Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

The performance of HCV GT plus RUO reagent in determining Hepatitis C virus genotypes in Taiwan

  • Ying-Chou Huang,

    Roles Conceptualization, Data curation, Formal analysis, Validation, Writing – original draft

    Affiliation Hepatobiliary Division, Department of Internal Medicine, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan

    ⨯
  • Chung-Feng Huang,

    Roles Conceptualization, Data curation, Formal analysis

    Affiliations Hepatobiliary Division, Department of Internal Medicine, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan, Faculty of Internal Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan, Hepatitis Centre, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan

    ⨯
  • Shu-Fen Liu,

    Roles Methodology, Project administration

    Affiliation Hepatobiliary Division, Department of Internal Medicine, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan

    ⨯
  • Hung-Yin Liu,

    Roles Resources, Software

    Affiliation Hepatobiliary Division, Department of Internal Medicine, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan

    ⨯
  • Ming-Lun Yeh,

    Roles Resources, Software, Visualization

    Affiliations Hepatobiliary Division, Department of Internal Medicine, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan, Faculty of Internal Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan, Hepatitis Centre, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan

    ⨯
  • Ching-I Huang,

    Roles Investigation, Methodology

    Affiliations Hepatobiliary Division, Department of Internal Medicine, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan, Faculty of Internal Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan, Hepatitis Centre, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan

    ⨯
  • Meng-Hsuan Hsieh,

    Roles Resources, Software

    Affiliations Hepatobiliary Division, Department of Internal Medicine, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan, Faculty of Internal Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan, Hepatitis Centre, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan

    ⨯
  • Chia-Yen Dai,

    Roles Supervision, Validation

    Affiliations Hepatobiliary Division, Department of Internal Medicine, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan, Faculty of Internal Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan, Hepatitis Centre, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan

    ⨯
  • Shinn-Chern Chen,

    Roles Software, Validation

    Affiliations Hepatobiliary Division, Department of Internal Medicine, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan, Faculty of Internal Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan, Hepatitis Centre, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan

    ⨯
  • Ming-Lung Yu,

    Roles Supervision, Validation

    Affiliations Hepatobiliary Division, Department of Internal Medicine, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan, Faculty of Internal Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan, Hepatitis Centre, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan

    ⨯
  • Wan-Long Chuang,

    Roles Supervision, Validation

    Affiliations Hepatobiliary Division, Department of Internal Medicine, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan, Faculty of Internal Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan, Hepatitis Centre, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan

    ⨯
  • Jee-Fu Huang

    Roles Data curation, Resources, Supervision, Validation, Writing – review & editing

    jf71218@gmail.com

    Affiliations Hepatobiliary Division, Department of Internal Medicine, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan, Faculty of Internal Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan, Hepatitis Centre, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan

    ⨯

Abstract

Background and aims

Hepatitis C virus (HCV) genotyping is a pivotal tool for epidemiological investigation, guiding management and antiviral treatment. Challenge existed in identifying subtypes of genotype-1 (G-1) and genotype (GT) of indeterminate. Recently, the Abbott HCV RealTime Genotype Plus RUO assay (HCV GT Plus) has been developed aiming to overcome the limitations. We aimed to evaluate the performance of the assay compared with 5’ UTR sequencing in clinical samples.

Materials and methods

Eligible individuals were treatment chronic hepatitis C patients that were enrolled consecutively in a medical center and two core regional hospitals in southern Taiwan from Oct 2017 through Aug 2018. The patient with genotype 1 without subtype and indeterminate previously genotyped by Abbott RealTime HCV GT II will further determinate by Abbott HCV RealTime HCV GT Plus. All of the genotype results were validated by 5' UTR sequencing as a reference standard.

