4+ media [5], but tRNA acylation was at ≥0.97 in YES media (does not contain NH4+). Notably, this limited hypoacylation appeared highly selective, in each case for only one tRNA isoacceptor in its family reflecting its differential sensitivity to misfolding in the absence of La [5]. As noted sla1Δ cells exhibit restrictive uptake of leucine and other amino acids regulated by Any1 (below) that is exacerbated by NH4+ [50], and this may help explain why the tRNAs were hypoacylated in EMM-NH4+ [5].

Deletion of LOS1 from S. cerevisiae which causes nuclear pre-tRNA accumulation and interferes with the maturation of numerous tRNA species, leads to a GAAC response with no detectable inhibition of general translation, in an apparent Gcn2-independent manner [35]. It is remarkable that ectopic expression of los1+ in sla1Δ cells completely reversed activation of the three GAAC genes examined, also rescued slow growth, and restored a more normal balance of nuclear end-containing and pre-export pre-tRNAs [50] and here, Fig 2 demonstrates that rrp6 deletion decreases GAAC gene expression in response to sla1Δ. Because a primary defect in sla1Δ cells is general perturbation of nuclear pre-tRNA processing [20, 50, 84, 85, 88], this would appear to reflect a connection between tRNA nuclear surveillance and a GAAC response akin to S. cerevisiae [22]. As noted in the Results section regarding Fig 2, deletion of RRP6 from S. cerevisiae and rrp6+ from S. pombe have different effects on growth, the latter in a NH4+ media-specific manner. Also, deletion of RRP6 rescued a nuclear surveillance phenotype that could also be rescued by ectopic expression of tRNAiMet presumably reflecting that the growth deficiency was due to degradation of a single pre-tRNA species related to the known unique sensitivity of pre-tRNAiMet to lack of m1A58 in the trm6-504 mutant [23]. The growth deficiency of sla1Δ cells is more complex. In any case, although it is presently beyond the scope of this study, it will be important for future work to determine if deletion of fil1+ or gcn2+ will also suppress the GAAC mRNAs (e.g., in Fig 2).

In summary, transcriptome analysis has shown that sla1Δ cells are in a state of constitutive basal GAAC activation in all growth media tested. In addition, NH4+ in the media is associated with upregulation of CESR genes in these sla1Δ cells. However, even in sla1Δ cells growing in YES and EMM-Pro there may be multiple potential triggers of the GAAC, consistent with lines of evidence which indicate that La protein works with tRNA modification enzymes and in some cases synthetases, and its absence can exacerbate deficiencies [4, 5, 20, 92]. Recent results in S. pombe suggest the possibility that pertubations to tRNA homeostasis could affect multiple pathways of gcn2+-mediated stress signaling [93]. Because La is a general factor involved in nuclear pre-tRNA processing and modification, pertubations in sla1Δ cells have potential to disrupt aspects of translation connected to signal pathways beyond gcn2+, such as TORC1 [17, 22, 23, 32, 39, 41, 57, 94].

Spontaneous sla1Δ revertants (SSRs) of slow growth relieve inhibitition by NH4+ on leucine uptake

The second objective of this study was to isolate sla1Δ mutants that revert to a growth rate comparable to sla1+ on NH4+ media whose characterization advance our understanding of and insight into the biology involved. Although sla1Δ cells are deficient for leucine uptake, their slow growth can not be overcome by increasing the concentration of leucine in EMM, consistent with it its uptake inhibitition by NH4+ [50]. A striking characteristic was an apparent communal effect of the SSR mutants on the growth of their otherwise isogenic neighbors [95, 96]. As the SSRs emerged as rare mutants from the sla1Δ cells they were surrounded by smaller sattelite colonies (Fig 3A and 3B). This is consistent with the hypothesis of radial depletion of NH4+ from the media due to consumption by the SSR accounting for relief of growth inhibition of the surrounding sla1Δ cells. Anabolic consumption of NH4+ by a growing SSR would be consistent with the activities of Gdh2 and the multiple other GAAC upregulated genes in sla1Δ cells involved in basic amino acid metabolism. This is plausible because as NH4+ is the only nitrogen source here its benefit for growth would at some point be reduced to a concentration that no longer inhibits amino acid uptake [53, 97]. We note that an alternative hypothesis is that the SSRs release a compound/molecules that neutralize or otherwize override the negative effects of NH4+. Microbial communal life is complex [98, 99], and when affected by NH4+ involves PKA, TOR and SCH9 pathways [100].

A F32V mutation in SSR5 relieves a negative activity of any1+ that appears distinctive to sla1Δ cells

A nucleotide mutation that resulted in F32V in the ORF of Any1, the β-arrestin-related endocytic adaptor that was known to negatively regulate leucine uptake in NH4+ media [58, 77] was found in SSR5. The F32V mutation distinguished an activity in sla1Δ cells in EMM-NH4+. While any1-F32V largely restored growth to sla1Δ in NH4+ in SSR5, this allele had no apparent effect on growth in YES in any of the backgrounds tested (Fig 4B and 4C). Also, while any1+ was inhibitory to sla1Δ growth in NH4+, any1-F32V relieved this inhibition, whereas both alleles supported the any1+ function for growth in YES (Fig 4B and 4C).

