Animals

Eight to twelve weeks old male C57BL/6N mice (Charles River Laboratories, Wilmington, Massachusetts, USA) and Ano2^-/- mice [8] (kindly provided by Dr. Thomas Jentsch, FMP, Berlin, Germany) were used for all the experiments. Mice were kept in the Interfaculty Biomedical Facility (IBF) of the Heidelberg University (Germany) under SPF conditions. Mice were anesthetized by isoflurane inhalation (Baxter, Deerfield, Illinois, USA) and then put to death with an overdose isoflurane. Animal housing and all experimental procedures were carried out in compliance with the guidelines for the welfare of experimental animals as stipulated by the Federal Republic of Germany. Animal experiments were approved by the Regierungspraesidium Karlsruhe, Germany (approval numbers T-04/18, T-05/18).

Quantitative real-time PCR (qPCR)

Immediately after sacrificing the animals, tissue samples were collected and flash-frozen in liquid nitrogen. Total RNA was extracted using either the MagJET RNA Kit (Thermo Fisher Scientific, Waltham, Massachusetts, USA) or the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. cDNA was synthetized with 50 ng of each RNA preparation using the SuperScript™ VILO™ Master Mix (Thermo Fisher Scientific) according to the manufacturer’s instructions. Quantitative real-time PCR (qPCR) was performed with StepOne Real Time PCR System (Applied Biosystems, Foster City, California, USA) using the Fast Start Universal SYBR Green Master (ROX) (Roche, Basel, Switzerland). In every run, a negative control and duplicates for each primer pair were used. A melting-curve analysis was included in every qPCR run. YWHAZ and Gusb were chosen as housekeeping genes, as they are supposed to be most consistently expressed across different regions of the mouse brain [13].

The CT-values, obtained from the StepOne Real Time PCR System, were analyzed using the relative quantification method [14] which is implemented in the REST 2009 software (Qiagen). Data obtained from inferior olivary tissue samples were chosen as reference sample. Primer efficiencies were calculated using the Miner-Algorithm [15]. Since the resulting fold-expression values are not normally distributed, the 68% confidence was calculated in REST 2009 using a randomization approach and was used as a measure of variation of the samples.

Primer pairs used were (5’-> 3’): ano2/f TTTATGATTGCCCTGACGTTCTC, ano2/r GAGGTTGATGATGACTGCTGTT, ywhaz/f TAGGTCATCGTGGAGGGTCG, ywhaz/r GAAGCATTGGGGATCAAGAACTT, gusb/f CCGACCTCTCGAACAACCG, gusb/r GCTTCCCGTTCATACCACACC.

In situ hybridization (ISH)

cDNA was synthesized from extracted RNA from olfactory epithelium or cerebellum using the SuperScript™ VILO™ Master Mix (Thermo Fisher Scientific). cDNA fragments were amplified through PCR using two sets of primers (ano2_1: primer pair used for qPCR (see above), ano2_2/f ACAACGGGACACTACATGGC, ano2_2/r TCGCTGATGTCAGTGGGGAT). The PCR products were purified using the PCR Cleanup Kit (Macherey-Nagel, Düren, Germany) and ligated in a pGEM-T Vector (Promega, Madison, Wisconsin, USA). Once ligated, plasmids were transformed through heat-shock into JM109 High-Efficiency E. Coli Competent Cells (Promega). Positive recombinants were incubated in LB-Medium and the samples were sequenced in Microsynth SeqLab (Göttingen, Germany) after minipreparation. After confirming the proper ligation of the insert and match with Ano2 mRNA through BLAST, the plasmids were linearized using the enzymes NcoI or NdeI (Thermo Scientific). The linearized vectors were finally incubated for 2 h at 37°C with the RNA-Polymerases SP6 or T7 using the DIG-RNA-Labeling Mix (Roche) to synthesize the sense (control) and the antisense hybridization probes, respectively.

C57BL/6N mice were transcardially perfused with 4% paraformaldehyde (PFA). After perfusion, heads were fixed for 2 h in 4% PFA and then washed with PBS (150 mM NaCl, 8.1 mM Na₂HPO₄ x 2H₂0, 1.9 mM NaH₂PO₄ x H₂0, pH adjusted to 7.4) for 5 min and submerged in 0.5 M EDTA for at least a week at 4°C for decalcification, until cranial bones softened. To dewater the tissue, heads were put in 10% sucrose solution (2–3 h, RT), 30% sucrose solution (overnight, 4°C) and in a 1:1 mixture of Tissue-Tek® O.C.T.™ Compound (2–3 h, RT) (Sakura Finetek, Tokyo, Japan) and 30% sucrose solution (2–3 h, RT), before being embedded in Tissue-Tek® O.C.T.™ Compound only. Sagittal and coronal sections (16 μm) were sliced with a cryostat (CM3050, Leica, Wetzlar, Germany), set at a chamber temperature of -22°C and an object temperature of -20°C. The sections were collected on SuperFrost Plus adhesion slides (Thermo Fisher Scientific) and were left to dry for no longer than 30 min and stored at -20°C.

As a pretreatment of the tissue, slices were fixed in 4% PFA for 10 min and then washed 2x 5 min in PBS. Afterwards, slices were digested with 50 μg/ml Proteinase K in PK-Buffer (50 mM TRIS/HCl and 5 mM EDTA adjusted to pH 8.3) for 5 min at 37°C and washed twice in PBS for 5 min. The samples were acetylated with 0.1 M triethanolamine solution containing 0.25% acetic acid (pH 8) for 10 min. After two washing steps with PBS, slices were incubated for 4–6 h in a prehybridization buffer (25% 5x SSC, 10% 1x Denhardt’s solution, 50% deionized formamide, 0.1% Tween-20, 500 μg/ml Herring Sperm DNA; for 20xSSC: 3 M NaCl, 0.3 M trisodium citrate, pH 7.0) before being incubated overnight with the hybridization buffer (25% 5x SSC, 10% 1x Denhardt’s solution, 50% deionized formamide, 0.1% Tween-20) containing 350–450 ng of the hybridization probe at 55°C. On the next day, the slices were washed with 5x SSC at 55°C, 0.2x SSC at 55°C and 0.2x SSC at RT for 30 min each. Slices were washed 5 min in PBS with 0.1% Triton X-100 and 0.5% BSA (PBT) and then blocked with a blocking solution containing 5% BSA in PBT for 1 h at RT. After blocking, the anti-Digoxigenin-AP antibodies (Roche, dilution 1:5000 in blocking solution) were added and incubated for 2 h at RT. Slices were washed 2x 30 min in PBT and incubated in NBT/BCIP coloration solution (Ready-to-use tablets, Roche) until a staining was visible for the antisense but not the sense hybridization probe (30 min to 4 h or overnight). Slices were washed with PBS to stop the reaction. The inferior olivary nucleus (coronal slices) or the inferior olivary nucleus and the hippocampus (sagittal slices) served as positive controls in each staining. Every staining procedure included stainings with the sense hybridization probe as negative control.