Results

A total of 100 viremic CHC patients were recruited, including 63 G-1 patients (male: 28), and 37 patients (male: 15) of indeterminate genotyped by Abbott RealTime HCV GT II assay (HCV GT II), respectively. The detection rate of 63 GT1 samples without subtype were 93.7% (59/63), 37 indeterminate samples without genotype were 62.2 (23/37) by HCV GT Plus. 5' UTR sequencing confirmed HCV GT Plus characterized results for 84.7% (50/59) of type1, with 100% (4/4), 82.8 (24/29) and 84.6% (22/26) for 1a, 1b and type6; 65.2% (15/23) of indeterminate with 100% (3/3) and 60% (12/20) for 1b and type 6 samples, respectively.

Conclusions

The Abbott RealTime HCV GT Plus RUO assay provides additional performance in GT detection.

Introduction

Hepatitis C virus (HCV) is a 30–60 nm diameter, lipid-coated RNA virus and carries continuously a huge impact on liver-related events and hepatocellular carcinoma (HCC) globally [1]. According to the World Health Organization (WHO), there are 1.75 million new-infected cases annually, and still 75 million people have been suffering from chronic hepatitis C (CHC) worldwide. Approximately 399,000 people die directly due to CHC-related cirrhosis and HCC each year. The prevalence of anti-HCV seropositivity among adults in Taiwan was about 4.4%, much larger than other countries [2–4]. However, geographic difference of prevalence exists and it could reach to 15–20% in some hyperendemic areas in South Taiwan [5–7]. Therefore, research on HCV infection is of great significance to global health and public health.

Among all HCV genotypes, HCV genotype 1 (G-1) is the most prevalent in the world (46.2–49.1%), followed by G-3 (17.9–30.1%,), G-4 (8.3–16.8%), G-2 (9.1–11.0%), G-6 (5.4%), and G-5 (<1%) [8–10]. Apart from the implications of demographic epidemiology, different genotype may lead to different disease course and treatment outcomes. For example, G-1b leads to the highest incidence of developing cirrhosis and HCC [11–13]. The scenario becomes worse in heavy drinking, elders and HCV/ HIV co-infected [14–16]. G-3 infection is the next most prevalent genotype with 54.3 million patients globally. It is associated with an increasing risk of fibrosis, liver-related events, HCC, and overall mortality. G-3 infection may have a negative impact on histological and clinical outcomes in CHC patients. In addition, its characteristic features of steatosis and metabolic abnormalities may add more difficulty in the disease management [17–20]. Therefore, the precise determination of genotype in CHC patients is essential in a clinical setting. In addition, although G-1 and -2 were the major genotypes of HCV infection in Taiwan, geographic difference of genotype distribution occurs even in this beautiful country [21, 22].

In the past decade, direct-acting antivirals (DAAs), with the extremely high efficacy, low adverse effect, and short treatment duration, have become the main stream of HCV therapy. However, the successful treatment of HCV infection in some undeveloped and developing regions remains challenging because the cost and the affordability [23–25]. The precise diagnosis of genotyping is informative and critical for pretreatment assessment and subsequent therapeutic decision. To scale up HCV care cascade and HCV elimination, HCV genotyping may not be warranted at the population level. At the individual level, HCV genotyping might help to facilitate HCV treatment plan in terms of difficult-to-cure population (ex. HCV genotype 3) or to distinguish potential virological failure from reinfection. During the past decade, HCV genotyping technologies have been continuously improving, yielding many commercialized diagnostic assays for clinical purposes. Among them, Abbott RealTime HCV Genotype II Assay (HCV GT II, Abbott Laboratories, USA) is one of the widely-used assays for genotyping. However, clinical validation studies demonstrated that G-1a and G-1b subtypes could not be precisely identified among 6–7% G-1 (result showed type 1 only, no subtype-1a or 1b) samples, whereas 3–4% samples identified as indeterminate (detected HCV but did not produce a genotype result) genotype [26, 27].

In order to overcome the challenging issues, Abbott RealTime HCV Genotype Plus RUO assay (HCV GT Plus, Abbott Laboratories, USA), has been developed recently based on Taqman real-time PCR method [28–30]. The performance verification of HCV GT Plus in Taiwan still has no complete evaluation report so far. Consequently, we conducted the study aiming to elucidate the performance of the HCV GT Plus in the genotyping diagnosis. Its detection performance will be compared with the direct sequencing results.