Thorough studies have shown that Any1 and Pub1 work together to negatively regulate trafficking of amino acid transporters Aat1 and Cat1 to the plasma membrane [77]. The S. pombe Tsc1 and Tsc2 homologs of the tuberous sclerosis proteins regulate the amino acid transporter system upstream of Any1 and Pub1. Nakase et al. have shown that Any1 and Aat1 physically interact in vivo and can be co-immunoprecipitated as epitope-tagged proteins [77]. Finally, conditions in Δtsc cells lead to increased stability of Any1-Pub1 interactions resulting in retention of Aat1, its prevention from reaching the plasma membrane. We previously showed that deletion of pub1+ suppressed slow growth of sla1Δ in EMM in NH4+ and deletion of tsc1+ exacerbated it [50]. According to the model pathway proposed by Nakase and coworkers we suppose that the Any1-F32V mutation weakens retention of Aat1 by the Any1-Pub1 system under conditions that are sensed as nitrogen starvation in sla1Δ in EMM in NH4+ media. The Any1-F32V allele may be useful in future studies that seek to understand mechanisms involved in such regulation.

Materials and methods

Yeast strains and growth media

Yeast strains are listed in Table 1. The leu1+ derivative of yAS113 was made by integrating pJK148 [101] at the leu1-32 locus. CY1697 and CY1698 were made by replacing any1+ with any1::kan MX6 in yAS113 and yAS99 respectively. CY1710 and CY1712 were made by integrating any1+ pcr2.1NAT into CY1697 and CY1698 respectively. CY1711 and CY1713 were made by integrating any1-F32V pcr2.1NAT into CY1697 and CY1698 respectively.

thumbnail
Download:
Table 1.

https://doi.org/10.1371/journal.pone.0253494.t001

Media were prepared according to standard recipes. The recipe for standard EMM is described in [50]; according to EMM “complete” containing additional leucine, adenine, and uracil, each at 225 mg/l, unless selection for a plasmid was required. For EMM-Pro, the NH4Cl was replaced with 10 mM proline.

cDNA microarray analysis

Yeast growth, RNA isolation, cDNA labeling, microarray hybridization, data processing and the quantified data obtained for the three growth media after normalization were reported [50]. Dr. Juan Mata (Cambridge) kindly provided the 26 core genes bound by Fil1 and Gcn4 [47] that comprise the Fil1\Gcn4-26 gene set. The 3AT-GAAC and 3AT-CESR gene sets are from [46]. Other gene data are available on request. Statistical significance of overalapping genes was by http://nemates.org/MA/progs/overlap_stats_prog.html.

Gene ontology (GO)

Lewis-Sigler Institute, Princeton, https://go.princeton.edu/cgi-bin/GOTermFinder [59], PomBase GO terms.

Plasmids

The any1+ and any1-F32V integrative plasmids were constructed by PCR from yAS113 and SSR5 respectively with primers Any1F: SpeI GATCATACTAGTCGTAACTTCTATGCGCCTCA and Any1R: PmeI ACCTATAGTTTAAACTGCCGAAGGCATATTACTCA generating the any1+ ORF plus ~900 bp upstream and ~220 bp downstream genomic sequence. These were digested with SpeI and PmeI and integrated into the pcr2.1NAT vector. Resulting plasmids were digested by NdeI for integration.

RNA purification and northern blotting

Total RNA was purified as described [102]. For blotting, 5 and 10 μg of total RNA were separated in 1% denaturing agarose gel, transferred to nylon membrane (GeneScreen Plus; Perkin-Elmer), UV cross-linked, baked and hybridized at 42°C overnight with random primed 32P-DNA fragments of genes of interest. Hybridization solution was 5X Denhardt’s, 5X SSC, 50% formamide, 0.2% SDS, 5 mM EDTA, 100 μg/ml total yeast RNA (Baker’s yeast, Sigma). Quantitation was by PhosphorImager FLA-3000 (Fuji Film). For sequential probings, signal was stripped, monitored for loss of 32P before next probing.

Whole genome sequencing (WGS)

DNA isolated from S. pombe was prepared as a multiplexed library and subjected to paired-end sequencing generating 100-bp reads on an Illumina HiSeq. Whole genome read coverage was ~39X for SSR5 and higher for SSRs 4 and 6. The chr II:3487055–3487059 (minus strand) 4 bp deletion at the zfs1+ (SPBC1718.07c) locus converts 5’-AAATAAAATAC-3’ to 5’-AAATAC-3’.

Alignment of WGS library reads.

Read pairs were aligned without relative position constraints using Bowtie2 software [103] to the reference genome, yAS113, sla1Δ [76] with the following modifications as described: the sla1+ locus had been deleted and replaced with the disrupted ura4 locus derived from sequencing of the parent construct, base mutations previously noted by the Broad Institute were incorporated to bring genomic sequence into agreement with the FS101 background, and the chromosome 2 N-gap was filled with resolved sequence [76].