For the combined ISH/immunohistochemistry (IHC) staining (modified from [16]) samples were blocked in CT solution (20% ChemiBlocker (Merck, Darmstadt, Germany), 0.5% Triton X-100 in 1x PBS pH 7.4) for 2 h at RT after the SSC washing steps. The samples were then incubated overnight with anti-digoxigenin antibody (Roche, dilution 1:5000) and the primary antibody Calbindin D-28K (Swant Cat# CB-38a, RRID: AB_10000340, Lot# 9.03, Marly, Switzerland, polyclonal, raised in rabbit, dilution 1:1000; [17]) in CTA solution (20% Chemiblocker, 0.5% Triton X-100, 0.05%, NaN₃ in 1x PBS pH 7.4). On the next day, the slices were washed 3x 10 min with PBT and incubated with the secondary antibody goat anti-rabbit conjugated with Alexa Fluor 568 (Thermo Fisher Scientific Cat# A-11011, RRID:AB_143157, Lot# 1558746, dilution 1:1000) for at least 2 h in C solution (20% ChemiBlocker in 1x PBS pH 7.4). Additionally, the anti-Digoxigenin antibody was added to prevent losing signal. Samples were washed twice in PBT for 30 min and incubated in NBT/NCIP coloration solution. Slices were washed with PBS, 0.3 μM DAPI (Sigma-Aldrich Cat# 32670, St. Louis, Missouri, USA) was added to the samples for 10 min and washed again with PBS. Lastly, a coverslip was mounted with Aqua Poly/Mount (Polysciences, Warrington, Pennsylvania, USA). For each staining, a negative control using only the secondary antibody was performed.

Images of ISH stainings were taken with an Eclipse 90i microscope (Nikon, Minato, Japan) using the brightfield camera DS-Ri1 (Nikon) and IHC stainings were captured with the confocal laser scanning system D-Eclipse C1 (Nikon). Images were captured with the imaging software NIS-Elements AR 4.00.12 (RRID:SCR_014329, Nikon). The following objectives were used: 4x (Nikon Plan Fluor 4x/NA 0.13) and 60x (Nikon Plan Apo VC 60x/NA 1.40 Oil). Contrast and brightness of the images were adjusted with CorelPHOTO-PAINT 2017 (Corel Corporation, Ottawa, Canada).

Free-floating immunohistochemistry

The cerebellum was removed and fixed for 30 min in 4% paraformaldehyde (PFA) solution. The cerebellum was cut in ice-cold PBS into 200 μm-thick slices with a vibratome (VT1000S, Leica). The slices were fixed again for 30 min in 4% PFA solution. After washing for 4x 10 min with PBS, slices were incubated for 2 h in a blocking solution containing 5% goat serum (Sigma-Aldrich), 0.5% Triton X-100 and 0.05% NaN₃. Primary antibodies were applied overnight (diluted in blocking solution) and sections were washed again 4x 10 min in PBS with 0.5% Triton X-100 (PBST). Unless the primary antibody was directly coupled with a fluorescent tag, the slices were incubated for 2 h with the secondary antibodies (diluted in blocking solution), which were conjugated to a fluorescent tag. After washing 4x 10 min with PBST, slices were mounted on glass slides with Aqua-Poly/Mount (Polysciences). The slices were kept on a shaker at RT in the dark for the entire procedure.

Cerebellar Purkinje cells were visualized with an antibody against Calbindin D-28K [18] (Swant, dilution 1:1000) and molecular layer interneurons together with Purkinje cells were stained with Parvalbumin [18,19] (Synaptic Systems Cat# 195 006, RRID:AB_2619887, Göttingen, Germany, polyclonal, raised in chicken, dilution 1:250; [20]). GABAergic synapses were targeted with an antibody specific for the Vesicular GABA transporter [21] (VGAT, Synaptic Systems Cat# 131 005, RRID:AB_1106810, polyclonal, raised in guinea pig, dilution 1:500; [22]). To visualize climbing fiber synapses, antibodies against the Vesicular glutamate transporter 2 (VGluT2, Millipore Cat# MAB5504A4, RRID:AB_11210701, Lot# 2914310, Burlington, Massachusetts, USA, monoclonal, raised in mouse, dilution 1:250; [23]), which is, in the molecular layer, specifically expressed in synapses of climbing fibers [24]. This antibody was directly coupled to Alexa Fluor 488, so no secondary antibody was needed for the detection of fluorescent signals. The secondary antibodies used were goat anti-rabbit conjugated with Alexa Fluor 405 (Thermo Fisher Scientific Cat# A-31556, RRID:AB_221605, dilution 1:500), goat anti-rabbit conjugated with Alexa Fluor 488 (Molecular Probes, Eugene, Oregon, USA, Cat# A-11008, RRID:AB_143165, Lot# 1515529, dilution 1:2000), goat anti-rabbit conjugated with Alexa Fluor 568 (Molecular Probes, Cat# A-11011, RRID:AB_143157, Lot# 1558746, dilution 1:2000), goat anti-chicken conjugated with Alexa Fluor 568 (Abcam, Cambridge, UK, Cat# ab175711, RRID:AB_2827757, dilution 1:1000) and goat anti-guinea pig conjugated with Alexa Fluor 568 (Molecular Probes Cat# A-11075, RRID:AB_141954, dilution 1:1000). Unless the secondary antibody with Alexa Fluor 405 was used, 0.3 μM DAPI was added to the secondary antibody dilution to visualize cell nuclei. A negative control using only the secondary antibody was performed for each staining, except for the tagged VGluT2 antibody.