Materials and methods

Patient selection

This study was reviewed and approved by Institutional Review Board, Kaohsiung Medical University Hospital (KMUH/IRB/AF/2.8-01-11.0). The study was conducted in one medical centre and 2 regional hospitals in Southern Taiwan. We recruited those CHC patients with age and HCV viral loads criteria were over 20 years old above and over 500 IU/mL, respectively. All participants were informed of the research content and signed a written consent form. People with not detected for HCV RNA were suitable as negative control group. We also recruited the HCV genotype 1 with subtype 1a or 1b and genotype 6 previously genotyped by Abbott RealTime HCV GT II as positive control group. The patient’s serum samples were determinate for genotype from Oct 2017 through Aug 2018. All the eligible patients with genotype 1 without subtype and indeterminate previously genotyped by Abbott RealTime HCV GT II will further determinate by Abbott HCV RealTime HCV GT Plus. All of the genotype results were validated by 5' UTR sequencing as a reference standard. The patients with other viral infections such as HIV or HBV were excluded.

Sample preparation

All the serum samples were centrifuged within 4 hours after the blood was drawn, and the HCV viral load, genotype was tested within 1 week by HCV GT II by using Abbott RealTime HCV m2000 PCR System. The qualified samples were stored in -70°C for further HCV GT Plus testing according to the manufacturer’s manual. Direct sequencing was done on 5’ UTR region by using ABI PRISM Big-Dye Terminator Cycle Sequencing Ready Reaction Kit, v3.1 (Applied Biosystems) on the ABI PRISM 3730XL DNA Analyzer. Primers used for PCR amplification and sequencing of 5’ UTR region were TTGTGGTACTGCCTGATAGGG (forward) and GGATGTACCCCATGAGGTCG (reverse). The reverse transcription reaction was done by using High Capacity cDNA Reverse Transcription Kit according to the standard protocol of the supplier (Applied Biosystems) for 120 min at 37°C. The clinical data such as albumin, bilirubin, transaminase, gamma-glutamyl transferase (GGT), and lipids levels were measured on a multichannel auto analyzer (Hitachi Inc, Tokyo, Japan).

Statistical analyses

Data were expressed as mean ± interquartile range (IQR). Chi-square test, Wicoxon rank-sum test, Pearson correlation coefficient and simple linear regression were used when appropriate. Quality control procedures, database processing and analyses were performed using the SPSS 20 statistical package (SPSS Inc., Chicago, IL, USA).

Results

A total of 100 viremic CHC patients were recruited, including 63 G-1 patients, and 37 patients of indeterminate genotyped by Abbott RealTime HCV GT II assay (HCV GT II), respectively. Five healthy volunteers who were not infected with HCV served as a negative control group (NCG, HCV RNA: Not detected); for the positive control group, HCV GT Plus confirmed HCV GT II characterized results for 100% (3/3) of 1a, with 100% (2/2), 100% (3/3) for 1b and type 6, respectively, validated by 5' UTR sequencing as a reference standard. Their demographical and clinical features of the patients are shown in Table 1.

thumbnail
Table 1. Basic demographic and clinical features of the two patient groups with type1 and indeterminate.

https://doi.org/10.1371/journal.pone.0246376.t001

For those 63 G-1 patients tested by HCV GT II, 59 (93.7%) patients were readily identified for their sub-genotypes or type by HCV GT Plus. There were 4 patients of G-1a, 29 patients of G-1b, 26 patients of G-6, and 4 patients of undetected, respectively. On the other side, for those 37 patients whose genotype showed indeterminate by HCV GT II, 23 (62.2%) patients could be genotyped by HCV GT Plus, including 3 patients of G-1b and 20 patients of G-6. We further used direct sequencing method based on 5' UTR sequence to test the performance of HCV GT Plus among those 63 G-1 patient samples detected by HCV GT II. The successful detection rate was 87.3% (55/63) by direct sequencing. The concordance rates between HCV GT Plus and direct sequencing method for G-1 samples was 84.8% (50/59), including 100% (4/4) of G-1a, 82.8% (24/29) of G-1b and 84.6% (22/26) of G-6.