WGS mutation calling.

Single-base as well as insertion or deletion mutations between reference sequence and SSR strains were called using SAMtools pileup [104] noting sites where >40% base identity altered and attaching any relevant annotation or coding domain changes with ANNOVAR [105] as previously described [76]. Copy number variation was predicted from averaging mapped read depth across a sliding 400-base pair window while normalizing datasets to average overall read depth. Copy number variations were flagged at locations where this change exceeded 0.8x that of average depth.

Verification of WGS mutations.

Mutations were verified from DNA prepared from acid-washed bead-lysed S. pombe cells. Lysate was treated with DNase-free RNase A. Following phenol/chloroform extraction, pH 7.9 DNA was ethanol precipitated and quantitated. PCR amplification of regions of interest was performed, purified using QIAGEN QIAquick PCR cleanup kit and products sequenced by Macrogen USA Inc to verify mutations.

3H-leucine uptake

This was performed as described, in EMM-NH4+ media containing 225 mg/l leucine (∼1.6 mM) and a trace amount of 3H-leucine [50, 51]. Multiple regression/correlation analysis to derive p-values and t-tests from the 3H-leucine uptake data were as described [106].

Supporting information

S1 Table. Different media-dependent sla1Δ up-regulated gene transcriptome categories.

https://doi.org/10.1371/journal.pone.0253494.s001

(XLSX)

S2 Table.

A. GO analysis: sla1Δ-com = 1.5x up in both EMM NH4+ and EMM Pro (38 genes). B. GO analysis: sla1Δ-all = 1.5x up in YES, Pro and NH4+ (23 genes).

https://doi.org/10.1371/journal.pone.0253494.s002

(ZIP)

S3 Table.

A-C: GO analyses: sla1Δ-λYES (11 genes), sla1Δ-λPro (22 genes), sla1Δ-λNH4+ (26 genes).

https://doi.org/10.1371/journal.pone.0253494.s003

(XLSX)

S4 Table. GO analysis of gene transcripts >1.5x up, sla1Δ in EMM-Pro (60 genes).

https://doi.org/10.1371/journal.pone.0253494.s004

(XLSX)

S5 Table. GO analysis of gene transcripts >1.5x up, sla1Δ in EMM-NH4+ (64 genes).

https://doi.org/10.1371/journal.pone.0253494.s005

(XLSX)

S6 Table. GO analysis of gene transcripts >1.5x up, sla1Δ in YES (40 genes).

https://doi.org/10.1371/journal.pone.0253494.s006

(XLSX)

S7 Table. 26 orthologs in S. pombe & S. cerevisiae bound by Fil1 & GCN4.

https://doi.org/10.1371/journal.pone.0253494.s007

(XLSX)

S1 Raw image. A PDF file containing raw images of the northern blots for Figs 2, 3 and 5 as required by the journal.

https://doi.org/10.1371/journal.pone.0253494.s008

(PDF)

Acknowledgments

The authors would like to thank Alan Hinnebusch for discussion and very helpful critical comments on the manuscript, Juan Mata for sharing the ID names of the 26 orthologous genes bound by GCN4 and Fil1, Steve Coon and colleagues at the NICHD Molecular Genomics Core facility for sequencing.