Images of IHC stainings were taken with an Eclipse 90i microscope (Nikon) using the confocal laser scanning system D-Eclipse C1 (Nikon). Images were captured with the imaging software NIS-Elements AR 4.00.12 (Nikon) using a 40x (Nikon Plan Fluor 40x/NA 1.30 Oil) and a 60x (Nikon Plan Apo VC 60x/NA 1.40 Oil) objective. For analysis of Purkinje cell morphology, density of Purkinje cells and molecular layer interneurons, z-stacks (range 4–9 μm) were taken with a 40x objective and the maximum intensity projections were analyzed with ImageJ (RRID:SCR_003070, NIH, Bethesda, Maryland, USA). Interneurons were identified by subtracting the calbindin signal from the parvalbumin signal [25]. Because the cell bodies of Purkinje cells are aligned in a row, density of Purkinje cells was defined as cell bodies per mm. On the other hand, density of molecular layer interneurons was defined as cells per volume of the molecular layer, since they are scattered throughout the molecular layer. For counting climbing fiber and GABAergic synapses, images were pre-processed with iLastik (RRID:SCR_015246, HCI, Heidelberg, Germany) and then further analyzed with ImageJ. Images were taken at 60x magnification and a zoom factor ranging from 1.0 to 2.0. As climbing fiber synapses are located primarily on the main dendrites, only synapses in the proximal half of the molecular layer were counted. To analyze the distribution of climbing fiber synapses, distances between adjacent synapses on or next to the same dendrite were measured. Data are presented as curves describing the shape of the underlying histogram (bin size 0.5 μm). Contrast and brightness of the images shown in this study were adjusted with CorelPHOTO-PAINT 2017 (Corel Corporation).

Electrophysiology

The cerebellum was removed immediately after sacrificing the animal and was mounted on the stage of a vibratome (VT1000S, Leica) with cyanoacrylate. The tissue was covered with artificial cerebrospinal fluid (ACSF) containing 134.6 mM NaCl, 21 mM NaHCO₃, 3.4 mM KCl, 0.6 mM NaH₂PO₄, 1 mM MgCl₂, 2.5 mM CaCl₂. The pH was adjusted to 7.4 with HCl and osmolarity was set between 305 and 320 mOsmol/kg. During slicing, the temperature of the ACSF was set to 32–35°C. Acute parasagittal cerebellar slices (200–250 μm) were obtained and incubated in a holding chamber at 35°C for at least 30 min, as previously reported [26,27]. During the experiments, the holding chamber was kept at RT (25–28°C). All solutions were constantly oxygenated with 95% O₂/5% CO₂.

For electrophysiological experiments, the slices were transferred onto the stage of an upright microscope (Nikon Eclipse E600FN). The recording chamber was continuously perfused with oxygenated ACSF at a speed of 1–2 ml/min at RT. Purkinje cells were identified by their morphology using a brightfield camera (DS-Ri1, Nikon) and a water-immersion objective (Nikon Fluor 40x/0.80W). For all experiments, borosilicate glass micropipettes (Science Products, Hofheim, Germany, GB-150F 10) were produced with a horizontal puller (P97; Sutter Instruments, Novato, California, USA) and polished with a microforge to a resistance of 3–5 MΩ. Electrical signals were recorded using a patch-clamp amplifier (EPC 8, HEKA Electronics, Lambrecht, Germany) and the WinWCP Software (RRID:SCR_014713, Version 5.5.2, University of Strathclyde, Glasgow, UK).

For current-clamp experiments, micropipettes were filled with a K-methane sulfonate based internal solution containing 150 mM K-methane sulfonate, 5 mM KCl, 0.1 mM Cs-EGTA, 10 mM Na-HEPES, 3 mM MgATP, 0.4 mM NaGTP, pH 7.4 with KOH, osmolarity 302 mOsmol/kg. This resulted in a reversal potential for chloride (E_Cl) of -87 mV that has previously been reported to reflect the physiological conditions of Purkinje cells [28]. Mature Purkinje cells have been shown to express KCC2 but not its counterpart NKCC1 [29,30], leading to a pronounced chloride extrusion and, therefore, a low E_Cl.

After obtaining the whole-cell configuration, the cell was held at -70 mV for 5 min. Two test pulses (-5 mV and -10 mV, 0.5 s) were induced in voltage-clamp mode to analyze series and input resistance off-line. Spontaneous activity was recorded in current-clamp mode (0 pA, 1 min). To examine the intrinsic excitability of Purkinje cells, the cells were held near -70 mV with hyperpolarizing current injections that were on average comparable between wildtype and Ano2^-/- mice (wt: -496.0 ± 123.5 pA; Ano2^-/-: -506.4 ± 105.8 pA). Two hyperpolarizing (-200 pA and -100 pA) and five depolarizing current pulses (200–1000 pA) were applied for 5 s to monitor the excitability of Purkinje cells in dependence of the amplitude of the current injection. For analysis, three different stages of activation were defined: threshold activation (current injection of 200 pA), moderate activation (600 pA) and strong activation (1000 pA). Each current injection was followed by a test pulse (-50 pA, 1 s) to monitor input resistance during the recording. Current pulses were separated by a break of 2 min. Data were filtered at 3 kHz and sampled at 20 kHz. Series resistance was 5–10 MΩ and was not compensated. To examine the role of chloride currents for excitability of Purkinje cells, measurements were repeated with a slightly modified intracellular solution, where the chloride concentration was adjusted to 23 mM chloride (132 mM K-methane sulfonate, 23 mM KCl, 0.1 mM Cs-EGTA, 10 mM Na-HEPES, 3 mM MgATP, 0.4 mM NaGTP, pH 7.4 with KOH, osmolarity 304 mOsmol/kg) to raise E_Cl to -48 mV which corresponds to the mean simple spike threshold (S2D Fig) that was recorded in the previous experiments. Unless otherwise stated, gabazine (20 μM, Tocris Bioscience) was applied by bath application in all experiments.

