Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

High pyrethroid/DDT resistance in major malaria vector Anopheles coluzzii from Niger-Delta of Nigeria is probably driven by metabolic resistance mechanisms

  • Abdullahi Muhammad ,

    Roles Conceptualization, Formal analysis, Funding acquisition, Writing – original draft

    abdullahi.muhammad@lstmed.ac.uk

    Affiliations Vector Biology Department, Liverpool School of Tropical Medicine (LSTM), Liverpool, United Kingdom, Centre for Biotechnology Research, Bayero University, Kano, Nigeria

  • Sulaiman S. Ibrahim,

    Roles Conceptualization, Formal analysis, Writing – review & editing

    Affiliations Vector Biology Department, Liverpool School of Tropical Medicine (LSTM), Liverpool, United Kingdom, Department of Biochemistry, Bayero University, Kano, Nigeria, LSTM Research Unit, Centre for Research in Infectious Diseases (CRID), Yaoundé, Cameroon

  • Muhammad M. Mukhtar,

    Roles Data curation, Formal analysis, Investigation

    Affiliation Department of Biochemistry, Bayero University, Kano, Nigeria

  • Helen Irving,

    Roles Data curation, Formal analysis, Software

    Affiliation Vector Biology Department, Liverpool School of Tropical Medicine (LSTM), Liverpool, United Kingdom

  • Maduamaka C. Abajue,

    Roles Data curation, Investigation, Validation, Writing – review & editing

    Affiliation Department of Animal and Environmental Biology, University of Port Harcourt, Port Harcourt, Nigeria

  • Noutcha M. A. Edith,

    Roles Data curation, Validation, Writing – review & editing

    Affiliation Department of Animal and Environmental Biology, University of Port Harcourt, Port Harcourt, Nigeria

  • Sabitu S. Da’u,

    Roles Data curation, Software, Writing – review & editing

    Affiliation Department of Science, School of Continuing Education, Bayero University, Kano, Nigeria

  • Mark J. I. Paine,

    Roles Conceptualization, Supervision, Writing – review & editing

    Affiliation Vector Biology Department, Liverpool School of Tropical Medicine (LSTM), Liverpool, United Kingdom

  • Charles S. Wondji

    Roles Conceptualization, Data curation, Formal analysis, Validation, Writing – review & editing

    Affiliations Vector Biology Department, Liverpool School of Tropical Medicine (LSTM), Liverpool, United Kingdom, LSTM Research Unit, Centre for Research in Infectious Diseases (CRID), Yaoundé, Cameroon

Abstract

Entomological surveillance of local malaria vector populations is an important component of vector control and resistance management. In this study, the resistance profile and its possible mechanisms was characterised in a field population of the major malaria vector Anopheles coluzzii from Port Harcourt, the capital of Rivers state, in the Niger-Delta Region of Nigeria. Larvae collected in Port-Harcourt, were reared to adulthood and used for WHO bioassays. The population exhibited high resistance to permethrin, deltamethrin and DDT with mortalities of 6.7% ± 2.4, 37.5% ± 3.2 and 6.3% ± 4.1, respectively, but were fully susceptible to bendiocarb and malathion. Synergist bioassays with piperonylbutoxide (PBO) partially recovered susceptibility, with mortalities increasing to 53% ± 4, indicating probable role of CYP450s in permethrin resistance (χ2 = 29.48, P < 0.0001). Transcriptional profiling revealed five major resistance-associated genes overexpressed in the field samples compared to the fully susceptible laboratory colony, Ngoussou. Highest fold change (FC) was observed with GSTe2 (FC = 3.3 in permethrin exposed and 6.2 in unexposed) and CYP6Z3 (FC = 1.4 in exposed and 4.6 in unexposed). TaqMan genotyping of 32 F0 females detected the 1014F and 1575Y knockdown resistance (kdr) mutations with frequencies of 0.84 and 0.1, respectively, while 1014S mutation was not detected. Sequencing of a fragment of the voltage-gated sodium channel, spanning exon 20 from 13 deltamethrin-resistant and 9 susceptible females revealed only 2 distinct haplotypes with a low haplotype diversity of 0.33. The findings of high pyrethroid resistance but with a significant degree of recovery after PBO synergist assay suggests the need to move to PBO-based nets. This could be complemented with carbamate- or organophosphate-based indoor residual spraying in this area.

Background

Malaria kills approximately 400,000 people in 2018 alone, 93% of these deaths in the sub-Saharan Africa. Nigeria alone account for the highest burden of malaria, at 25% of all global cases [1]. The control of malaria vectors is reliant on the use of chemical insecticides through indoor residual spraying (IRS), long-lasting lasting insecticidal nets (LLINs) and Insecticide treated mosquito nets (ITNs) [2,3]. These interventions have reduced malaria transmission to half its level from year 2000 to 2015 [4]. However, the major threat to these recorded successes is the issue of insecticide resistance in the major malaria vectors leading to retrogression and an increase in transmission [5,6]. Adequate data gathering on the resistance profiles and mechanisms in the local malaria vector populations is a key to guide deployment of control tools using evidence-based strategies [7,8].

The major vectors of malaria in Nigeria are Anopheles gambiae s.s., Anopheles coluzzii, Anopheles arabiensis and the patchily distributed Anopheles funestus s.s. [911]. However, Anopheles coluzzii has become the dominant species reported in most parts of Nigeria in recent years, e.g. in the south western region [12,13], the south eastern region [14] and the northern regions [15,16]. Insecticide resistance in Anopheles gambiae s.l. has been reported in Nigeria as far back as the early 1960s. In the southern part of the country for example, resistance to dieldrin, lindane and dichlorodiphenyltrichloroethane (DDT), but susceptibility to malathion parathion, fenthion, and bromophos was reported [17]. Moreover, in Sokoto, in the northwest of the country resistance to dieldrin, DDT and benzene hexachloride (BHC) was reported early [18]. Decades after these earlier efforts, data documenting the evolution of the malaria vectors, their insecticide resistance profiles and the underlying molecular mechanisms driving the resistance are still lacking, particularly in the Niger-Delta (south-south) region of the country.