References

  1. 1. Blewett NH, Maraia RJ. La involvement in tRNA and other RNA processing events including differences among yeast and other eukaryotes. Biochim Biophys Acta. 2018. pmid:29397330
  2. 2. Pannone B, Xue D, Wolin SL. A role for the yeast La protein in U6 snRNP assembly: evidence that the La protein is a molecular chaperone for RNA polymerase III transcripts. EMBO J. 1998;17:7442–53. pmid:9857199
  3. 3. Wolin SL, Cedervall T. The La protein. Annu Rev Biochem. 2002;71:375–403. pmid:12045101
  4. 4. Copela LA, Chakshusmathi G, Sherrer RL, Wolin SL. The La protein functions redundantly with tRNA modification enzymes to ensure tRNA structural stability. RNA. 2006;12:644–54. pmid:16581807
  5. 5. Vakiloroayaei A, Shah NS, Oeffinger M, Bayfield MA. The RNA chaperone La promotes pre-tRNA maturation via indiscriminate binding of both native and misfolded targets. Nucl Acids Res. 2017;45:11341–55. pmid:28977649
  6. 6. Moir RD, Willis IM. Regulation of pol III transcription by nutrient and stress signaling pathways. Biochim Biophys Acta. 2013;1829:361–75. pmid:23165150
  7. 7. Karkusiewicz I, Turowski TW, Graczyk D, Towpik J, Dhungel N, Hopper AK, et al. Maf1, repressor of RNA polymerase III, indirectly affects tRNA processing. J Biol Chem. 2011;286:39478–88. pmid:21940626
  8. 8. Arimbasseri AG, Blewett NH, Iben JR, Lamichhane TN, Cherkasova V, Hafner M, et al. RNA polymerase III output is functionally linked to tRNA dimethyl-G26 modification. PLoS Genetics. 2015; pmid:26720005
  9. 9. Foretek D, Wu J, Hopper AK, Boguta M. Control of Saccharomyces cerevisiae pre-tRNA processing by environmental conditions. RNA. 2016;22:339–49. pmid:26729922
  10. 10. Gudipati RK, Xu Z, Lebreton A, Séraphin B, Steinmetz LM, Jacquier A, et al. Extensive degradation of RNA precursors by the exosome in wild-type cells. Mol Cell. 2012;48:409–21. pmid:23000176
  11. 11. Turowski TW, Lesniewska E, Delan-Forino C, Sayou C, Boguta M, Tollervey D. Global analysis of transcriptionally engaged yeast RNA polymerase III reveals extended tRNA transcripts. Genome Res. 2016;26:933–44. pmid:27206856
  12. 12. Wolin SL, Maquat LE. Cellular RNA surveillance in health and disease. Science. 2019;366:822–7. pmid:31727827
  13. 13. LaCava J, Houseley J, Saveanu C, Petfalski E, Thompson E, Jacquier A, et al. RNA degradation by the exosome is promoted by a nuclear polyadenylation complex. Cell. 2005;121:713–24. pmid:15935758
  14. 14. Delan-Forino C, Spanos C, Rappsilber J, Tollervey D. Substrate specificity of the TRAMP nuclear surveillance complexes. Nat Commun. 2020;11:3122. pmid:32561742
  15. 15. Ogami K, Chen Y, Manley JL. RNA surveillance by the nuclear RNA exosome: mechanisms and significance. Noncoding RNA. 2018;4. pmid:29629374
  16. 16. Kadaba S, Wang X, Anderson JT. Nuclear RNA surveillance in Saccharomyces cerevisiae: Trf4p-dependent polyadenylation of nascent hypomethylated tRNA and an aberrant form of 5S rRNA. RNA. 2006;12:508–21. pmid:16431988
  17. 17. Anderson J, Phan L, Cuesta R, Carlson BA, Pak M, Asano K, et al. The essential Gcd10p-Gcd14p nuclear complex is required for 1-methyladenosine modification and maturation of initiator methionyl-tRNA. Genes Dev. 1998;12:3650–62. pmid:9851972
  18. 18. Calvo O, Cuesta R, Anderson J, Gutierrez N, Garcia-Barrio MT, Hinnebusch AG, et al. GCD14p, a repressor of GCN4 translation, cooperates with Gcd10p and Lhp1p in the maturation of initiator methionyl-tRNA in Saccharomyces cerevisiae. Mol Cell Biol. 1999;19:4167–81. pmid:10330157
  19. 19. Copela LA, Fernandez CF, Sherrer RL, Wolin SL. Competition between the Rex1 exonuclease and the La protein affects both Trf4p-mediated RNA quality control and pre-tRNA maturation. RNA. 2008;14:1214–27. pmid:18456844
  20. 20. Huang Y, Bayfield MA, Intine RV, Maraia RJ. Separate RNA-binding surfaces on the multifunctional La protein mediate distinguishable activities in tRNA maturation. Nat Struct Mol Biol. 2006;13:611–8. pmid:16799560
  21. 21. Vazquez de Aldana CR, Wek RC, Segundo PS, Truesdell AG, Hinnebusch AG. Multicopy tRNA genes functionally suppress mutations in yeast eIF-2 alpha kinase GCN2: evidence for separate pathways coupling GCN4 expression to unchanged tRNA. Mol Cell Biol. 1994;14:7920–32. pmid:7969132