For voltage-clamp experiments, micropipettes were filled with an internal solution where K-methane sulfonate was exchanged by Cs-methane sulfonate (150 mM Cs-methane sulfonate, 5 mM KCl, 0.1 mM Cs-EGTA, 10 mM Na-HEPES, 3 mM MgATP, 0.4 mM NaGTP, pH 7.4 with CsOH, osmolarity 295 mOsmol/kg). Since hydrogencarbonate permeability has been reported for Anoctamin-chloride channels [31,32], 0.5 mM of the pH-sensitive dye HPTS (Sigma-Aldrich Cat# H1529; [33]) was added to the intracellular solution in all experiments to visualize Purkinje cell dendrites. Additionally, HPTS fluorescence was used in a preliminary experiment to confirm that ANO2 conducts mainly chloride instead of hydrogencarbonate [31,32] in our experiments. After obtaining the whole-cell configuration, cells were held at -70 mV for 10 min to ensure uniform distribution of HPTS in the dendritic tree. Inhibitory postsynaptic currents (IPSCs) were induced using a slightly modified version of the protocol from [12]. A stimulation pipette (2–2.5 MΩ) filled with ACSF was placed in the molecular layer. The HPTS-fluorescence signal was used to detect non-fluorescent areas between the dendrites of the Purkinje cell of interest, which were used to predict the positions of molecular layer interneurons. Electrical stimulation using a constant current source (DS7A; Digitimer, Welwyn Garden, UK) induced evoked IPSCs (eIPSCs) every 15 s (800 μA, 100 μs, interstimulus interval 50 ms) at a holding potential of -60.5 mV. Experiments on the reduction of inhibition were performed, as previously described [12], with a train of five depolarizing pulses via the patch pipette (-70.5 mV to -20.5 mV for 1 s at 0.5 Hz). A test pulse (5 mV, 0.5 ms) was induced before each stimulation to monitor the series resistance, which was 5–9 MΩ in all experiments. Series resistance was not compensated. Data were filtered and sampled at 3 kHz. ACSF included the AMPA/Kainate receptor antagonist CNQX (10 μM, Tocris Bioscience, Bristol, UK), the NMDA antagonist D-AP5 (40 μM, Tocris Bioscience), the GABA_B antagonist CGP 55845 (2 μM, Tocris Bioscience) and the CB₁ antagonist AM 251 (2 μM, Tocris Bioscience) in all recordings. For control experiments, tetrodotoxin (TTX; 0.5 μM, Abcam) or gabazine (20 μM, Tocris Bioscience) were applied by bath application.

Electrophysiological data were analyzed off-line using Origin (RRID:SCR_014212, Version 9.0, OriginLab, Northampton, Massachusetts, USA) and Spike2 (CED, RRID:SCR_000903, Cambridge, UK). In all experiments, measurements were discarded if the series resistance changed by more than 20% during the recording. Current clamp measurements of spontaneous simple spike activity were only included in analysis, if continuous simple spike firing could be observed for 1 min. The first eight seconds were used for calculation of simple spike frequency in all recordings. Current clamp measurements with current injections were only used for analysis if the input resistance varied by less than 25% during recording and the holding potential stayed between -65 and -75 mV. Simple spikes were counted in the first 500 ms of each current injection step. For the analysis of spike frequency adaptation, interspike intervals (ISIs) of the first sixteen simple spikes after current injections were examined. The amplitude of the hyperpolarization after the current injection was calculated as the difference between the minimum membrane potential during hyperpolarization and the resting membrane potential before the current injection.

The eIPSC amplitudes were calculated as difference between the maximal current during the eIPSC and the holding current immediately before the stimulation. To compare eIPSC measurements of different cells, eIPSC amplitudes were normalized to the average eIPSC amplitude before the depolarization pulse (baseline). Time constant τ for recovery of eIPSC amplitude after depolarization was obtained by using the following model for exponential regression: (1)

Statistics

Statistics were performed using Origin and SigmaPlot (RRID:SCR_003210, Version 13, Systat Software, San José, California, USA). All data sets were tested for normal distribution (Shapiro-Wilk test) prior to statistical analysis. Not normally distributed data were analyzed with the nonparametric Wilcoxon-Mann-Whitney test or the Kruskal-Wallis test. Normally distributed data were analyzed using Student’s unpaired two-tailed t-test with Welch correction or one-way ANOVA with Holm-Sidak’s multiple-comparison test, unless otherwise stated. Two-way ANOVA with Holm-Sidak’s multiple-comparison test was used for the comparison of interspike intervals. Significance level was set to 0.05. Sample sizes were defined as n = number of images or cells from N animals. Data are presented as box plots, with the line indicating the median, the square indicating the mean and the whiskers representing 1.5x interquartile range (IQR). In the figure legends, normally distributed data are presented as mean ± SD otherwise as median with IQR.

Ano2 is expressed in cerebellar Purkinje cells

An expression of ANO2 in Purkinje cells has previously been reported using immunohistochemistry [10,11]. On the other hand, no fluorescence was detected in Purkinje cells of another global ANO2-knockout mouse model that expresses farnesylated mCherry instead of ANO2 [9]. This raised a controversy about whether ANO2 is indeed expressed in Purkinje cells and, to examine this question, we performed qPCR and in situ hybridization experiments to investigate the expression of Ano2-mRNA in cerebellar tissue. Double-stainings of in situ hybridization and immunohistochemistry were used to verify the identity of the neurons expressing Ano2.

Our qPCR experiments revealed an expression of Ano2 mRNA in both cerebellar hemispheres and the Vermis (S1 Fig). In situ hybridization was performed with two different hybridization probes for Ano2 in independent experiments. Both hybridization probes provided a robust signal along the Purkinje cell layer (PCL) in all parts of the cerebellum (Fig 1A). No signal was detectable in the control stainings with the two sense probes (Fig 1A inset). The signals for in situ hybridization (Fig 1B, upper) and immunohistochemistry for calbindin, a marker for Purkinje cells (Fig 1B, middle), clearly overlapped (Fig 1B, lower). These data demonstrate that Ano2 is expressed in cerebellar Purkinje cells.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. Ano2 is expressed in cerebellar Purkinje cells.