Malaria transmission is practically perennial in the coastal regions of Nigeria (including the Niger-Delta), due to the prolonged rainy season which provides Anopheles breeding sites year round [1921]. This is in contrast to the northern part of the country, with shorter rainy season (3–5 months) and thus relatively lower transmission rates [19]. Unfortunately, where numerous strides have been made in determining the transmission profiles of malaria mosquitoes, insecticide resistance and the molecular mechanisms driving it in other parts of the country, e.g. in southwestern Nigeria [13,2224] and in the north, e.g. [11,15,25], little information is available from the south-south/Niger-Delta region. Baseline information on the abundance of Anopheles and its distribution [26], insecticide resistance profiles [27] are available in this region, without actually going deep into studying the molecular mechanisms involved. Equally, also there is a dearth of information on the potential impact of the resistance on the malaria control tools such, as the efficacy of bed nets, as recently conducted in other parts of the country [15,28]. As well, information on the role of target-site resistance mechanisms like the 1014F/S knockdown resistance (kdr) mutations [29,30] is also lacking in south-south of Nigeria, compared to other parts of the country where frequencies of these mutations have been described in several studies [1416,31].

In this work, resistance profiles of An. coluzzii from Port Harcourt, Niger-Delta, Nigeria was investigated, establishing high resistance to pyrethroids and DDT, with evidences from qPCR (overexpression of CYP6Z2 and CYP6M3 especially) and synergist bioassay with piperonyl butoxide implicating cytochrome P450s in driving permethrin resistance. Analysis of the voltage gated sodium channel also revealed the presence of 1014F kdr mutation at high frequency, whereas 1014S was not detected. The 1575Ymutation was detected but only at a very low frequency.

Methods

Study site and sample collection

Port Harcourt (4.8156° N, 7.0498° E), the capital of Rivers State, Nigeria lies along the Bonny Rivers in the south-south region of the country, also referred to as the Niger-Delta. It is situated in the Tropical Mangrove, with rain extending from February to December [32]. It is ever green and ever raining because only the months of January and December can be truly called dry season, as such malaria is perennial in the region due to availability of Anopheles breeding sites year-round [33]. The heaviest rains in Port Harcourt occur in September with an average of 367 mm while December is the driest month of the year with an average rain of 20 mm [32].

Larval collection was conducted in Port Harcourt Metropolis in October and November 2019. Larvae were randomly collected from 33 rainwater puddles, in 5 sites, at Obio/Akpor Government Area (Fig 1). The larvae were suspected to belong to An. gambiae Complex based on their morphology (sizes and color) and all the female adults that emerged were identified morphologically as belonging to Anopheles gambiae s.l. [34]. Larvae were reared at the insectary (each group from particular puddle in separate tray) at the department of animal and experimental biology, University of Port Harcourt, at 25–28°C and 70–80% relative humidity.

thumbnail
Fig 1. Map of sampling site, showing Obio/Akpor local Government of Port-Harcourt Metropolis, Rivers state, Nigeria.

https://doi.org/10.1371/journal.pone.0247944.g001

Mosquitoes identification to species level

Genomic DNA (gDNA) was extracted from 48 F0 female mosquitoes randomly selected from the cages [35]. The gDNA was utilised in the identification to the species level using the SINE200 PCR [36]. All mosquitoes were confirmed as An. coluzzii with a band of ~479 bp on agarose gel (S1 Fig). Also, legs individually pulled out from randomly selected 60 adult females used for qPCR were extracted for species identification, as above, with all the females confirmed as An. coluzzii.

WHO insecticides susceptibility testing

The resistance profile of the mosquito population was established using the WHO protocol [37]. 3–5 days old F0 mosquitoes (4 replicates each of 25 females in a tube) were exposed to the diagnostic concentrations of the insecticides for 1 h. These insecticides include the pyrethroids: permethrin (0.75%) and deltamethrin (0.05%), the organochloride, dichlorodiphenyltrichloroethane (4% DDT), the carbamate, bendiocarb (0.1%), and the organophosphate, malathion (5%). All the insecticide impregnated papers were obtained from Vector Control Research Unit, University Sains Malaysia, Penang, Malaysia. One tube each was used as control for each insecticide tested, with 25 females exposed to control papers impregnated only with the carrier oil (QC controls for pyrethroids, OC control for DDT while OP and PY controls were used for bendiocarb and malathion, respectively). Knockdown rates were monitored for the pyrethroids and DDT at 15 min, 30 min, 45 min and 60 min post-exposure. Mosquitoes were then transferred into the holding tubes and allowed to recover for 24 h during which they were fed with 10% sucrose solution. Mortality was recorded 24 h after the exposure. All bioassays were carried out at at 25–28°C and 70–80% relative humidity. Resistance status of the population was established according to WHO criteria [37] for which populations with mortality > 98% are considered susceptible, population with mortality of 90–98% are considered moderately resistant, and those with mortality > 90% as resistant. Abbott’s formula was not used to correct mortalities in the control mosquitoes of which the highest was 4%. The papers were tested on a susceptible population of An. coluzzii, Ngoussou to ascertain their efficacy before being use for the testing on the field population.

Synergist assay

Piperonyl butoxide (PBO) (obtained from Vector Control Research Unit, University Sains Malaysia, Penang, Malaysia) was utilised in a synergist bioassay with pyrethroid to investigate the potential role of P450s and/or oxidases in resistance [38]. Four replicates each of 25 F0 females were pre-exposed to 4% PBO for 1 h, after which they were then transferred to tubes containing 0.75% permethrin-impregnated papers, for 1 h. Mosquitoes were then transferred to holding tubes to recover for 24 h, and mortality was scored. Two tubes with 25 females were used as controls, with mosquitoes in the first tube exposed to only PBO, while those in the second tube were only exposed to permethrin [37].

Transcriptional analysis using quantitative PCR

3–5 days old, F0 females which survive exposure to deltamethrin (deltamethrin-alive) and unexposed females were used for RNA extraction, alongside females from Ngousso colony. Total RNA was extracted from three biological replicates of 10 females using the Arcturus PicoPure Kit (Applied Biosystems, CA, USA) according to the manufacturer’s instructions. The RNA was treated with Dnase (Qiagen, Hilden, Germany) in order to degrade any residual gDNA. Purity and concentrations of the RNA was measured using nanodrop UV-Visible spectrophotometer (Thermo Scientific, Massachusetts, USA). 1 μg of the total RNA was used as initial template to synthesize the cDNA using an oligo(dT) primer and superscript III reverse transcriptase enzyme (Invitrogen, Waltham, CA, USA) following manufacturer’s protocol. Primers for five well-known pyrethroid metabolizing P450s, including (CYP6P3, CYP6M3, CYP6Z2, CYP6Z3 [3942] and DDT metabolizing GST, GSTe2 [43,44] were used for qPCR (S1 Table in S1 File). Ribosomal gene S7 and glucose-6-phosphate dehydrogenase (GADH) were used as the house keeping genes [45]. 1 μl of cDNA was used as template in a PCR reaction with final volume of 20 μl. The components of the mixture included 10 μl of SyBr Green fluorescent dye (Sigma Aldrich, Germany), 0.6 μl each of the forward and reverse primers, which was topped up to 20 μl by adding 7.8 μl of nuclease free water. Thermocycling conditions were initial denaturation at 95 °C for 3 min, followed by 40 cycles each of 95 °C for 10 s, 60 °C for 10 s. Final conditions were 95 °C for 60 s, 55 °C for 30 s and 95 °C for 30 s.