  22. 22. Qiu H, Hu C, Anderson J, Björk G, Sarkar S, Hopper A, et al. Defects in tRNA Processing and Nuclear Export Induce GCN4 Translation Independently of Phosphorylation of the Alpha Subunit of eIF2. Mol Cell Biol. 2000;20:2505–16. pmid:10713174
  23. 23. Kadaba S, Krueger A, Trice T, Krecic AM, Hinnebusch AG, Anderson J. Nuclear surveillance and degradation of hypomodified initiator tRNAMet in S. cerevisiae. Genes Dev. 2004;18:1227–40. pmid:15145828
  24. 24. Wek RC, Ramirez M, Jackson BM, Hinnebusch AG. Identification of positive-acting domains in GCN2 protein kinase required for translational activation of GCN4 expression. Mol Cell Biol. 1990;10:2820–31. pmid:2188100
  25. 25. Wek RC, Jackson BM, Hinnebusch AG. Juxtaposition of domains homologous to protein kinases and histidyl-tRNA synthetases in GCN2 protein suggests a mechanism for coupling GCN4 expression to amino acid availability. Proc Natl Acad Sci U S A. 1989;86:4579–83. pmid:2660141
  26. 26. Zhu S, Sobolev AY, Wek RC. Histidyl-tRNA synthetase-related sequences in GCN2 protein kinase regulate in vitro phosphorylation of eIF-2. J Biol Chem. 1996;271:24989–94. pmid:8798780
  27. 27. Abastado JP, Miller PF, Jackson BM, Hinnebusch AG. Suppression of ribosomal reinitiation at upstream open reading frames in amino acid-starved cells forms the basis for GCN4 translational control. Mol Cell Biol. 1991;11:486–96. pmid:1986242
  28. 28. Niederberger P, Miozzari G, Hütter R. Biological role of the general control of amino acid biosynthesis in Saccharomyces cerevisiae. Mol Cell Biol. 1981;1:584–93. pmid:9279372
  29. 29. Hinnebusch AG. Translational regulation of GCN4 and the general amino acid control of yeast. Annu Rev Microbiol. 2005;59:407–50. pmid:16153175
  30. 30. Godard P, Urrestarazu A, Vissers S, Kontos K, Bontempi G, van Helden J, et al. Effect of 21 different nitrogen sources on global gene expression in yeast Saccharomyces cerevisiae. Mol Cell Biol. 2007;27:3065–86. pmid:17308034
  31. 31. De Zoysa T, Phizicky EM. Hypomodified tRNA in evolutionarily distant yeasts can trigger rapid tRNA decay to activate the general amino acid control response, but with different consequences. PLoS Genet. 2020;16:e1008893. pmid:32841241
  32. 32. Zinshteyn B, Gilbert WV. Loss of a conserved tRNA anticodon modification perturbs cellular signaling. PLoS Genet. 2013;9:e1003675. pmid:23935536
  33. 33. Daugeron MC, Lenstra TL, Frizzarin M, El Yacoubi B, Liu X, Baudin-Baillieu A, et al. Gcn4 misregulation reveals a direct role for the evolutionary conserved EKC/KEOPS in the t6A modification of tRNAs. Nucleic Acids Res. 2011;39:6148–60. pmid:21459853
  34. 34. Bruch A, Laguna T, Butter F, Schaffrath R, Klassen R. Misactivation of multiple starvation responses in yeast by loss of tRNA modifications. Nucleic Acids Res. 2020;48:7307–20. pmid:32484543
  35. 35. McCormick MA, Delaney JR, Tsuchiya M, Tsuchiyama S, Shemorry A, Sim S, et al. A Comprehensive Analysis of Replicative Lifespan in 4,698 Single-Gene Deletion Strains Uncovers Conserved Mechanisms of Aging. Cell Metab. 2015;22:895–906. pmid:26456335
  36. 36. Wlotzka W, Kudla G, Granneman S, Tollervey D. The nuclear RNA polymerase II surveillance system targets polymerase III transcripts. Embo j. 2011;30:1790–803. pmid:21460797
  37. 37. Vanacova S, Stefl R. The exosome and RNA quality control in the nucleus. EMBO Rep. 2007;8:651–7. pmid:17603538
  38. 38. Sloan KE, Schneider C, Watkins NJ. Comparison of the yeast and human nuclear exosome complexes. Biochem Soc Trans. 2012;40:850–5. pmid:22817747
  39. 39. Otsubo Y, Kamada Y, Yamashita A. Novel Links between TORC1 and Traditional Non-Coding RNA, tRNA. Genes (Basel). 2020;11. pmid:32825021
  40. 40. Willis IM, Moir RD. Signaling to and from the RNA Polymerase III Transcription and Processing Machinery. Annu Rev Biochem. 2018;87:75–100. pmid:29328783
  41. 41. Mohler K, Mann R, Kyle A, Reynolds N, Ibba M. Aminoacyl-tRNA quality control is required for efficient activation of the TOR pathway regulator Gln3p. RNA Biol. 2018;15:594–603. pmid:28910581
  42. 42. Huang HY, Hopper AK. Multiple Layers of Stress-Induced Regulation in tRNA Biology. Life (Basel). 2016;6. pmid:27023616
  43. 43. Hinnebusch AG, Natarajan K. Gcn4p, a master regulator of gene expression, is controlled at multiple levels by diverse signals of starvation and stress. Eukaryot Cell. 2002;1:22–32. pmid:12455968