Among those 26 patients who were genotyped G-1 by HCV GT II whereas G-6 genotype was identified on HCV GT Plus, 22 (84.6%) patients were of G-6 (G-6a = 7, 6e = 7, 6g = 4, 6u = 1, 6w = 3) by direct sequencing. Two of the 26 patients were genotyped as G-2 (Table 2).

thumbnail
Table 2. Concordance comparison of HCV GT II/HCV GT Plus assays and direct sequencing results for the 63 G-1 patient samples.

https://doi.org/10.1371/journal.pone.0246376.t002

There were 37 indeterminate genotype patients tested by HCV GT II. Twenty-three (62.2%) samples could be genotyped by HCV GT Plus, including 3 of G-1b, and 20 of G-6, respectively. Among those 20 patients who were genotyped indeterminate by HCV GT II whereas G-6 genotype was identified on HCV GT Plus, 12 (60%) patients were of G-6 (G-6a = 3, 6c = 4, 6e = 3, 6g = 1, 6n = 1) by direct sequencing. Among those 14 samples not detected by HCV GT Plus, 10 of them were genotyped as G-2 infection by direct sequencing (Table 3).

thumbnail
Table 3. Concordance comparison of HCV GT II/HCV GT Plus assays and direct sequencing results for the 37 indeterminate genotype patient samples.

https://doi.org/10.1371/journal.pone.0246376.t003

Discussion

HCV strains are classified into eight recognized genotypes on the basis of phylogenetic and sequence analyses of whole viral genomes, further classified into 90 confirmed subtypes [31, 32]. HCV genotyping is essential in clinical setting for epidemiological study, implementation of therapeutic intervention, and outcome prediction [33–35]. Precise GT determination of genotypes by molecular diagnostic methods is a clinical challenging task with the current commercial assays, particularly in G-1 and indeterminate genotypes due to the high variability of HCV. The inability to distinguish G-6 subtypes might impact on redicted SVR to interferon (IFN)-based therapies in patients with apparent G-1 infection [35].

Taiwan government started to reimburse DAA with genotype specific regimens including daclatasvir /asunaprevir, paritaprevir/ritonavir/ombitasvir/dasabuvir, sofosbuvir/ledipasvir, sofosbuvir/ledipasvir and elbasvir/grazoprevir since 2017. For the pangenotypic DAAs, the National Health Insurance Administration of Taiwan start to reimburse glecaprevir/ pibrentasvir since Aug 2018 and sofosbuvir/velpatasvir since June 2019. Nowadays, available DAAs in Taiwan include elbasvir/grazoprevir, glecaprevir/ pibrentasvir and sofosbuvir/velpatasvir at the time of manuscript drafting. The choice of DAA regimens is at physicians’ discretion. Even though pangenotypic DAAs are available in Taiwan, it is mandatory to provide and upload HCV genotype data to the government while applying DAAs per request by the authority (https://www.nhi.gov.tw/Content_List.aspx?n=A4EFF6CD1C4891CA&topn=3FC7D09599D25979)

To our knowledge, this is the first study to address the characteristics of HCV GT Plus performance completely with G-1 and indeterminate patients in Taiwan. We demonstrated that the concordance rate was only 52.4% (33/63) between HCV GT II and HCV GT Plus in G-1 patients. G-6 and its variants, previously mistyped as G-1. HCV G-6, highly prevalent in the Asia–Pacific region, can be incorrectly classified as G-1 because they share similar nucleotide homology in the 5′UTR [36, 37]. Mainly infection areas of G-6 are concentrated in South Asia, including Vietnam, Thailand, Hong Kong and Macau [38, 39]. Ethnic groups are mainly prevalent in injection drug users (IDUs). The main infection subtype of G-6 in Taiwan was 6a [40], but this time we also found other G-6 subtypes (6c, 6e, 6g, 6n).