The data generated were analysed according to the ddCt protocol [46] in comparison with the house keeping genes, RSP7 (AGAP010592) and GADH; the efficiencies of the primers were incorporated into the calculation. The data were converted to their logarithmic forms to ensure normal distribution. The expression levels between the exposed and unexposed were analysed using tow-tailed t-test at 95% confidence levels. The list of forward and reverse primers used in the study are attached in S1 File.

Genotyping of knockdown resistance mutations

The frequencies of the 1014F, 1014S and 1575Y voltage-gated sodium channel mutations were determined in the field F0 females using TaqMan assay. Genotyping was carried using 32 randomly selected females with real-time thermocyclers (Agilent, Mx3005) using a previously established protocols [4749]. The probes for 1014F ((5’-acgacaaaatttc-3’) and 1014S (5-‘acgactgaatttc-3’) were used based on previous study [48]. Forward (5’-catttttcttggccactgtagtgat-3’) and reverse (5’cgatcttggtccatgttaatttgca-3’) kdr primer pairs were also adopted from the work of Bass [48]. The probes used in detecting the wild 1575Y and the N1575 were also labelled with FAM (3′nfqtttttcattgcataatagtac) and HEX (3′nfqatttttttcattgcattatagtac), and forward (tggatcgctagaaatgttcatgaca) and reverse (cgaggaattgcctttagaggtttct) primer pairs were also adopted from [49]. In a final volume of 10 μl comprise of 1 μl of gDNA, 4.25 μl ddH20, 0.25 μl (40x) probes containing allelic-specific primers in each case, and 5 μl of Sensimix (Bioline, London, UK). Cycling conditions were 10 min at 95°C, followed by 40 cycles each of 92 °C for 15 s and 60 °C for 1 min. Two probes labelled with fluorescent dyes, HEX and FAM were used to detect the susceptible and resistant alleles respectively, were used. Three controls were used in each case, gDNA from known homozygote resistant, heterozygote resistant and homozygote susceptible individuals. A negative control was also used, which has 1 μl distilled water instead of gDNA. Results were analysed from scatter plots using the Mx Pro software.

Polymorphism analysis of the Voltage-Gated Sodium Channel (VGSC)

To assess genetic diversity of the VGSC, a fragment spanning the intron-1 and intron-2, and the exon 20 was amplified in 13 deltamethrin-alive and 9 dead females This was done using the previously published set of primers kdrCL-F (5′-AAA TGT CTC GCC CAA ATCAG-3) and kdrCL-R (5′-GCA CCT GCA AAA CAA TGTCA-3) [50]. The PCR premix had 1.5 μl 10x buffer A, 0.75 μl of MgCl2, 0.12 μl each of Kapa Taq polymerase and dNTPs, 0.51 μl each of the forward and reverse primers, and 10.49 μl of ddH20. 1 μl of the gDNA was topped up to make a total of 15 μl reaction volume. The thermal cycling conditions included an initial denaturation at 95 °C for 5 min, followed by 35 cycles each of 94 °C for 30 s, 57 °C for 30 s, 72 °C for 45 s and a final elongation at 72 °C for 10 min. PCR products were cleaned and purified using the QIAquick® PCR Purification Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s directives. The purified products were individually sequenced on both strands using the same pair of primers above.

For polymorphism analyses, Bioedit [51] was used to visualize and manually edit and aligned (ClustalW) the sequences. Pattern of genetic variability was assessed using the DnaSPv6.0 [52]. Maximum likelihood phylogenetic tree was constructed using MEGA 6.0 [53].

Data analysis

Results of bioassays are presented as percentage mortalities for respective insecticides as bars with standard deviations. Two-tailed Chi-square test was conducted to compare result of synergist assays with conventional one, using GraphPad Prism (GraphPad Inc., La Jolla, CA, USA). Two-tailed t-test was also conducted to compare the expression levels between the exposed and unexposed individuals. The frequencies of kdr mutations were respectively calculated using the formulae F(R) = (2 x RR + RS)/2N, F(S) = 1-F(R), where RR = Total number of homozygote resistant, RS = Total number of heterozygote resistant, S = susceptible individuals and N = total number of individuals.

Results

Insecticide resistance profile of An. coluzzii

Bioassay showed the Port Harcourt An. coluzzii population as highly resistant to pyrethroids and DDT. The knockdown rates in permethrin (type I pyrethroid), deltamethrin (type II pyrethroid) and DDT was very low, recorded within the range of 3.3 to the highest of 10%. These low knockdown rates were also supported by the 24 h mortalities which did not significantly increased except in the case of deltamethrin. This reiterates the fact that the population is highly resistant to the pyrethroids and DDT (Fig 2a).

thumbnail
Fig 2. Insecticide susceptibility of the Anopheles coluzzii of the Niger Delta, Nigeria.

a: Percentage knockdown rates due to exposure to various insecticides; b. Percentage mortalities from WHO susceptibility assay using five insecticides. Results are presented as mean ± SD (standard deviation); c. Result of synergist assay with PBO showing recovery of mortality in synergized mosquitoes exposed to permethrin. *** statistically significant.

https://doi.org/10.1371/journal.pone.0247944.g002

A high mortality rate (37.5%) was recorded in WHO bioassays with 0.05% deltamethrin in comparison to the very low mortality of only 6.7% ± 2.4 observed with 0.75% permethrin (Fig 2b). There was no mortalities in all the negative control, except for malathion, with 4% mortality (not shown in Fig 2b). The population was more resistant to permethrin than deltamethrin. However, the organochlorine DDT also showed mortalities of only 6.3% ± 4.1, 24 h post-exposure. The population showed complete susceptibility to organophosphate malathion and the carbamate bendiocarb with a mortality of 100% for both insecticides.

Investigating the role of P450 monooxygenases in resistance using PBO bioassay

PBO-synergist bioassay recovered some susceptibility towards permethrin with mortality increasing from 6.7% ± 2.4 as obtained from the conventional bioassay to 53% ± 4, indicating the potential role of P450s in permethrin resistance (Fig 2c). Two-tailed chi-square test indicated that the association between the recovery of susceptibility from PBO exposure as significant (χ2 = 29.479, df = 1, P < 0.0001).