(A) Overview of in situ hybridization of a sagittal cerebellar slice reveals a continuous expression of Ano2 in the Purkinje cell layer (PCL). No staining is visible in the molecular layer (ML) and only few cells are labelled in the granule layer (GL) and the area where the deep cerebellar nuclei (DCN) are located. Control experiments using the sense probes revealed no staining in the cerebellum (inset). Scale bars = 1 mm (B) Detail of the Purkinje cell layer demonstrating the colocalization (lower) of the in situ hybridization (upper) with an immunohistochemical staining for calbindin (green) (middle) following the in situ hybridization procedure. A DAPI nuclear stain (blue) was added to visualize the GL. Scale bars = 25 μm.

https://doi.org/10.1371/journal.pone.0247801.g001

Neuroanatomy of the cerebellar cortex is comparable in wildtype and Ano2^-/- mice

Most experiments in this study are based on the comparison of wildtype mice and mice lacking ANO2-chloride channels (Ano2^-/- mice). To check for neuroanatomical integrity of the cerebellar cortex in Ano2^-/- mice, we analyzed density and size of Purkinje cells, as well as the density of molecular layer interneurons with double immunohistochemical stainings of the Purkinje cell marker calbindin together with parvalbumin that stains both Purkinje cells and molecular layer interneurons (Fig 2A). Additionally, we investigated the density of interneuron synapses on the Purkinje cell dendrites, as well as the density and distribution of climbing fiber synapses with co-stainings for calbindin, VGAT and VGluT2, to visualize Purkinje cells, GABAergic and climbing fiber synapses in the molecular layer of wildtype and Ano2^-/- mice, respectively (Fig 2E and 2F).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. Neuroanatomy of the cerebellar cortex is comparable between wildtype and Ano2^-/- mice.

(A) Representative immunohistochemical stainings for calbindin (green) and parvalbumin (red) on sagittal cerebellar slices of wildtype (left) and Ano2^-/- mice (right). Stainings were used to compare Purkinje cell density (B) and size (C) as well as the density of molecular layer interneurons (D) between wildtype and Ano2^-/- mice. DAPI (blue) was used to visualize cell nuclei. (B)–(D) No significant differences were detected in Purkinje cell density (B; wt 41.1 ± 6.4 per mm PCL, n = 61 images from N = 6 animals, Ano2^-/- 38.5 ± 7.5 per mm PCL, n = 42 N = 6; Student’s t-test p = 0.0811) and diameter (C; wt 20.7 ± 3.4 μm, n = 342 cells in 61 images from N = 6 animals, Ano2^-/- 21.1 ± 3.7 μm, n = 246 in 42 images N = 6; Student’s t-test p = 0.2091), as well as in the density of molecular layer interneurons (D; wt 15.9 per 10⁵ μm³ ML IQR 13.3–20.7, n = 62 images from N = 6 animals; Ano2^-/- 17.1 per 10⁵ μm³ ML IQR 13.3–23.6, n = 45 N = 6; Wilcoxon-Mann-Whitney test p = 0.501) between wildtype and Ano2^-/- mice. (E) Immunohistochemical staining for calbindin (blue), VGluT2 (green) and VGAT (red) on sagittal cerebellar slices. As expected, GABAergic synapses (red) cover the entire molecular layer, whereas climbing fiber synapses (green) only span the proximal two thirds of the molecular layer. (F) Detail of a Purkinje cell with primary and secondary dendrites (calbindin; blue) with climbing fiber synapses (VGluT2; green) and GABAergic synapses (VGAT; red). (G), (H) No significant differences were detected in density of GABAergic (G; wt 22.0 ± 6.8 per 10² μm² ML, n = 42 images from N = 5 animals, Ano2^-/- 21.8 ± 5.5 per 10² μm² ML, n = 47 N = 5; Student’s t-test p = 0.8788) and climbing fiber synapses (H; wt 3.5 ± 1.0 per 10² μm² ML, n = 42 images from N = 5 animals; Ano2^-/- 3.2 ± 1.0 per 10² μm² ML, n = 48 N = 5; Student’s t-test p = 0.1989) in the proximal half of the molecular layer between wildtype and Ano2^-/- mice. (I) Histograms of the distances measured between adjacent climbing fiber synapses on a Purkinje cell dendrite reveal a comparable distribution of climbing fiber synapses between wildtype and Ano2^-/- mice (bin size = 0.5 μm; wt n = 1698 distances in 35 images from N = 9 animals, Ano2^-/- n = 1762 in 30 images N = 6). ML = molecular layer; PCL = Purkinje cell layer; GL = granule layer. Scale bars = 20 μm.

https://doi.org/10.1371/journal.pone.0247801.g002

We did not observe any significant differences between wildtype and Ano2^-/- mice, neither for density (Fig 2B) or size of Purkinje cells (Fig 2C), nor for density of molecular layer interneurons (Fig 2D). As anticipated, GABAergic synapses covered the entire molecular layer, whereas climbing fiber synapses only populated the proximal two thirds of the molecular layer in both wildtype and Ano2^-/- mice. We did not detect any significant difference between wildtype and Ano2^-/- mice for the density of GABAergic synapses (Fig 2G) nor for the density of climbing fiber synapses (Fig 2H). Climbing fiber synapses were regularly distributed in both wildtype and Ano2^-/- mice, with distances typically ranging from 1 to 5 μm, without clusters of synapses being observable (Fig 2I).

These results provide evidence, that the neuroanatomical parameters of the cerebellar cortex of Ano2^-/- mice are not significantly altered compared to wildtype mice. Therefore, we can assume that functional differences between wildtype and Ano2^-/- mice are due to the absence of ANO2 chloride-channels as opposed to being a consequence of neuroanatomical changes in the cerebellar cortex of Ano2^-/- mice.