Direct sequencing confirmed HCV GT Plus results for 84.7% (50/59) of G-1, with 100% (4/4), 82.8% (24/29) and 84.6% (22/26) for 1a, 1b and GT 6, respectively. Therefore, the HCV GT Plus assay has a very good ability to distinguish 1a, 1b and G-6 in G-1 group.

Among the 37 patients of indeterminate genotype detected by HCV GT II, 62.2% (23/37) patients were readily identified for their sub-genotypes or type by HCV GT Plus. The concordance rate increased 65.2% (15/23) between HCV GT Plus and direct sequencing method. Our results thus provided the comparison between the 2 assays in clinical application. The discordant results between assays may also raise the concern of potential limitations for clinical precise diagnosis.

The Abbott Realtime HCV Plus RUO assay is an automated HCV genotyping method specifically targets the HCV core region with multiple TaqMan probes for HCV genotypes 1a, 1b, and 6. Addition of Core motifs could improve the discrimination between G-1 and G-6 [41].

Our results found that HCV GT Plus for G-1 group whether in the detection rate (93.7% vs. 62.2%, p = 0.10) or concordance (84.7% vs. 65.2%, p = 0.009) was better than indeterminate group.

The samples that have preliminary results from HCV GT II, the higher proportions genotype results will obtain by HCV Plus or direct sequencing.

For the indeterminate group, the detection rate was only 62.2%, 10 of 14 samples (37.8%) showed not detected due to 15 subtypes of type 2 [37] that HCV GT II cannot cover all subtypes and HCV GT Plus enhancements for 1a, 1b and type 6 only.

The HCV GT Plus could also potentially be used to resolve high rate (up to 34.9%) of misidentifying genotype 6 samples as genotype 1, confirmed by 5' UTR direct sequencing.

A variety of genotyping auxiliary methods (such as Okamoto typing or direct sequencing) have limitations in the past. Okamoto typing can only detect 1a, 1b, 2a, 2b and 3a, respectively [21]. Direct sequencing will also have some differences in the results due to the region selected by the primer’s position (5’untranslated region, core or Nonstructural protein 5B [42, 43].

Despite design limitations (core region for 1a, 1b, and 6 only, but 99% to be attributable to subtypes 1a and 1b and inability to detect all subtype of G-1 and G-6, the HCV Plus completes HCV GT II well and thus helps to overcome the shortcomings of the HCVGT II assay design, significantly reduced the frequency of G-1 without subtype results, while also providing the ability to identify G-6, reliably characterized confirmed by 5' UTR sequencing. Regardless of cost or time spent, HCV GT Plus assay is lower than direct sequencing. As far as auxiliary testing is concerned, HCV GT Plus assay is more convenient and cheaper than direct sequencing. Therefore, we recommend that Abbott RealTime HCV Genotype II Assay should be collocated with HCV GT Plus assay.

Conclusions

The shortcomings of Abbott RealTime HCV GT II assay without subtype (ST) of type1 and genotype (GT) of indeterminate can be further resolved and reliably characterized by the new Abbott RealTime HCV GT Plus RUO assay in certain ambiguous samples.

Acknowledgments

We are very grateful to Pey-Fang Wu and Yu-Fen Wang for giving suggestions to improve the manuscript.