Expression profile of candidate resistance genes

The expression of profile of four P450s and GSTe2 was investigated in females which survived exposure, the unexposed females and Ngousso (Fig 3). These genes were found to be overexpressed in the field population compared to Ngousso. Specifically, highest expression was observed in GSTe2 and CYP6Z3 (Fold change = 6.2 and 4.6, respectively). The least expression was observed in CYP6Z2 (FC = 0.24), whereas CYP6P3 and CYP6M3 were moderately overexpressed (1.8- and 1.2-folds). Two-tailed t-test carried out to determine the statistical differences between the expression levels in the exposed and unexposed individuals revealed expressions in the unexposed individuals to be significantly higher than the exposed for CYP6P3 (P = 0.0025) (Fig 3).

thumbnail
Fig 3. Determination of molecular basis of pyrethroid resistance in the An. coluzzii population.

Results of transcription profiling of 5 major insecticide resistance gene using qRT-PCR. Values are represented as mean of expression in relation to Ngousso ± SD.

https://doi.org/10.1371/journal.pone.0247944.g003

Investigating presence of target site resistance mutations in the VGSC

Initial assessment of the presence of the kdr mutations in the VGSC of 32 field females revealed a high frequency of the 1014F mutation (0.84) and a very low frequency of the 1575Y mutation (0.1). No 1014S mutation was detected in all the females screened. For the 1014F kdr mutations, 48.4% of the individuals were homozygote resistant with the allele (RR) whereas 38.7% were heterozygote resistant (RS) (Fig 4a). Only 12.9% of the population harbour the wild type susceptible allele (SS). On the other hand, the 1575Y detected in low frequencies of ~10% was found only at heterozygote resistant (RS) state. The association between the 1014F and 1575Y mutations was such that 66% of 1575Y alleles were detected on heterozygote 1014F individuals (RS) while the 33% of the 1575Y alleles were detected on the 1014F homozygote resistant individuals (RR) (Fig 4b). This means 1575Y distribution might not be random but linked to RS 1014F. The 1575Y alleles were not detected on L1014 susceptible individuals.

thumbnail
Fig 4. Determination of molecular basis of pyrethroid resistance in the An. coluzzii population.

a. The genotype frequency distributions of the 1014F kdr mutation (T/T: homozygote resistant, T/A: heterozygote resistant and A/A: homozygote susceptible); b. Association between the 1575Y and the 1014F kdr mutations; c. maximum likelihood phylogenetic tree of fragment of VGSC from deltamethrin-alive (AL) and dead (DE) F0 female An. coluzzii from Port-Harcourt (PH). Inset: polymorphism analysis of a fragment of VGSC from deltamethrin-alive and dead F0 females showing only two haplotypes with variable positions.

https://doi.org/10.1371/journal.pone.0247944.g004

To determine the genetic diversity of the VGSC a fragment encompassing the 1014 codon was amplified from 13 deltamethrin-resistant and 9 dead females. Analysis of a 548 bp fragment of VGSC revealed only two distinct haplotypes (Table 1, Fig 4c, S1 File), with low haplotype diversity of 0.33.

thumbnail
Table 1. Summary statistics of VGSC fragments in deltamethrin-alive and -dead An. coluzzii females.

https://doi.org/10.1371/journal.pone.0247944.t001

77% (10/13) of the deltamethrin-alive individuals were homozygote resistant while only 15% were homozygote susceptible in the same group. In contrast, only 55% of the deltamethrin-susceptible individuals were homozygote resistant and the remaining 45% were heterozygote resistant. No correlation was observed between deltamethrin resistance and the presence of the 1014F mutations, for example, RR+RS vs SS (Odds ratio = 0.61 (0.05–7.8, p = 0.70).

Haplotype 1 appeared to be the largest with ~80% of the sequences (35/44), whereas the haplotype 2 has the remaining 20%. Tajima’s D test of neutrality between the resistant and susceptible mosquitoes had a positive value but not significantly different. Moreover, both the deltamethrin-resistant and susceptible individuals appeared to have 3 polymorphic sites.

Discussion

In this study resistance profile and the possible molecular mechanism behind it was assessed in the major malaria vector An. coluzzii from Niger-Delta of Nigeria, where malaria is stable/perennial [33]. Niger-Delta is the most polluted region in Nigeria due to crude oil related activities, such as gas flaring, illegal refineries, pipeline vandals and operational accidents leading to the release of pollutants into the environments in the forms of spillages [54]. These pollutants get washed into waters and the atmospheric spaces of the cities and villages within the region posing as additional selection pressure for insecticide resistance to disease vectors. The most recalcitrant oil related pollutants are the polycyclic aromatic hydrocarbons [55] which are also potent ligands for the aryl hydrocarbon receptor (AhR) involved in the transcriptional regulation of xenobiotic metabolizing enzymes in insects [5658] and higher organisms [59]. The combinations of year-round breeding sites [33] and resistant vectors will be a good cocktail for malaria transmission. The An. coluzzii population from Port-Harcourt was found to be highly resistant to the pyrethroids and DDT with a very low mortalities for permethrin. In a previous study, resistance of > 25% mortality was reported in deltamethrin and DDT [60]. In the present work, mortalities of < 10% was seen with DDT and permethrin. In the south-eastern states of Nigeria which share some geographical features with the Niger-Delta, resistance to deltamethrin (57%) and DDT (13%) was recently reported [14]. While the above two studies [60] and [14] and our study reported full susceptibility to this bendiocarb observations made in An. coluzzii populations in the northern part of Nigeria suggest moderate resistance to this carbamate [15,16]. Moderate resistance to bendiocarb, may be attributed to the additional selection pressure from the use of carbamates in IRS and pesticides in agricultural fields [16,25]. In the neighbouring countries of Niger and Cameroun, despite not sharing the same geographical attributes with the Niger-Delta, An. coluzzii populations were also reported to be susceptible to malathion and bendiocarb [61,62].

The recovery of susceptibility following synergist bioassays suggests partial contribution of P450-mediated metabolic resistance in this population. The findings of GSTe2, a gene linked to DDT/pyrethroid resistance [43,44] overexpressed in the field population probably explained the alternative mechanism conferring pyrethroid resistance besides kdr mutation. The mortalities observed following pre-exposure to PBO was seven folds higher than the mortality recorded in the conventional bioassay. This shows a significant association between the PBO exposure and the increased in mortality even though the recovered susceptibility is ~50%. This is a trend that has been reported in recent studies [61,62] suggesting the potential of other detoxification mechanisms to the insecticides and/or other mechanisms including cuticular resistance on top of kdr resistance.