ANO2 does not affect spontaneous simple spike activity of Purkinje cells

Purkinje cells display intrinsically driven simple spike discharge at high rates (ca. 40–50 Hz) which is modulated by parallel fiber input [34,35]. Additionally, Purkinje cells receive excitatory input from climbing fibers that irregularly elicit complex spikes in Purkinje cells at low rates (ca. 1 Hz) [36]. We performed current-clamp measurements on Purkinje cells in acute cerebellar slices to analyze spontaneous simple spike discharge of Purkinje cells in wildtype and Ano2^-/- mice. To monitor this spontaneous activity, Purkinje cells were held at 0 pA.

The measured spontaneous simple spike firing rates of wildtype mice without gabazine corresponded to published data [35] and no significant difference was observed between wildtype and Ano2^-/- mice (Fig 3A). We added 20 μM gabazine to the bath solution to eliminate chloride currents conducted by GABA_A-mediated channels. As expected, spontaneous simple spike activity became more regular and firing rates increased but were still comparable between wildtype and Ano2^-/- mice (Fig 3B). These results suggest, that ANO2 does not modulate spontaneous simple spike discharge of Purkinje cells.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. Spontaneous simple spike firing of Purkinje cells is unaltered in Ano2^-/- mice.

Representative traces of spontaneous simple spike activity in wildtype (black) and Ano2^-/- mice (red) before (A) and after (B) addition of 20 μM gabazine to the bath solution. The arrows in (A) mark spontaneous inhibitory postsynaptic currents (IPSCs) that were then blocked by addition of gabazine to the bath solution. Comparison of spontaneous simple spike firing rates reveals no significant difference between wildtype and Ano2^-/- mice without (A; wt 43.3 ± 12.9 Hz, n = 10 cells of N = 3 animals; Ano2^-/- 53.2 ± 21.4 Hz, n = 15 N = 3; Student’s t-test p = 0.1631) and with 20 μM gabazine (B; wt 62.3 ± 21.5 Hz, n = 12 cells of N = 3 animals; Ano2^-/- 59.8 ± 20.4 Hz, n = 23 N = 5; Student’s t-test p = 0.7448).

https://doi.org/10.1371/journal.pone.0247801.g003

ANO2-mediated chloride currents reduce excitability of Purkinje cells

Spontaneous simple spike activity of Purkinje cells can be modulated by inhibitory and excitatory input from molecular layer interneurons and parallel fibers, respectively, leading to simple spike rates of up to 250 Hz [37,38]. To investigate the excitability of Purkinje cells, we first applied hyperpolarizing currents to clamp Purkinje cells close to -70 mV and then injected depolarizing current pulses of 200 to 1000 pA amplitude. Current injection of 200 pA resulted in threshold activation [39], 600 pA in moderate activation and 1000 pA in strong activation of Purkinje cells. Simple spikes were counted in the first 500 ms of each current pulse. Additionally, spike frequency adaptation as well as the hyperpolarization following the current injections were analyzed. Because ANO2-mediated changes in excitability could either be caused by chloride currents or, alternatively, by a shunt conductance via ANO2, the recordings were repeated with a slightly modified intracellular solution, where the chloride concentration was adjusted to raise the reversal potential for chloride currents (E_Cl) from -87 mV to -48 mV. As -48 mV corresponded to the mean simple spike threshold (S2D Fig), this approach resulted in a minimized net chloride current at the simple spike threshold, whereas the shunt conductance was still effective. Therefore, this second set of experiments allowed to distinguish between effects that were caused by chloride currents via ANO2 or by an ANO2-mediated shunt conductance. All recordings were performed in the presence of 20 μM gabazine, to eliminate GABA_A-mediated chloride currents.

As expected, threshold activation of Purkinje cells of wildtype mice induced only a few simple spikes or no spikes at all (Fig 4A left). In contrast, repetitive simple spike activity could regularly be observed in Purkinje cells of Ano2^-/- mice upon the same current injection intensity. This resulted in a significantly increased average number of simple spikes upon threshold activation in Ano2^-/- mice (Fig 4A middle). Repetitive simple spike activity was also significantly increased in Ano2^-/- mice upon strong current injections (Fig 4C), whereas only a slight tendency towards increased simple spike activity could be observed in Ano2^-/- mice upon moderate current injections (Fig 4B). Interestingly, these differences between wildtype and Ano2^-/- mice disappeared upon elevation of E_Cl to the simple spike threshold. Moreover, the elevation of E_Cl appeared to only affect the simple spike activity of wildtype but not Ano2^-/- Purkinje cells. The elevation of E_Cl neither influenced the basic electrical properties of Purkinje cells, such as input resistance and simple spike threshold, nor the spontaneous simple spike activity (S2 Fig).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. ANO2 reduces excitability during strong and threshold activation.

Analysis of simple spike counts upon threshold activation (A), moderate activation (B) and strong activation (C). Representative traces (left) of simple spike activity of Purkinje cells from wildtype (black) and Ano2^-/- mice (red) at physiological E_Cl. Comparison of simple spike counts during the first 500 ms of the respective current injection at physiological (middle) and elevated E_Cl (right) (A middle: wt 1.0 IQR 0.0–7.0, n = 39 cells of N = 8 animals, Ano2^-/- 6.0 IQR 0.0–13.0, n = 43 cells of N = 11 animals, Wilcoxon-Mann-Whitney test p = 0.040; A right: wt 5.0 IQR 0.0–14.3, n = 32 cells of N = 6 animals, Ano2^-/- 9.0 IQR 1.0–14.75, n = 36 cells of N = 8 animals, Wilcoxon-Mann-Whitney test p = 0.368; B middle: wt 33.1 ± 11.0, n = 35 cells of N = 8 animals, Ano2^-/- 35.9 ± 11.8, n = 31 N = 9, Student’s t-test p = 0.3255; B right: wt 38.9 ± 11.1, n = 29 cells of N = 6 animals, Ano2^-/- 38.5 ± 10.6, n = 31 N = 8, Student’s t-test p = 0.9116; C middle: wt 46.1 ± 11.0, n = 21 cells of N = 6 animals, Ano2^-/- 54.1 ± 10.6, n = 19 N = 7, Student’s t-test p = 0.0255; C right: wt 57.6 ± 11.4, n = 27 cells of N = 6 animals, Ano2^-/- 60.0 ± 13.1, n = 29 N = 7, Student’s t-test p = 0.4788). * p < 0.05.