References

  1. 1. Yuasa T, Ishikawa G, Manabe S, Sekiguchi S, Takeuchi K, Miyamura T. The particle size of hepatitis C virus estimated by filtration through microporous regenerated cellulose fibre. The Journal of general virology. 1991;72 (Pt 8):2021–4. pmid:1714947
  2. 2. Sievert W, Altraif I, Razavi HA, Abdo A, Ahmed EA, Alomair A, et al. A systematic review of hepatitis C virus epidemiology in Asia, Australia and Egypt. Liver international: official journal of the International Association for the Study of the Liver. 2011;31 Suppl 2:61–80. pmid:21651703
  3. 3. Sarah Blach SZ, Michael Manns, et al. Global prevalence and genotype distribution of hepatitis C virus infection in 2015: a modelling study. The lancet Gastroenterology & hepatology. 2017;2(3):161–76. pmid:28404132
  4. 4. Buti M, Domínguez-Hernández R, Casado M, Sabater E, Esteban R. Healthcare value of implementing hepatitis C screening in the adult general population in Spain. PloS one. 2018;13(11):e0208036. pmid:30485377
  5. 5. Huang JF, Lu SN, Chue PY, Lee CM, Yu ML, Chuang WL, et al. Hepatitis C virus infection among teenagers in an endemic township in Taiwan: epidemiological and clinical follow-up studies. Epidemiology and infection. 2001;127(3):485–92. pmid:11811882
  6. 6. Wang JH, Lu SN, Wu JC, Huang JF, Yu ML, Chen SC, et al. A hyperendemic community of hepatitis B virus and hepatitis C virus infection in Taiwan. Transactions of the Royal Society of Tropical Medicine and Hygiene. 1999;93(3):253–4. pmid:10492752
  7. 7. Yang JF, Lin CI, Huang JF, Dai CY, Lin WY, Ho CK, et al. Viral hepatitis infections in southern Taiwan: a multicenter community-based study. The Kaohsiung journal of medical sciences. 2010;26(9):461–9. pmid:20837342
  8. 8. Gower E, Estes C, Blach S, Razavi-Shearer K, Razavi H. Global epidemiology and genotype distribution of the hepatitis C virus infection. Journal of hepatology. 2014;61(1 Suppl):S45–57. pmid:25086286
  9. 9. Messina JP, Humphreys I, Flaxman A, Brown A, Cooke GS, Pybus OG, et al. Global distribution and prevalence of hepatitis C virus genotypes. Hepatology (Baltimore, Md). 2015;61(1):77–87. pmid:25069599
  10. 10. Yu ML, Chuang WL, Lu SN, Chen SC, Wang JH, Lin ZY, et al. The genotypes of hepatitis C virus in patients with chronic hepatitis C virus infection in southern Taiwan. The Kaohsiung journal of medical sciences. 1996;12(11):605–12. pmid:8953853
  11. 11. Bruno S, Silini E, Crosignani A, Borzio F, Leandro G, Bono F, et al. Hepatitis C virus genotypes and risk of hepatocellular carcinoma in cirrhosis: a prospective study. Hepatology (Baltimore, Md). 1997;25(3):754–8. pmid:9049231
  12. 12. Lee MH, Yang HI, Lu SN, Jen CL, You SL, Wang LY, et al. Hepatitis C virus genotype 1b increases cumulative lifetime risk of hepatocellular carcinoma. International journal of cancer. 2014;135(5):1119–26. pmid:24482200
  13. 13. Huang CF, Huang CI, Yeh ML, Huang JF, Hsieh MY, Lin ZY, et al. Host and virological characteristics of patients with hepatitis C virus mixed genotype 1 and 2 infection. The Kaohsiung journal of medical sciences. 2015;31(5):271–7. pmid:25910563
  14. 14. Poynard T, Mathurin P, Lai CL, Guyader D, Poupon R, Tainturier MH, et al. A comparison of fibrosis progression in chronic liver diseases. Journal of hepatology. 2003;38(3):257–65. pmid:12586290
  15. 15. Huang CF, Chuang WL, Yu ML. Chronic hepatitis C infection in the elderly. The Kaohsiung journal of medical sciences. 2011;27(12):533–7. pmid:22208535