Transcriptional analysis of the candidate genes previously implicated in resistance to pyrethroids and DDT demonstrated overexpression of the genes pointing to potential roles of the metabolic resistance mechanisms. For example, recombinant protein of the CYP6P3 (consistently established as overexpressed in field populations of An. gambiae s.l) was demonstrated to metabolize permethrin and deltamethrin in field resistant population [42,63,64]. Using transcriptional analysis this gene has previously been reported in pyrethroid resistant populations of An. gambiae in southwest Nigeria and Benin as overexpressed [24]. CYP6Z2 linked to the pyrethroid resistance locus of An. gambiae, was reported to be involved in the metabolism of varying substrates including butein, resveratrol and entrodiol but not permethrin and cypermethrin [41]. However, CYP6Z2 was found to metabolize the juvenile hormone analogue, pyriproxyfen in An. gambiae [65]. Though, pyriproxyfen was not tested on this population of An. coluzzii it is likely that the Niger-Delta population is resistant to pyriproxyfen which could reduce the efficacy of new LLINs incorporating this chemical. Overexpression of GSTe2 has been linked with resistance to pyrethroid and DDT [43]. Not only in An. gambiae s.l. this gene is shown to be one of the major cross-resistance gene conferring resistance across diverse populations of An. funestus populations across Africa [44,66]. The rapid increase in resistance to pyrethroid in recent years has been attributed to the overexpression of multiple candidate genes in West Africa including the CYP6Z3 [40] and the highly expressed CYP6M3 reported in pyrethroid resistant populations of An. gambiae various parts of West Africa [39,67] as well as in An. funestus [68,69].

The 1014F kdr mutation was recorded at a high frequency of ~84% in the Niger-Delta population. Comparable frequency of ~ 82% have been reported in the northern part of Nigeria [15,16]. The highest frequency of 1014F kdr (88%) in Nigeria was reported in Niger state, north-central geopolitical zone [12]. Moreover, in the south eastern region, a frequency that ranges from 60% to 90% was detected [14]. In the neighbouring country of Niger, frequency ~82% was reported in the An. coluzzii [62]. However, a lower frequency of 60% was reported in Chad [62] and ~ 65% in Cameroon [61]. Looking at the frequencies of 1014F kdr mutations in parts of Nigeria and the neighbouring countries, it could be said that the mutation is approaching fixation; probably this explains the emergence of the 1575Y mutation in the populations to ameliorate the deleterious effects of the 1014F [49,70]. From the genotype data generated on this population, all the individuals detected were heterozygote with the 1575Y allele. It is interesting to mention here that all the alleles were detected on either heterozygote (RS) (66%) or homozygote resistant (RR) 1014F (33%). 1575Y alleles were not detected on any L1014 susceptible individuals, confirming the earlier projections that it always coexists with 1014F alleles thereby conferring additional advantages to the individuals. It was reported in the work of Jones and his associates, the1575Y kdr mutation, located in the exon 30 of the paratype VGSC coexists on the 1014F haplotypes, even though it was found to have an additive benefit, it is also alleged to compensate for the fitness cost lost due to 1014F in the field [49]. To the best of our knowledge this is the first study to document presence of this mutation in populations from Nigeria, though it has been documented in other parts of West Africa [49,7173].

Analysis of the 548 bp fragment of the VGSC shows the VGSC is under selection pressure as a result of which it lead to the selection of only two distinct haplotypes within the population [74,75]. Low haplotype diversity (0.33) was observed between the deltamethrin-resistant and susceptible individuals and Tajma’s D* statistics also showed there was no significant difference between them.

Conclusion

Anopheles coluzzii was the only species of Anopheles found in the various larval sampling sites in Port Harcourt. The population is highly resistant to pyrethroids and DDT, and fully susceptible to bendiocarb and malathion. Evidence of a role of metabolic resistance was shown possibly mediated by P450 monooxygenases and/or GSTs. High frequency of 1014F kdr mutation was seen and for the first time in a population of this major malaria vector from Nigeria presence of 1575Y kdr mutation established. Altogether, the findings of high pyrethroid resistance and the partial recovery with PBO suggest that pyrethroid-only LLINs may only have a reduced efficacy against these mosquitoes and that PBO-based nets should be considered. However, the failure to recover 100% mortality from PBO-synergist assay suggests that other insecticide classes should be considered in Port Harcourt including bendiocarb and malathion which could be used for indoor residual spraying.

Supporting information

S1 Fig. Agarose gel micrograph showing the 479 bp band pattern characteristic of An. coluzzii from SINE200 PCR.

Lane 1 = hyperladder IV (Bioline), 1013 bp. Lane 2–20 showing 479 bp with lane 4 and 16 showing no band.

https://doi.org/10.1371/journal.pone.0247944.s001

(TIF)

S1 File. Partial fragments of the voltage-gated sodium channel from deltamethrin-alive and dead An. coluzzii females.

List of primers used for the qPCR and their respective sequences.

https://doi.org/10.1371/journal.pone.0247944.s002

(DOCX)

Acknowledgments

The authors would like to acknowledge the contribution of Mr Michael Lemenebari and Hyacinth for their assistance during mosquito larvae collections.