  44. 44. Rawal Y, Chereji RV, Valabhoju V, Qiu H, Ocampo J, Clark DJ, et al. Gcn4 Binding in Coding Regions Can Activate Internal and Canonical 5’ Promoters in Yeast. Mol Cell. 2018;70:297–311.e4. pmid:29628310
  45. 45. Harding HP, Novoa I, Zhang Y, Zeng H, Wek R, Schapira M, et al. Regulated translation initiation controls stress-induced gene expression in mammalian cells. Mol Cell. 2000;6:1099–108. pmid:11106749
  46. 46. Udagawa T, Nemoto N, Wilkinson CR, Narashimhan J, Jiang L, Watt S, et al. Int6/eIF3e promotes general translation and Atf1 abundance to modulate Sty1 MAPK-dependent stress response in fission yeast. J Biol Chem. 2008;283:22063–75. pmid:18502752
  47. 47. Duncan CDS, Rodriguez-Lopez M, Ruis P, Bahler J, Mata J. General amino acid control in fission yeast is regulated by a nonconserved transcription factor, with functions analogous to Gcn4/Atf4. Proc Natl Acad Sci U S A. 2018;115:E1829–E38. pmid:29432178
  48. 48. Martín R, Berlanga JJ, de Haro C. New roles of the fission yeast eIF2α kinases Hri1 and Gcn2 in response to nutritional stress. J Cell Sci. 2013;126:3010–20. pmid:23687372
  49. 49. Chen D, Toone WM, Mata J, Lyne R, Burns G, Kivinen K, et al. Global transcriptional responses of fission yeast to environmental stress. Mol Biol Cell. 2003;14:214–29. pmid:12529438
  50. 50. Cherkasova V, Bahler J, Bacikova D, Pridham K, Maraia RJ. Altered nuclear tRNA metabolism in La-deleted S. pombe is accompanied by a nutritional stress response involving Atf1p and Pcr1p that is suppressible by Xpo-t/Los1p. Mol Biol Cell. 2012;23:480–91. pmid:22160596
  51. 51. Weisman R, Roitburg I, Nahari T, Kupiec M. Regulation of leucine uptake by tor1+ in Schizosaccharomyces pombe is sensitive to rapamycin. Genetics. 2005;169:539–50. pmid:15466417
  52. 52. Laor D, Cohen A, Kupiec M, Weisman R. TORC1 Regulates Developmental Responses to Nitrogen Stress via Regulation of the GATA Transcription Factor Gaf1. mBio. 2015;6:e00959. pmid:26152587
  53. 53. Petersen J, Russell P. Growth and the Environment of Schizosaccharomyces pombe. Cold Spring Harb Protoc. 2016;2016:pdb.top079764. pmid:26933253
  54. 54. Lamichhane TN, Blewett NH, Cherkasova VA, Crawford AK, Iben JR, Farabaugh PJ, et al. Lack of tRNA modification isopentenyl-A37 alters mRNA decoding and causes metabolic deficiencies in fission yeast. Mol Cell Biol. 2013;33:2918–29. pmid:23716598
  55. 55. Doi A, Fujimoto A, Sato S, Uno T, Kanda Y, Asami K, et al. Chemical genomics approach to identify genes associated with sensitivity to rapamycin in the fission yeast Schizosaccharomyces pombe. Genes Cells. 2015;20:292–309 pmid:25651869
  56. 56. Lamichhane TN, Arimbasseri AG, Rijal K, Iben JR, Wei FY, Tomizawa K, et al. Lack of tRNA-i6A modification causes mitochondrial-like metabolic deficiency in S. pombe by limiting activity of cytosolic tRNATyr, not mito-tRNA. RNA. 2016;22:583–96. pmid:26857223
  57. 57. Rodríguez-López M, Gonzalez S, Hillson O, Tunnacliffe E, Codlin S, Tallada VA, et al. The GATA Transcription Factor Gaf1 Represses tRNAs, Inhibits Growth, and Extends Chronological Lifespan Downstream of Fission Yeast TORC1. Cell Rep. 2020;30:3240–9.e4. pmid:32160533
  58. 58. Nakashima A, Kamada S, Tamanoi F, Kikkawa U. Fission yeast arrestin-related trafficking adaptor, Arn1/Any1, is ubiquitinated by Pub1 E3 ligase and regulates endocytosis of Cat1 amino acid transporter. Biol Open. 2014;3:542–52. pmid:24876389
  59. 59. Boyle EI, Weng S, Gollub J, Jin H, Botstein D, Cherry JM, et al. GO::TermFinder—open source software for accessing Gene Ontology information and finding significantly enriched Gene Ontology terms associated with a list of genes. Bioinformatics. 2004;20:3710–5. pmid:15297299
  60. 60. Lock A, Rutherford K, Harris MA, Hayles J, Oliver SG, Bähler J, et al. PomBase 2018: user-driven reimplementation of the fission yeast database provides rapid and intuitive access to diverse, interconnected information. Nucleic Acids Res. 2019;47:D821–d7. pmid:30321395
  61. 61. Nakase Y, Matsumoto T. The RHEB-mTOR axis regulates expression of Tf2 transposons in fission yeast. J Cell Sci. 2018;131. pmid:30301783
  62. 62. Lorenz DR, Meyer LF, Grady PJ, Meyer MM, Cam HP. Heterochromatin assembly and transcriptome repression by Set1 in coordination with a class II histone deacetylase. Elife. 2014;3:e04506. pmid:25497836