  16. 16. Paraschiv S, Banica L, Nicolae I, Niculescu I, Abagiu A, Jipa R, et al. Epidemic dispersion of HIV and HCV in a population of co-infected Romanian injecting drug users. PloS one. 2017;12(10):e0185866. pmid:29016621
  17. 17. Huang JF, Huang CF, Yeh ML, Dai CY, Yu ML, Chuang WL. Updates in the management and treatment of HCV genotype 3, what are the remaining challenges? Expert review of anti-infective therapy. 2018;16(12):907–12. pmid:30396303
  18. 18. Huang JF, Yu ML, Dai CY, Hsieh MY, Hwang SJ, Hsiao PJ, et al. Reappraisal of the characteristics of glucose abnormalities in patients with chronic hepatitis C infection. The American journal of gastroenterology. 2008;103(8):1933–40. pmid:18637090
  19. 19. Huang JF, Huang CF, Yeh ML, Dai CY, Hsieh MH, Yang JF, et al. The outcomes of glucose abnormalities in chronic hepatitis C patients receiving interferon-free direct antiviral agents. The Kaohsiung journal of medical sciences. 2017;33(11):567–71. pmid:29050674
  20. 20. Huang JF, Chuang WL, Yu ML, Yu SH, Huang CF, Huang CI, et al. Hepatitis C virus infection and metabolic syndrome—a community-based study in an endemic area of Taiwan. The Kaohsiung journal of medical sciences. 2009;25(6):299–305. pmid:19560994
  21. 21. Chen CH, Sheu JC, Wang JT, Huang GT, Yang PM, Lee HS, et al. Genotypes of hepatitis C virus in chronic liver disease in Taiwan. Journal of medical virology. 1994;44(3):234–6. pmid:7852966
  22. 22. Yu ML, Chuang WL, Chen SC, Dai CY, Hou C, Wang JH, et al. Changing prevalence of hepatitis C virus genotypes: molecular epidemiology and clinical implications in the hepatitis C virus hyperendemic areas and a tertiary referral center in Taiwan. Journal of medical virology. 2001;65(1):58–65. pmid:11505444
  23. 23. Lim SG, Aghemo A, Chen PJ, Dan YY, Gane E, Gani R, et al. Management of hepatitis C virus infection in the Asia-Pacific region: an update. The lancet Gastroenterology & hepatology. 2017;2(1):52–62. pmid:28404015
  24. 24. Tapper EB, Catana AM, Sethi N, Mansuri D, Sethi S, Vong A, et al. Direct costs of care for hepatocellular carcinoma in patients with hepatitis C cirrhosis. Cancer. 2016;122(6):852–8. pmid:26716758
  25. 25. Tsai PC, Liu TW, Hsieh MH, Yeh ML, Liang PC, Lin YH, et al. A real-world impact of cost-effectiveness of pegylated interferon/ribavarin regimens on treatment-naïve chronic hepatitis C patients in Taiwan. The Kaohsiung journal of medical sciences. 2017;33(1):44–9. pmid:28088273
  26. 26. Benedet M, Adachi D, Wong A, Wong S, Pabbaraju K, Tellier R, et al. The need for a sequencing-based assay to supplement the Abbott m2000 RealTime HCV Genotype II assay: a 1 year analysis. Journal of clinical virology: the official publication of the Pan American Society for Clinical Virology. 2014;60(3):301–4. pmid:24794397
  27. 27. Yang R, Cong X, Du S, Fei R, Rao H, Wei L. Performance comparison of the versant HCV genotype 2.0 assay (LiPA) and the abbott realtime HCV genotype II assay for detecting hepatitis C virus genotype 6. Journal of clinical microbiology. 2014;52(10):3685–92. pmid:25100817
  28. 28. He C, Germer JJ, Ptacek ER, Bommersbach CE, Mitchell PS, Yao JDC. Utility of the Abbott RealTime HCV Genotype Plus RUO assay used in combination with the Abbott RealTime HCV Genotype II assay. Journal of clinical virology: the official publication of the Pan American Society for Clinical Virology. 2018;99–100:97–100. pmid:29396354
  29. 29. Mallory MA, Lucic D, Ebbert MT, Cloherty GA, Toolsie D, Hillyard DR. Evaluation of the Abbott RealTime HCV genotype II plus RUO (PLUS) assay with reference to core and NS5B sequencing. Journal of clinical virology: the official publication of the Pan American Society for Clinical Virology. 2017;90:26–31.