References

  1. 1. WHO. World Malaria Report 2019. Geneva. [Internet]. 2019. 1–232 p. https://www.who.int/publications-detail/world-malaria-report-2019
  2. 2. Musiime AK, Smith DL, Kilama M, Rek J, Arinaitwe E, Nankabirwa JI, et al. Impact of vector control interventions on malaria transmission intensity, outdoor vector biting rates and Anopheles mosquito species composition in Tororo, Uganda. Malar J [Internet]. 2019;18(1):1–9. pmid:30602373
  3. 3. Gari T, Lindtjørn B. Reshaping the vector control strategy for malaria elimination in Ethiopia in the context of current evidence and new tools: Opportunities and challenges. Malar J [Internet]. 2018;17(1):1–8. pmid:29291736
  4. 4. Bhatt S, Weiss DJ, Cameron E, Bisanzio D, Mappin B, Dalrymple U, et al. The effect of malaria control on Plasmodium falciparum in Africa between 2000 and 2015. Nature. 2015;526:207–2011. pmid:26375008
  5. 5. WHO. World malaria report 2016. 2016.
  6. 6. Ranson H, Lissenden N. Insecticide Resistance in African Anopheles Mosquitoes: A Worsening Situation that Needs Urgent Action to Maintain Malaria Control. Trends Parasitol [Internet]. 2016;32(3):187–96. pmid:26826784
  7. 7. WHO. Global plan for insecticide resistance management in malaria vectors. WHO Glob Malar Program. 2012;
  8. 8. Mnzava AP, Knox TB, Temu EA, Trett A, Fornadel C, Hemingway J, et al. Implementation of the global plan for insecticide resistance management in malaria vectors: progress, challenges and the way forward. Malar J [Internet]. 2015;14(173):1–9. pmid:25899397
  9. 9. Okorie PN, Mckenzie FE, Ademowo OG, Bockarie M, Kelly L. Nigeria Anopheles Vector Database: An Overview of 100 Years ‘ Research. PLoS One. 2011;6(12):6–7.
  10. 10. Akpan GE, Adepoju KA, Oladosu OR, Adelabu SA. Dominant malaria vector species in Nigeria: Modelling potential distribution of Anopheles gambiae sensu lato and its siblings with MaxEnt. PLoS One. 2018;13(10):1–15. pmid:30281634
  11. 11. Ibrahim SS, Mukhtar MM, Riveron JM, Fadel AN, Tchapga W, Hearn J, et al. Exploring the Mechanisms of Multiple Insecticide Resistance in a Highly Plasmodium -Infected Malaria Vector Anopheles funestus Sensu Stricto from Sahel of. Genes (Basel). 2020;11(454):1–15.
  12. 12. Samson T, Id A, Adeogun A, Olakiigbe AK, Oyeniyi T, Olukosi YA, et al. Pyrethroids resistance intensity and resistance mechanisms in Anopheles gambiae from malaria vector surveillance sites in Nigeria. PLoS One. 2018;12:1–13.
  13. 13. Fagbohun IK, Oyeniyi TA, Idowu TE, Otubanjo OA, Awolola ST. Cytochrome P450 Mono-Oxygenase and Resistance Phenotype in DDT and Deltamethrin-Resistant Anopheles gambiae (Diptera: Culicidae) and Culex quinquefasciatus in Kosofe, Lagos, Nigeria. Vector Control Pest Manag Resist Repellents. 2019;56(February):817–21.
  14. 14. Chukwuekezie O, Nwosu E, Nwangwu U, Dogunro F, Onwude C, Agashi N, et al. Resistance status of Anopheles gambiae (s. l.) to four commonly used insecticides for malaria vector control in South ‑ East Nigeria. Parasit Vectors [Internet]. 2020;13(152):1–10. Available from: https://doi.org/10.1186/s13071-020-04027-z
  15. 15. Ibrahim SS, Muhammad MM, Datti JA, Irving H, Kusimo MO, Tchapga W, et al. Temporal escalation of Pyrethroid Resistance in the major malaria vector Anopheles coluzzii from Sahelo-Sudanian Region of northern Nigeria. Sci Rep. 2019;9(7395):1–11. pmid:31089196
  16. 16. Ibrahim SS, Manu YA, Tukur Z, Irving H, Wondji CS. High frequency of kdr L1014F is associated with pyrethroid resistance in Anopheles coluzzii in Sudan savannah of northern Nigeria. BMC Infect Dis. 2014;14(1):1–9. pmid:25127882
  17. 17. Self LS, Pan CP, Leader P, Insecticide WHO, Unit T. Insecticide Susceptibility and Resistance in Populations of Anopheles gambiae, Culex fatigans and Aedes aegypti in Southern Nigeria. Bull World Heal Organ. 1966;34(6):960–2. pmid:4380414
  18. 18. Ramakrishna V, Elliott R. Insecticide resistance in Anopheles gambiae in Sokoto Province. Trans R Soc Trop Med Hyg [Internet]. 1959 Jan 1;53(1):102–9. pmid:13635819
  19. 19. NMCP, SUMAP, WHO, INFORM. A description of the epidemiology of malaria to guide the planning of control in Nigeria. A report prepared for the Federal Ministry of Health, Nigeria, the Roll Back Malaria Partnership and Department for International Development, UK. November, 2013. 2013.
  20. 20. Okwa O, Akinmolayan FI, Carter V, Hurd H. Transmission Dynamics of Malaria In four Selected Zones of Nigeria In the Rainy Season. Ann Afr Med. 2009;8(1):1–9. pmid:19762999
  21. 21. Bruce-Chwatt LJ. MALARIA IN NIGERIA. Bull World Heal Organ. 1951;4:301–27. pmid:14886718
  22. 22. Awolola TS, Oduola OA, Strode C, Koekemoer LL, Brooke B, Ranson H. Evidence of multiple pyrethroid resistance mechanisms in the malaria vector Anopheles gambiae sensu stricto from Nigeria. Trans R Soc Trop Med Hyg. 2009;103:1139–45. pmid:18829056
  23. 23. Djouaka RJ, Atoyebi SM, Tchigossou GM, Riveron JM, Irving H, Akoton R, et al. Evidence of a multiple insecticide resistance in the malaria vector Anopheles funestus in South West Nigeria. Malar J. 2016;15(1):1–10. pmid:27876039
  24. 24. Djouaka RF, Bakare AA, Coulibaly ON, Akogbeto MC, Ranson H, Hemingway J, et al. Expression of the cytochrome P450s, CYP6P3 and CYP6M2 are significantly elevated in multiple pyrethroid resistant populations of Anopheles gambiae s.s. from Southern Benin and Nigeria. BMC Genomics. 2008;9:1–11. pmid:18171476
  25. 25. Olatunbosun-oduola A, Abba E, Adelaja O, Taiwo-ande A. Widespread Report of Multiple Insecticide Resistance in Anopheles gambiae s. l. Mosquitoes in Eight Communities in Southern Gombe, North-Eastern Nigeria. J Arthropod Borne Dis. 2019;13(March):50–61. pmid:31346535
  26. 26. Oringanje C, Alaribe AAA, Oduola AO, Oduwole OA, Adeogun AO. Vector abundance and species composition of Anopheles mosquito in Calabar, Nigeria. Int J Anti-malaria Res. 2013;1(1):35–7.