  63. 63. Lemay JF, D’Amours A, Lemieux C, Lackner DH, St-Sauveur VG, Bähler J, et al. The nuclear poly(A)-binding protein interacts with the exosome to promote synthesis of noncoding small nucleolar RNAs. Mol Cell. 2010;37:34–45. pmid:20129053
  64. 64. Mukherjee K, Gardin J, Futcher B, Leatherwood J. Relative contributions of the structural and catalytic roles of Rrp6 in exosomal degradation of individual mRNAs. Rna. 2016;22:1311–9. pmid:27402898
  65. 65. Shichino Y, Otsubo Y, Yamamoto M, Yamashita A. Meiotic gene silencing complex MTREC/NURS recruits the nuclear exosome to YTH-RNA-binding protein Mmi1. PLoS Genet. 2020;16:e1008598. pmid:32012158
  66. 66. Burkard KT, Butler JS. A nuclear 3’-5’ exonuclease involved in mRNA degradation interacts with Poly(A) polymerase and the hnRNA protein Npl3p. Mol Cell Biol. 2000;20:604–16. pmid:10611239
  67. 67. Fang F, Hoskins J, Butler JS. 5-fluorouracil enhances exosome-dependent accumulation of polyadenylated rRNAs. Mol Cell Biol. 2004;24:10766–76. pmid:15572680
  68. 68. Libri D, Dower K, Boulay J, Thomsen R, Rosbash M, Jensen TH. Interactions between mRNA export commitment, 3’-end quality control, and nuclear degradation. Mol Cell Biol. 2002;22:8254–66. pmid:12417728
  69. 69. Weisman R, Roitburg I, Schonbrun M, Harari R, Kupiec M. Opposite effects of tor1 and tor2 on nitrogen starvation responses in fission yeast. Genetics. 2007;175:1153–62. pmid:17179073
  70. 70. Jacobs JZ, Ciccaglione KM, Tournier V, Zaratiegui M. Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014;5:5344. pmid:25352017
  71. 71. Ekwall K, Cranston G, Allshire RC. Fission yeast mutants that alleviate transcriptional silencing in centromeric flanking repeats and disrupt chromosome segregation. Genetics. 1999;153:1153–69. pmid:10545449
  72. 72. Kanoh J, Ishikawa F. spRap1 and spRif1, recruited to telomeres by Taz1, are essential for telomere function in fission yeast. Curr Biol. 2001;11:1624–30. pmid:11676925
  73. 73. Jia S, Noma K, Grewal SI. RNAi-independent heterochromatin nucleation by the stress-activated ATF/CREB family proteins. Science. 2004;304:1971–6. pmid:15218150
  74. 74. Grewal SI, Klar AJ. A recombinationally repressed region between mat2 and mat3 loci shares homology to centromeric repeats and regulates directionality of mating-type switching in fission yeast. Genetics. 1997;146:1221–38. pmid:9258669
  75. 75. Irvine DV, Goto DB, Vaughn MW, Nakaseko Y, McCombie WR, Yanagida M, et al. Mapping epigenetic mutations in fission yeast using whole-genome next-generation sequencing. Genome Res. 2009;19:1077–83. pmid:19423874
  76. 76. Iben JR, Epstein JA, Bayfield MA, Bruinsma MW, Hasson S, Bacikova D, et al. Comparative whole genome sequencing reveals phenotypic tRNA gene duplication in spontaneous Schizosaccharomyces pombe La mutants. Nucleic Acids Res. 2011;39:4728–42. pmid:21317186
  77. 77. Nakase Y, Nakase M, Kashiwazaki J, Murai T, Otsubo Y, Mabuchi I, et al. The fission yeast beta-arrestin-like protein Any1 is involved in TSC-Rheb signaling and the regulation of amino acid transporters. J Cell Sci. 2013;126:3972–81. pmid:23813957
  78. 78. Thodberg M, Thieffry A, Bornholdt J, Boyd M, Holmberg C, Azad A, et al. Comprehensive profiling of the fission yeast transcription start site activity during stress and media response. Nucl Acids Res. 2019;47:1671–91. pmid:30566651
  79. 79. Navarro FJ, Chakravarty P, Nurse P. Phosphorylation of the RNA-binding protein Zfs1 modulates sexual differentiation in fission yeast. J Cell Sci. 2017;130:4144–54. pmid:29084823
  80. 80. Li H, Hou J, Bai L, Hu C, Tong P, Kang Y, et al. Genome-wide analysis of core promoter structures in Schizosaccharomyces pombe with DeepCAGE. RNA Biol. 2015;12:525–37. pmid:25747261
  81. 81. Liu Q, Ma Y, Zhou X, Furuyashiki T. Constitutive Tor2 Activity Promotes Retention of the Amino Acid Transporter Agp3 at Trans-Golgi/Endosomes in Fission Yeast. PLoS One. 2015;10:e0139045. pmid:26447710
  82. 82. Karagiannis J, Saleki R, Young PG. The pub1 E3 ubiquitin ligase negatively regulates leucine uptake in response to NH(4)(+) in fission yeast. Curr Genet. 1999;35:593–601. pmid:10467003
  83. 83. Yoo CJ, Wolin SL. The yeast La protein is required for the 3’ endonucleolytic cleavage that matures tRNA precursors. Cell. 1997;89:393–402. pmid:9150139