  30. 30. Mokhtari C, Ebel A, Reinhardt B, Merlin S, Proust S, Roque-Afonso AM. Characterization of Samples Identified as Hepatitis C Virus Genotype 1 without Subtype by Abbott RealTime HCV Genotype II Assay Using the New Abbott HCV Genotype Plus RUO Test. Journal of clinical microbiology. 2016;54(2):296–9. pmid:26582834
  31. 31. Simmonds P, Becher P, Bukh J, Gould EA, Meyers G, Monath T, et al. ICTV Virus Taxonomy Profile: Flaviviridae. The Journal of general virology. 2017;98(1):2–3. pmid:28218572
  32. 32. Borgia SM, Hedskog C, Parhy B, Hyland RH, Stamm LM, Brainard DM, et al. Identification of a Novel Hepatitis C Virus Genotype From Punjab, India: Expanding Classification of Hepatitis C Virus Into 8 Genotypes. The Journal of infectious diseases. 2018;218(11):1722–9. pmid:29982508
  33. 33. Safi MA. Hepatitis C: an Overview of Various Laboratory Assays with their Mode of Diagnostic Cooperation. Clinical laboratory. 2017;63(5):855–65. pmid:28627823
  34. 34. Schnell G, Krishnan P, Tripathi R, Beyer J, Reisch T, Irvin M, et al. Hepatitis C virus genetic diversity by geographic region within genotype 1–6 subtypes among patients treated with glecaprevir and pibrentasvir. PloS one. 2018;13(10):e0205186. pmid:30286205
  35. 35. Dev AT, McCaw R, Sundararajan V, Bowden S, Sievert W. Southeast Asian patients with chronic hepatitis C: the impact of novel genotypes and race on treatment outcome. Hepatology (Baltimore, Md). 2002;36(5):1259–65. pmid:12395338
  36. 36. Yu ML, Chuang WL. Treatment of chronic hepatitis C in Asia: when East meets West. Journal of gastroenterology and hepatology. 2009;24(3):336–45. pmid:19335784
  37. 37. McCaughan GW, Omata M, Amarapurkar D, Bowden S, Chow WC, Chutaputti A, et al. Asian Pacific Association for the Study of the Liver consensus statements on the diagnosis, management and treatment of hepatitis C virus infection. Journal of gastroenterology and hepatology. 2007;22(5):615–33. pmid:17444847
  38. 38. Lu L, Nakano T, He Y, Fu Y, Hagedorn CH, Robertson BH. Hepatitis C virus genotype distribution in China: predominance of closely related subtype 1b isolates and existence of new genotype 6 variants. Journal of medical virology. 2005;75(4):538–49. pmid:15714489
  39. 39. Wasitthankasem R, Vongpunsawad S, Siripon N, Suya C, Chulothok P, Chaiear K, et al. Genotypic distribution of hepatitis C virus in Thailand and Southeast Asia. PloS one. 2015;10(5):e0126764. pmid:25962112
  40. 40. Lee YM, Lin HJ, Chen YJ, Lee CM, Wang SF, Chang KY, et al. Molecular epidemiology of HCV genotypes among injection drug users in Taiwan: Full-length sequences of two new subtype 6w strains and a recombinant form_2b6w. Journal of medical virology. 2010;82(1):57–68. pmid:19950240
  41. 41. Bouchardeau F, Cantaloube JF, Chevaliez S, Portal C, Razer A, Lefrère JJ, et al. Improvement of hepatitis C virus (HCV) genotype determination with the new version of the INNO-LiPA HCV assay. Journal of clinical microbiology. 2007;45(4):1140–5. pmid:17251399
  42. 42. Laperche S, Lunel F, Izopet J, Alain S, Dény P, Duverlie G, et al. Comparison of hepatitis C virus NS5b and 5' noncoding gene sequencing methods in a multicenter study. Journal of clinical microbiology. 2005;43(2):733–9. pmid:15695672
  43. 43. Hara K, Rivera MM, Koh C, Sakiani S, Hoofnagle JH, Heller T. Important factors in reliable determination of hepatitis C virus genotype by use of the 5' untranslated region. Journal of clinical microbiology. 2013;51(5):1485–9. pmid:23467599