  27. 27. Atting IA, Ekpo ND, Akpan ME, Bassey BE, Asuquo MJ. Insecticide Susceptibility Profile of Malaria Vector Populations from the Coastal and Mainland Areas of Akwa Ibom State, Nigeria. J Adv Med Med Res. 2019;29(7):1–11.
  28. 28. Awolola ST, Adeogun AO, Olojede JB, Oduola AO, Oyewole IO, Amajoh CN. Impact of PermaNet 3.0 on entomological indices in an area of pyrethroid resistant Anopheles gambiae in south-western Nigeria. Parasites and Vectors. 2014;7(1):1–10.
  29. 29. Martinez-Torres D, Chandre F, Williamson MS, Darriet F, Bergé JB, Devonshire AL, et al. Molecular characterization of pyrethroid knockdown resistance (kdr) in the major malaria vector Anopheles gambiae s.s. Insect Mol Biol. 1998;7(2):179–84. pmid:9535162
  30. 30. Ranson H, Jensen B, Vulule JM, Wang X, Hemingway J, Collins FH. Identification of a point mutation in the voltage-gated sodium channel gene of Kenyan Anopheles gambiae associated with resistance to DDT and pyrethroids. Insect Mol Biol. 2000;9(5):491–7. pmid:11029667
  31. 31. Okorie PN, Ademowo OG, Irving H, Kelly-Hope LA, Wondji CS. Insecticide susceptibility of Anopheles coluzzii and Anopheles gambiae mosquitoes in Ibadan, Southwest Nigeria. Med Vet Entomol. 2015;29(1):44–50. pmid:25417803
  32. 32. Izeogu CV, Salau AT. Port Harcourt. Cities [Internet]. 1985;2(1):14–23. Available from: http://www.sciencedirect.com/science/article/pii/0264275185900587
  33. 33. Onyiri N. Estimating malaria burden in Nigeria: a geostatistical modelling approach. Geospat Health. 2015;10(306):163–70. pmid:26618305
  34. 34. Gilles M and Coetzee M. A supplement to anophelinae of Africa south of Sahara (Afro-tropical region). In Soth Africa; 1987. p. 55:1–143.
  35. 35. Livak KJ. Organization and mapping of a sequence on the Drosophila melanogaster X and Y chromosomes that is transcribed during spermatogenesis. Genetics. 1984;107(4):611–34. pmid:6430749
  36. 36. Santolamazza F, Mancini E, Simard F, Qi Y, Tu Z, Della Torre A. Insertion polymorphisms of SINE200 retrotransposons within speciation islands of Anopheles gambiae molecular forms. Malar J. 2008;7:1–10. pmid:18173836
  37. 37. WHO. Test procedures for insecticide resistance monitoring in malaria vector mosquitoes Second edition. 2016. 1–48 p.
  38. 38. Feyereisen R. Insect P450 inhibitors and insecticides: challenges and opportunities. Pest Manag Sci. 2015;71(793). pmid:25404103
  39. 39. Kwiatkowska RM, Platt N, Poupardin R, Irving H, Dabire RK, Mitchell S, et al. Dissecting the mechanisms responsible for the multiple insecticide resistance phenotype in Anopheles gambiae s. s., M form, from Vallée du Kou, Burkina Faso. Gene [Internet]. 2013;519(1):98–106. Available from: http://dx.doi.org/10.1016/j.gene.2013.01.036 pmid:23380570
  40. 40. Toé KH, Falé SN, Dabiré RK, Ranson H, Jones CM. The recent escalation in strength of pyrethroid resistance in Anopheles coluzzi in West Africa is linked to increased expression of multiple gene families. BMC Genomics. 2015;16(146):1–11. pmid:25766412
  41. 41. McLaughlin LA, Niazi U, Bibby J, David JP, Vontas J, Hemingway J, et al. Characterization of inhibitors and substrates of Anopheles gambiae CYP6Z2. Insect Mol Biol. 2008;17(2):125–35. pmid:18353102
  42. 42. Muller P, Warr E, Stevenson BJ, Pignatelli PM, Morgan JC, Yawson AE, et al. Field-Caught Permethrin-Resistant Anopheles gambiae Overexpress CYP6P3, a P450 That Metabolises Pyrethroids. PLoS Genet. 2008;4(11). pmid:19043575
  43. 43. Mitchell SN, Rigden DJ, Dowd AJ, Lu F, Wilding CS, Weetman D, et al. Metabolic and Target-Site Mechanisms Combine to Confer Strong DDT Resistance in Anopheles gambiae. PLoS One. 2014;9(3). pmid:24675797
  44. 44. Riveron JM, Yunta C, Ibrahim SS, Djouaka R, Irving H, Menze BD, et al. A single mutation in the GSTe2 gene allows tracking of metabolically based insecticide resistance in a major malaria vector. Genome Biol. 2014;15(2):1–20.
  45. 45. Dimopoulos G, Richman A, Della Torre A, Kafatos FC, Louis C. Identification and characterization of differentially expressed cDNAs of the vector mosquito, Anopheles gambiae. Proc Natl Acad Sci U S A. 1996;93(23):13066–71. pmid:8917545
  46. 46. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative CT method. Nat Protoc [Internet]. 2008;3(6):1101–8. pmid:18546601
  47. 47. Bass C, Nikou D, Vontas J, Donnelly MJ, Williamson MS, Field LM. The Vector Population Monitoring Tool (VPMT): High-Throughput DNA-Based Diagnostics for the Monitoring of Mosquito Vector Populations. Malar Researh Treat. 2010;2010. pmid:22347668
  48. 48. Bass C, Nikou D, Donnelly MJ, Williamson MS, Ranson H, Ball A, et al. Detection of knockdown resistance (kdr) mutations in Anopheles gambiae: A comparison of two new high-throughput assays with existing methods. Malar J. 2007;6:1–14. pmid:17204149
  49. 49. Jones CM, Liyanapathirana M, Agossa FR, Weetman D, Ranson H, Donnelly MJ, et al. Footprints of positive selection associated with a mutation (N1575Y) in the voltage-gated sodium channel of Anopheles gambiae. Proc Natl Acad Sci U S A. 2012;109(17):6614–9. pmid:22493253
  50. 50. Pinto J, Lynd A, Vicente JL, Santolamazza F, Randle NP, Gentile G, et al. Multiple origins of knockdown resistance mutations in the afrotropical mosquito vector Anopheles gambiae. PLoS One. 2007;2(11). pmid:18043750
  51. 51. Hall T. “BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT.” Nucl. Acids. Symp. Ser. 1999. p. 41:95–98.
  52. 52. Librado P, Rozas J. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinforma Appl Note. 2009;25(11):1451–2. pmid:19346325
  53. 53. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol. 2013 Dec;30(12):2725–9. pmid:24132122