https://doi.org/10.1371/journal.pone.0247801.g004

Spike frequency adaptation was examined by analyzing the progression of interspike intervals (ISIs) for moderate and strong current injections. Because threshold activation did often induce only few simple spikes, spike frequency adaptation was not analyzed in this case. At physiological E_Cl, the first ISIs were similar in wildtype and Ano2^-/- mice for both moderate and strong activation but then gradually diverged, with ISIs growing larger in wildtype compared to Ano2^-/- Purkinje cells (Fig 5 left). In contrast, when the driving force for chloride was reduced no divergence of ISIs was observed for both moderate and strong current injections (Fig 5 right). Only a minimal parallel shift between wildtype and Ano2^-/- mice were observed upon strong activation of Purkinje cells. Furthermore, we analyzed the extent and time course of hyperpolarization that occurred after returning to the holding current that clamped Purkinje cells close to -70 mV. The amplitude of afterhyperpolarization was significantly decreased in Ano2^-/- mice compared to wildtype following strong activation at physiological, but not elevated E_Cl (Fig 6B). The same tendency, although not statistically significant, was observed after moderate and threshold activation (S3 Fig). No difference between wildtype and Ano2^-/- mice was observed for the time until maximal afterhyperpolarization, neither at physiological nor at increased intracellular chloride concentration.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. ANO2-mediated chloride currents gradually increase interspike intervals.

Progression of interspike intervals (ISIs) during the first sixteen simple spikes upon moderate (A) and strong activation (B) of Purkinje cells in wildtype (black) and Ano2^-/- mice (red). At physiological E_Cl (left), the interspike intervals in wildtype mice grow longer from the second ISI on, causing a divergence of the ISIs from wildtype and Ano2^-/- mice. In contrast, the progression of ISIs at elevated E_Cl (right) develops without divergence (A left: Genotype effect: F(1, 930) = 22.65, p < 0.001; ISI number x genotype interaction: F(14, 930) = 0.09, p = 1; A right: Genotype effect: F(1, 900) = 0.18, p = 0.6712; ISI number x genotype interaction: F(14, 930) = 0.01, p = 1; B left: Genotype effect: F(1, 570) = 29.37, p < 0.001; ISI number x genotype interaction: F(14, 570) = 0.14, p = 1; B right: Genotype effect: F(1, 840) = 4.2, p = 0.0430; ISI number x genotype interaction: F(14, 840) = 3.7, p = 1). * p < 0.05; *** p < 0.001.

https://doi.org/10.1371/journal.pone.0247801.g005

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6. ANO2 increases the hyperpolarization following strong activation of Purkinje cells.

(A) Representative traces of the afterhyperpolarization (AHP) following strong activation of wildtype (black/grey) and Ano2^-/- (red/dark red) Purkinje cells at physiological and elevated E_Cl. The holding current was set at -500 pA or -550 pA for all cells in this example. (B) AHP amplitude after strong activation is significantly larger in wildtype compared to and Ano2^-/- mice at physiological E_Cl, but not at elevated E_Cl (E_Cl -87 mV: wt -11.2 ± 2.8 mV, n = 20 cells of N = 6 animals; Ano2^-/- -8.9 ± 2.4 mV, n = 19 N = 7; Student’s t-test p = 0.0097; E_Cl -48 mV: wt -9.0 ± 3.0 mV, n = 27 cells of N = 6 animals; Ano2^-/- -9.2 ± 1.9 mV, n = 31 N = 7; Student’s t-test p = 0.7983) (C) Time till the maximal AHP is reached after strong activation is unaltered by ANO2 or the elevation of E_Cl (E_Cl -87 mV: wt 187.8 ± 53.2 ms, n = 20 cells of N = 6 animals; Ano2^-/- 178.1 ± 35.6 ms, n = 19 N = 7; Student’s t-test p = 0.5073; E_Cl -48 mV: wt 172.4 ± 50.7 mV, n = 27 cells of N = 6 animals; Ano2^-/- 181.4 ± 49.8 ms, n = 31 N = 7; Student’s t-test p = 0.5035). ** p < 0.01.

https://doi.org/10.1371/journal.pone.0247801.g006

Taken together, these results indicate that ANO2-mediated chloride currents reduce the excitability of Purkinje cells at the activation threshold and during strong activation. These chloride currents lead to a prolongation of ISIs from the second simple spike on and additionally promote hyperpolarization after current injections stop.

ANO2 attenuates inhibition after depolarization of Purkinje cells

It has previously been suggested that ANO2 is involved in a process causing attenuation of GABAergic inhibition following climbing fiber input [10]. This process was proposed to rely on a calcium-mediated influx of chloride into the dendrites that increases the local intracellular chloride concentration and, thus, diminishes the driving force for chloride across the dendritic membrane [12]. The resulting reduction of amplitude observed in spontaneous inhibitory postsynaptic currents (IPSCs) at GABAergic synapses of wildtype mice, could not be detected in Ano2^-/- mice [10]. This finding gave rise to the idea that ANO2 would temporarily relieve Purkinje cells from GABAergic inhibition after a calcium surge that accompanies a complex spike. However, it is still unclear whether this effect is based on ANO2 channels in inferior olivary neurons or ANO2 channels in the dendritic membrane of Purkinje cells.