  84. 84. Van Horn DJ, Yoo CJ, Xue D, Shi H, Wolin SL. The La protein in Schizosaccharomyces pombe: a conserved yet dispensable phosphoprotein that functions in tRNA maturation. RNA. 1997;3:1434–43. pmid:9404894
  85. 85. Intine RVA, Sakulich AL, Koduru SB, Huang Y, Pierstorrf E, Goodier JL, et al. Control of transfer RNA maturation by phosphorylation of the human La antigen on serine 366. Mol Cell. 2000;6:339–48. pmid:10983981
  86. 86. Intine RV, Dundr M, Misteli T, Maraia RJ. Aberrant nuclear trafficking of La protein leads to disordered processing of associated precursor tRNAs. Mol Cell. 2002;9:1113–23. pmid:12049746
  87. 87. Kufel J, Tollervey D. 3’-processing of yeast tRNATrp precedes 5’-processing. RNA. 2003;9:202–8. pmid:12554863
  88. 88. Bayfield MA, Maraia RJ. Precursor-product discrimination by La protein during tRNA metabolism. Nat Struct & Mol Biol. 2009;16:430–7. pmid:19287396
  89. 89. Dong J, Qiu H, Garcia-Barrio M, Anderson J, Hinnebusch AG. Uncharged tRNA activates GCN2 by displacing the protein kinase moiety from a bipartite tRNA-binding domain. Mol Cell. 2000;6:269–79. pmid:10983975
  90. 90. Sarkar S, Hopper AK. tRNA nuclear export in Saccharomyces Cerevisiae: in situ hybridization analysis. Mol Biol Cell. 1998;9:3041–55. pmid:9802895
  91. 91. Nemoto N, Udagawa T, Ohira T, Jiang L, Hirota K, Wilkinson CR, et al. The roles of stress-activated Sty1 and Gcn2 kinases and of the protooncoprotein homologue Int6/eIF3e in responses to endogenous oxidative stress during histidine starvation. J Mol Biol. 2010;404:183–201. pmid:20875427
  92. 92. Johansson MJ, Bystrom AS. Dual function of the tRNA(m(5)U54)methyltransferase in tRNA maturation. RNA. 2002;8:324–35. pmid:12003492
  93. 93. Anda S, Zach R, Grallert B. Activation of Gcn2 in response to different stresses. PLoS One. 2017;12:e0182143. pmid:28771613
  94. 94. Otsubo Y, Matsuo T, Nishimura A, Yamamoto M, Yamashita A. tRNA production links nutrient conditions to the onset of sexual differentiation through the TORC1 pathway. EMBO Rep. 2018;19:e44867. pmid:29330317
  95. 95. Maršíková J, Pavlíčková M, Wilkinson D, Váchová L, Hlaváček O, Hatáková L, et al. The Whi2p-Psr1p/Psr2p complex regulates interference competition and expansion of cells with competitive advantage in yeast colonies. Proc Natl Acad Sci U S A. 2020;117:15123–31. pmid:32541056
  96. 96. Leeder AC, Palma-Guerrero J, Glass NL. The social network: deciphering fungal language. Nat Rev Microbiol. 2011;9:440–51. pmid:21572459
  97. 97. Bicho CC, de Lima Alves F, Chen ZA, Rappsilber J, Sawin KE. A genetic engineering solution to the "arginine conversion problem" in stable isotope labeling by amino acids in cell culture (SILAC). Mol Cell Proteomics. 2010;9:1567–77. pmid:20460254
  98. 98. Wilkinson D, Maršíková J, Hlaváček O, Gilfillan GD, Ježková E, Aaløkken R, et al. Transcriptome Remodeling of Differentiated Cells during Chronological Ageing of Yeast Colonies: New Insights into Metabolic Differentiation. Oxid Med Cell Longev. 2018;2018:4932905. pmid:29576850
  99. 99. Palková Z, Forstová J. Yeast colonies synchronise their growth and development. J Cell Sci. 2000;113:1923–8. pmid:10806103
  100. 100. Santos J, Sousa MJ, Leão C. Ammonium is toxic for aging yeast cells, inducing death and shortening of the chronological lifespan. PLoS One. 2012;7:e37090. pmid:22615903
  101. 101. Keeney JB, Boeke JD. Efficient targeted integration at leu1-32 and ura4-294 in Schizosaccharomyces pombe. Genetics. 1994;136:849–56. pmid:8005439
  102. 102. Lyne R, Burns G, Mata J, Penkett CJ, Rustici G, Chen D, et al. Whole-genome microarrays of fission yeast: characteristics, accuracy, reproducibility, and processing of array data. BMC Genomics. 2003;4:27. pmid:12854975
  103. 103. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9:357–9. pmid:22388286
  104. 104. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 2009;25:2078–9. pmid:19505943
  105. 105. Wang K, Li M, Hakonarson H. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res. 2010;38:e164. pmid:20601685
  106. 106. Cohen J, Cohen P, West SG, Aiken LS. Applied Multiple Regression/Correlation Analysis for the Behavioral Sciences (3rd edition). Mahwah, NJ: Lawrence Earlbaum Associates; 2003.