  54. 54. Olusegun A, Makun HA, Ogara IM, Edema M, Idahor KO, Oluwabamiwo BF, et al. Air Pollution in the Niger Delta Area: Scope, Challenges and Remedies. Intech [Internet]. 2012;i(tourism):38. http://dx.doi.org/10.1039/C7RA00172J https://www.intechopen.com/books/advanced-biometric-technologies/liveness-detection-in-biometrics http://dx.doi.org/10.1016/j.colsurfa.2011.12.014
  55. 55. Yakubu O. Particle (Soot) Pollution in Port Harcourt Rivers State, Nigeria—Double Air Pollution Burden? Understanding and Tackling Potential Environmental Public Health Impacts. Environments [Internet]. 2017;5(1):2. Available from: http://www.mdpi.com/2076-3298/5/1/2
  56. 56. Mohammed B, S MK, O MN, J OC, A RIS, F RD. Understanding the Mechanisms Involved in the Regulation of Cytochrome P450 Gene Expression in Drosophila melanogaster (Diptera: Drosophilidae). Entomol Ornithol Herpetol Curr Res. 2016;06(01):1–6.
  57. 57. Misra JR, Horner MA, Lam G, Thummel CS. Transcriptional regulation of xenobiotic detoxification in Drosophila. Genes Dev. 2011;25(17):1796–806. pmid:21896655
  58. 58. Pan Y, Peng T, Xu P, Zeng X, Tian F, Song J, et al. Transcription factors AhR/ARNT regulate the expression of CYP6CY3 and CYP6CY4 switch conferring nicotine adaptation. Int J Mol Sci. 2019;20(18). pmid:31547315
  59. 59. Clark BW, Di Giulio RT. Fundulus heteroclitus adapted to PAHs are cross-resistant to multiple insecticides. Ecotoxicology [Internet]. 2012 Mar 30;21(2):465–74. pmid:22037695
  60. 60. Ebere N, Atting I, Ekerette I, Nioking A. Assessment of Level of Susceptibility of Anopheles gambiae S.L to Public Health Insecticides in a Malaria Vector Sentinel Site, Rivers State, Nigeria. Annu Res Rev Biol. 2019;32(1):1–10.
  61. 61. Fadel AN, Ibrahim SS, Tchouakui M, Terence E, Wondji MJ, Tchoupo M, et al. A combination of metabolic resistance and high frequency of the 1014F kdr mutation is driving pyrethroid resistance in Anopheles coluzzii population from Guinea savanna of Cameroon. Parasites and Vectors [Internet]. 2019;12(1):1–13. pmid:30606222
  62. 62. Ibrahim SS, Fadel AN, Tchouakui M, Terence E, Wondji MJ, Tchoupo M, et al. High insecticide resistance in the major malaria vector Anopheles coluzzii in Chad Republic. Infect Dis Poverty. 2019;8(1):1–12. pmid:30626428
  63. 63. Edi CV., Djogbénou L, Jenkins AM, Regna K, Muskavitch MAT, Poupardin R, et al. CYP6 P450 Enzymes and ACE-1 Duplication Produce Extreme and Multiple Insecticide Resistance in the Malaria Mosquito Anopheles gambiae. PLoS Genet. 2014;10(3). pmid:24651294
  64. 64. Stevenson BJ, Bibby J, Pignatelli P, Muangnoicharoen S, O’Neill PM, Lian LY, et al. Cytochrome P450 6M2 from the malaria vector Anopheles gambiae metabolizes pyrethroids: Sequential metabolism of deltamethrin revealed. Insect Biochem Mol Biol [Internet]. 2011;41(7):492–502. Available from: http://dx.doi.org/10.1016/j.ibmb.2011.02.003 pmid:21324359
  65. 65. Yunta C, Grisales N, Nász S, Hemmings K, Pignatelli P, Voice M, et al. Pyriproxyfen is metabolized by P450s associated with pyrethroid resistance in An. gambiae. Insect Biochem Mol Biol. 2016;78:50–7. pmid:27613592
  66. 66. Tchouakui M, Chiang MC, Ndo C, Kuicheu CK, Amvongo-Adjia N, Wondji MJ, et al. A marker of glutathione S-transferase-mediated resistance to insecticides is associated with higher Plasmodium infection in the African malaria vector Anopheles funestus. Sci Rep. 2019;9(1):1–12. pmid:30626917
  67. 67. Antonio-Nkondjio C, Poupardin R, Tene BF, Kopya E, Costantini C, Awono-Ambene P, et al. Investigation of mechanisms of bendiocarb resistance in Anopheles gambiae populations from the city of Yaoundé, Cameroon. Malar J. 2016;15(1):1–11. pmid:27549778
  68. 68. Irving H, Riveron JM, Ibrahim SS, Lobo NF, Wondji CS. Positional cloning of rp2 QTL associates the P450 genes CYP6Z1, CYP6Z3 and CYP6M7 with pyrethroid resistance in the malaria vector Anopheles funestus. Heredity (Edinb) [Internet]. 2012;109(6):383–92. pmid:22948188
  69. 69. Riveron JM, Ibrahim SS, Chanda E, Mzilahowa T, Cuamba N, Irving H, et al. The highly polymorphic CYP6M7 cytochrome P450 gene partners with the directionally selected CYP6P9a and CYP6P9b genes to expand the pyrethroid resistance front in the malaria vector Anopheles funestus in Africa. BMC Genomics. 2014;15(1):1–19. pmid:25261072
  70. 70. Wang L, Nomura Y, Du Y, Liu N, Zhorov BS, Dong K. A mutation in the intracellular loop III/IV of mosquito sodium channel synergizes the effect of mutations in helix IIS6 on pyrethroid resistance. Mol Pharmacol. 2015;87(3):421–9. pmid:25523031
  71. 71. Opondo KO, Weetman D, Jawara M, Diatta M, Fofana A, Crombe F, et al. Does insecticide resistance contribute to heterogeneities in malaria transmission in the Gambia? Malar J. 2016;15(1). pmid:26980461
  72. 72. Toe KH, Müller P, Badolo A, Traore A, Sagnon N, Dabiré RK, et al. Do bednets including piperonyl butoxide offer additional protection against populations of Anopheles gambiae s.l. that are highly resistant to pyrethroids? An experimental hut evaluation in Burkina Fasov. Med Vet Entomol. 2018;32(4):407–16. pmid:29998497
  73. 73. Edi AVC, N’Dri BP, Chouaibou M, Kouadio FB, Pignatelli P, Raso G, et al. First detection of N1575Y mutation in pyrethroid resistant Anopheles gambiae in Southern Côte d’Ivoire. Wellcome Open Res. 2017;2(0):1–10. pmid:29018842
  74. 74. Silva Martins WF, Wilding CS, Steen K, Mawejje H, Antão TR, Donnelly MJ. Local selection in the presence of high levels of gene flow: Evidence of heterogeneous insecticide selection pressure across Ugandan Culex quinquefasciatus populations. PLoS Negl Trop Dis. 2017;11(10):1–22. pmid:28972985
  75. 75. Irving H, Wondji CS. Investigating knockdown resistance (kdr) mechanism against pyrethroids/DDT in the malaria vector Anopheles funestus across Africa. BMC Genet. 2017;18(1):1–11. pmid:28056775