To address this question, we performed whole-cell voltage clamp recordings on Purkinje cells uncoupled from climbing fiber input, using a stimulation protocol slightly modified from [12] (Fig 7A). In contrast to the previously performed experiments [10], IPSCs were evoked by stimulation of individual molecular layer interneurons with an ACSF-filled glass pipette positioned in the molecular layer (P2 in Fig 7A). Purkinje cells were held at a membrane potential of -70.5 mV, which was increased to -60.5 mV during stimulation of molecular layer interneurons in order to provide a better signal-to-noise ratio of the evoked IPSCs (eIPSCs; b in Fig 7B). Molecular layer interneurons were stimulated twice (arrows in Fig 7B) with an interstimulus interval of 50 ms to monitor the paired-pulse ratio as a parameter for recording stability and postsynaptic localization of the effect. A pipette solution with low chloride was used in all recordings resulting in an E_Cl of -87 mV. Therefore, chloride currents, such as eIPSCs, appeared as outward currents in the recordings (c in Fig 7B). Reduction of eIPSC amplitude was induced, as previously described [12], with five depolarizing pulses to -20.5 mV (inset in Fig 7A) via the patch pipette (P1 in Fig 7A). Each depolarization step lasted for 1 s and was separated from the next depolarization step by another 1 s (0.5 Hz). Glutamatergic inputs as well as CB₁ and GABA_B mediated signals were blocked by bath application of CNQX (10 μM), D-AP5 (40 μM), AM 251 (2 μM) and CGP 55845 (2 μM) in all recordings. eIPSCs were completely abolished in the presence of 0.5 μM TTX (Fig 7C) or 20 μM gabazine (Fig 7D). The polarity of the currents together with their sensitivity for TTX and gabazine indicates, that the evoked IPSCs are indeed mediated by molecular layer interneurons.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 7. Stimulation of molecular layer interneurons and control experiments.

(A) Schematic illustration of the neuronal circuits in the cerebellar cortex and the protocol for the stimulation of molecular layer interneurons. Purkinje cells (PC) are the central element in the olivo-cerebellar circuit. Purkinje cells project to the deep cerebellar nuclei (DCN) and receive excitatory input from the mossy fiber (MF)-parallel fiber (PF) pathway and from climbing fibers (CF), which originate in the inferior olivary nucleus (IO) of the brainstem. Basket cells (BC) and stellate cells (SC) both inhibit Purkinje cells, whereas Golgi cells (GoC) inhibit the mossy fiber-granule cell (GrC) synapse. Evoked inhibitory postsynaptic currents (eIPSCs) are induced by extracellular stimulation of molecular layer interneurons (P2). eIPSCs are recorded at the Purkinje cell soma with the patch pipette (P1). Reduction of eIPSC amplitudes is induced by a train of five depolarizing pulses with an amplitude of 50 mV via the patch pipette (inset). GL = granule layer, PCL = Purkinje cell layer, ML = molecular layer (B) Representative trace of an eIPSC recording described in (A). At the beginning of each recording, a test pulse (a) was applied to monitor series resistance. The holding potential was increased to -60.5 mV (b) before inducing two eIPSCs (c) with an interstimulus interval of 50 ms (arrows in the command trace). The red arrow marks the amplitude of eIPSC that was analyzed in these experiments (C), (D) Representative traces of eIPSC recordings of one cell before (black) and after (grey) adding 0.5 μM TTX (C) or 20 μM gabazine (D) to the bath solution. eIPSCs are completely abolished by both TTX and gabazine.

https://doi.org/10.1371/journal.pone.0247801.g007

To investigate whether an ANO2-mediated chloride current attenuates inhibition after depolarization of Purkinje cells, we measured the eIPSC amplitude (red arrow in Fig 7B) every 15 s before and after depolarizing Purkinje cells of wildtype and Ano2^-/- mice via the patch pipette (Fig 8A). To compare recordings of different cells, eIPSC amplitudes were normalized to the averaged eIPSC amplitude preceeding depolarization (baseline). eIPSC amplitudes were significantly reduced in wildtype mice 15 s after depolarization (Fig 8B, upper). In accordance with previous experiments [12], paired-pulse ratios did not change after depolarization (S4 Fig). We observed a complete recovery of eIPSC amplitude with time constant τ = 30.6 s, which was calculated by performing a monoexponential fit to the mean values of eIPSC amplitudes (Fig 8C). In Ano2^-/- mice, the eIPSC amplitude was also reduced significantly after depolarization of Purkinje cells (Fig 8B, lower). Comparing both datasets revealed that the effect of depolarization on the eIPSC amplitudes was significantly stronger in wildtype compared to Ano2^-/- mice (Fig 8D).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 8. ANO2 promotes reduction of eIPSC amplitude.

(A) Representative traces of eIPSC recordings in wildtype (upper) and Ano2^-/- mice (lower) before (black/dark red) and after depolarization (grey/light red) of Purkinje cells. The dotted line marks the holding current right before stimulation of interneurons from which the amplitude was calculated. (B) Time course of eIPSC amplitude in wildtype (upper) and Ano2^-/- mice (lower). Reduction (blue) was defined as the difference between eIPSC amplitude of the last measurement before depolarization and eIPSC amplitude of the second measurement after depolarization. eIPSC amplitude was significantly reduced in both mouse lines after depolarization (wt before depol. 110.4 ± 16.3%, wt after depol. 59.6 ± 13.4%, paired Student’s t-test p = 0.0001; Ano2^-/- before depol. 101.6 ± 14.5%, Ano2^-/- after depol. 74.5 ± 18.4%, paired Student’s t-test p = 0.0004). (C) Recovery of eIPSC amplitude in wildtype Purkinje cells after depolarization (B, upper). An exponential fit (red) to the mean values of eIPSC amplitude was performed to obtain the time constant τ = 30.6 s of recovery. (D) Comparison of reduction of eIPSC amplitudes (blue in B) between wildtype and Ano2^-/-mice. The reduction of eIPSC amplitude is significantly attenuated in Ano2^-/- mice (wt 50.8 ± 20.9%, Ano2^-/- 27.2 ± 21.2%, Student’s t-test p = 0.0173). wt n = 9 cells from N = 6 animals; Ano2^-/- n = 14, N = 9; * p < 0.05, *** p < 0.001.

https://doi.org/10.1371/journal.pone.0247801.g008

The observed reduction of eIPSC amplitudes in wildtype mice occurred without contribution of climbing fibers. Because this reduction was diminished in Ano2^-/- mice, we conclude that ANO2 in Purkinje cells must contribute to this process, although other factors appear to be involved as well.

Taken together, our results provide conclusive evidence that ANO2 is expressed in cerebellar Purkinje cells where it reduces simple spike activity during strong activation and at the activation threshold. Additionally, ANO2 seems to be activated upon strong depolarization in the dendrites, which leads to a transient reduction of IPSC amplitudes.